Home Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
Article Open Access

Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy

  • Changsheng Wang EMAIL logo , Rongsheng Chen , Xitian Zhu and Xiaobo Zhang
Published/Copyright: November 22, 2022
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 17 Issue 1

Abstract

This study aimed to explore the effects of long non-coding RNAs LINC00689 (LINC00689) in human nucleus pulposus cells (NPCs). NPCs were isolated and their morphology was observed. The proliferation and apoptosis of NPCs, and the levels of LINC00689, miR-3127-5p, Bax, Bcl-2, Cleaved caspase-3, ATG5, ATG7, p62, and LC3Ⅱ/LC3I were detected. Interrelations of LINC00689, miR-3127-5p, and ATG7 were analyzed. LINC00689 was down-regulated yet miR-3127-5p was up-regulated in NPCs. LINC00689 could competitively bind with miR-3127-5p, and ATG7 was targeted by miR-3127-5p in NPCs. Overexpressed LINC00689 promoted proliferation yet inhibited apoptosis of NPCs, whereas LINC00689 silencing did the opposite. Overexpressed LINC00689 raised ATG7 level and LC3Ⅱ/LC3I value yet reduced that of p62 level, but the depletion of LINC00689 did the contrary. ATG7 silencing abolished the effects of overexpressed LINC00689 in NPCs, and likewise, up-regulation of miR-3127-5p overturned the effects of overexpressed LINC00689 in NPCs. Collectively, the up-regulation of LINC00689 inhibits the apoptosis of NPCs via miR-3127-5p/ATG7 axis-mediated autophagy.

Keywords: intervertebral disc degeneration; LINC00689; MiR-3127-5p; ATG7; autophagy

1 Introduction

The intervertebral disc (IVD) is an important part of the spinal column and plays a key role in the spinal movement and the intervertebral juncture in general [1]. As a typical common disease in clinical practice, IVD degeneration (IDD) is the pathological basis of spinal degenerative diseases, which can cause a series of clinical syndromes such as disc herniation, low back pain, and cervical spondylosis [2–4]. Relevant investigation has shown that various diseases caused by IDD tremendously decrease the life quality of patients [5]. Currently, many treatment modalities for IDD have been developed, including tissue engineering, stem cell injections, and therapeutic protein administrations [6]. In addition to the discovery highlighting IDD as the result of a combination of factors, recent studies have further demonstrated that genetic factors play an important role in the occurrence of IDD [7]. Therefore, gene therapy for IDD has received increasing attention and research in recent years [8].

Increasing findings have shown that abnormal expression of genetic factors occurs in the development and progression of IDD [9]. Long non-coding RNAs (lncRNAs) are a class of non-coding RNAs with transcripts more than 200 nucleotides in length [10]. LncRNAs do not code for proteins, resulting in their lack of attention by scholars in the initial period of time; however, in recent years, a large number of studies have proposed the involvement of lncRNAs in the progression of various diseases [11,12]. Similarly, lncRNAs participated in the progression of osteoarthritis and IDD, such as lncRNA HOTAIR, lncRNA TUG1, and lncRNA MAGI2-AS3 [13–15]. Moreover, a previous study has reported that lncRNA LINC00689 expression was down-regulated in IDD [9]. Nevertheless, its effect in IDD awaits to be further elucidated.

In accordance with the results of the existing study, the involvement of lncRNA–miRNA–mRNA network in IDD has been indicated [9]. A previous study has profiled that lncRNA prostate androgen-regulated transcript 1 (lncRNA PART1) expression was increased in lipopolysaccharide-treated human nucleus pulposus cells (NPCs) and that the up-regulation of lncRNA PART1 promoted the progression of IDD via targeting miR-190a-3p [16]. Interestingly, the up-regulated expression of miR-3127-5p in IDD samples has been evidenced, suggesting that miR-3127-5p may also be involved in the development of IDD [9]. What additionally caught our attention is the discovery that Metformin increased paclitaxel sensitivity of ovarian cancer cells via miR-3127-5p-mediated autophagy [17]. Meanwhile, it has been documented in several studies that the senescence of NPCs plays a vital role in the pathogenesis and development of IDD [18,19]. Furthermore, a number of researchers have reported that activating the autophagy of NPCs reduced cellular senescence and apoptosis [20,21]. Therefore, we speculated that the down-regulation of LINC00689 could promote the apoptosis of NPCs via miR-3127-5p-mediated autophagy.

In this work, we evaluated the expressions of LINC00689 and miR-3127-5p in NP tissues and cells. Moreover, we investigated the interaction between LINC00689 and miR-3127-5p in the autophagy of NPCs, with the hope to provide new insights into the gene therapy for IDD.

2 Materials and methods

2.1 Ethics statement and tissue samples collection

This study was approved by the Ethics Committee of First Affiliated Hospital of Fujian Medical University (ZL2020080215). Ten degenerative IVD NP tissues (IDD group) were obtained from ten patients (including five females and five males, with a mean age of 54 ± 10 years old) with lumbar disc herniation (LDH). All patients were diagnosed with LDH and underwent lumbar spine surgery at the Orthopedic Department of our hospital between September 2020 and February 2021. Meanwhile, ten normal IVD NP tissues were obtained from ten patients (including five females and five males, with a mean age of 52 ± 10 years old) with lumbar vertebrae fractures (LVF). The informed consent was obtained from all patients before tissue samples were collected.

2.2 Extraction, culture, and observation of NPCs

The NPCs were isolated using the method as previously described [4]. First, the collected NP tissues were cut with a size of 1 mm3 and incubated with trypsin (0.25%, PB180228, Procell, Wuhan, China) for 30 min, followed by centrifugation at 1,000g (E2658, Beyotime, Shanghai, China) for 10 min and incubation with collagenase type II (40508ES60, Qcbio Science & Technologies Co., Ltd, Shanghai, China) at 37°C for 4 h. Later, the treated NP tissues were filtered with a 200-mesh filter (S4203, Aladdin, Shanghai, China), maintained in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F medium (with the inclusion of 1% penicillin–streptomycin mixture solution, PM150312A, Procell, Wuhan, China) supplemented with 20% of fetal bovine serum (164210, Procell, Wuhan, China) and cultured in an incubator (BC-J80, BoXun, Shanghai, China) at 37°C with 5% CO2. The cell medium was replaced 2–3 times a week.

When the NPCs grew attached, the morphology of primary NPCs was observed (magnification 200×) under an inverted microscope (Ts2-FL, Nikon, Tokyo, Japan) as appropriate. NPCs with passage ≤3 (P ≤ 3) were used for the subsequent experiments in the present study [22–24].

2.3 Bioinformatic analysis

The upstream miRNAs of autophagy related 7 (ATG7) were analyzed by the following websites, including: Starbase (http://starbase.sysu.edu.cn/index.php), TargetScan (http://www.targetscan.org/vert_72/), and LncBase Predicted v.2 (http://carolina.imis.athena-innovation.gr/diana_tools/web/). Following the analysis of the data, we obtained five potential upstream miRNAs of ATG7 (miR-3127-5p, miR-769-5p, miR-3179, miR-129-5p, and miR-766-5p). Moreover, the interrelations of LINC00689, miR-3127-5p, and ATG7 were predicted by Targetscan and Starbase.

2.4 Cell transfection

The small interfering RNA specifically targeting LINC00689 (siLINC00689) and its negative control (siNC), the overexpression plasmid of LINC00689 and its negative control (NC, pcDNA3.1 vector), as well as the small interfering RNAs targeting ATG7 (siATG7) were synthesized and purchased from GenePharma (Shanghai, China). Besides, miR-3127-5p mimic (abbreviated as M in the figures, miR10014990-1-5) and mimic control (abbreviated as MC in the figures, miR1N0000002-1-5) were ordered from RiboBio (Guangzhou, China).

For cell transfection, NPCs were grown in 6-well plates (5 × 105 cells/well). Then, cells at a confluence of 80% were transfected with siLINC00689 (100 pmol), siNC (100 pmol), LINC00689 (5 μg), NC (5 μg), siATG7 (100 pmol), miR-3127-5p M (100 nM), or MC (100 nM) at room temperature for 48 h, which was performed with the help of lipofectamine 3000 reagent (L3000015, Thermo Fisher Scientific, Waltham, MA, USA).

2.5 Dual-luciferase reporter assay

The binding sites in between ATG7 and miR-3127-5p and between LINC00689 and miR-3127-5p were confirmed by dual-luciferase reporter assay kit (RG027, Beyotime, Shanghai, China). The wild-type sequence of ATG7 (ATG7-WT: 5′-GAUCCUUUCCCCUUGGCCCUGAG-3′), mutant sequence of ATG7 (ATG7-MUT: 5′-GAUCCUUUCCCCUUGGCCCCAAG-3′), wild type sequence of LINC00689 (LINC00689-WT: 5′-CGACUGGAGGGUCUUGCCCUGAG-3′), and mutant sequence of LINC00689 (LINC00689-MUT: 5′-CGACUGGAGGGUCUUGAACUCAG-3′) were structured and sub-cloned into pGL3 luciferase reporter vectors by GenePharma Company (Shanghai, China).

To verify the relationship between ATG7 and miR-3127-5p, HEK293T cells (CL-0005, Procell, Wuhan, China) were co-transfected with 0.25 μg ATG7-WT/ATG7-MUT plasmids and 50 nM miR-3127-5p mimic/mimic control. Likewise, to verify the relationship between LINC00689 and miR-3127-5p, HEK293T cells were co-transfected with 0.25 μg LINC00689-WT/LINC00689-MUT plasmids and 50 nM miR-3127-5p mimic/mimic control. Following the culture of HEK293T cells for 48 h, the relative luciferase activity was evaluated using the dual-luciferase reporter assay kit and the microplate reader (GM3000, Promega, Madison, WI, USA).

2.6 Cell proliferation assay

The proliferation of NPCs was measured by the EdU Cell Proliferation Kit (C0071S, Beyotime, Shanghai, China). Prior to this assay, the Click Additive Solution, EdU reagent, and Hoechst 33342 reagent were prepared with the help of EdU Cell Proliferation Kit. NPCs were maintained in 6-well plates (5 × 105 cells/well) and transfected as instructed. Cells were then incubated with EdU reagent at 37°C for 2 h, after which these cells were fixed with 4% paraformaldehyde (P0099, Beyotime, Shanghai, China) and washed with wash buffer as appropriate. Afterwards, cells were incubated with immunol staining wash buffer (P0106, Beyotime, Shanghai, China) at room temperature for 15 min, and then treated with Click Additive Solution for 30 min in the dark, followed by the staining with Hoechst 33342 reagent at room temperature for 10 min in the dark. Finally, cells were washed with wash buffer and observed (magnification 200×) under a fluorescence microscope (MVX10, OLYMPUS, Tokyo, Japan).

2.7 Cell apoptosis assay

In this assay, the apoptosis of NPCs was measured using the Annexin V-FITC/Propidium Iodide Apoptosis Detection Kit (C1062M, Beyotime, Shanghai, China). Specifically, the treated NPCs were washed with PBS (C0221A, Beyotime, Shanghai, China), digested with trypsin solution, and resuspended with PBS. An appropriate amount (5 × 104) of NPCs was resuspended with 195 μL AnnexinV-FITC conjugated solution, and then the cells were treated with 5 μL of Annexin V-FITC and 10 μL of propidium iodide at room temperature for 15 min. Finally, the flow cytometer (CytoFLEX, Beckman Coulter, Inc., Kraemer Boulevard Brea, CA, USA) was used to assess the apoptosis of NPCs, and the results were analyzed with the help of Kaluza C software (v. 1.1.2, Beckman Coulter, Indianapolis, IN, USA).

2.8 Quantitative RT-PCR (qRT-PCR)

In this work, qRT-PCR was performed on the qRT-PCR system (ABI7700, Applied Biosystems, Carlsbad, CA, USA). The tissue samples and transfected NPCs were harvested prior to the analysis of qRT-PCR. TransZol Up Plus RNA Kit (ER501-01) was purchased from TransGen Biotech (Beijing, China) and employed to extract the total RNA from the collected tissues and cells. The concentration of isolated RNA samples was evaluated using a spectrophotometer (Cary 60 UV-Vis, Agilent, Santa Clara, CA, USA). Next, using RNA as template, the cDNA was synthesized with the help of First-Strand Synthesis System (18091050, Thermo Fisher Scientific, Waltham, MA, USA), and the reaction mix solution for qRT-PCR was prepared by the Top Green qPCR SuperMix kit (AQ131-01, TransGen Biotech, Beijing, China). After the supplementation of cDNA synthesized above and the corresponding primers (Table 1), the qRT-PCR reaction mix solution was detected by the qRT-PCR system. The results in our study were analyzed with 2−ΔΔct method [25], and GAPDH or U6 was used as the endogenous control.

Table 1

All primers in qRT-PCR experiments in this study

ID Forward sequence (5′−3′) Reverse sequence (5′−3′)
LINC00689 AGTTGGTACAGGGAGGGGTT GTCCCTCTTGGTGGAGTTGG
miR-3127-5p CGGGCTTGTGGAATGGTAAGC CTGTCAGCTTCCCATTCC
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG

2.9 Western blot

The treated NPCs were harvested first, and the total protein was subsequently extracted from the treated cells (5 × 106) with the help of total protein extraction kit (C1396, Jining Shiye, Shanghai, China), after which the concentration of protein samples was calculated using the BCA protein assay kit (C1397, Jining Shiye, Shanghai, China). Later, SDS-PAGE gel (BB-3702, BestBio, Nanjing, China) was prepared and 20 μL of protein samples was electrophoresed on the prepared SDS-PAGE gel. Subsequently, the separated proteins were transferred onto the PVDF membrane (1620177) ordered from Bio-Rad (Hercules, CA, USA). Later, the PVDF membrane was blocked with Blocker™ BLOTTO TBS Buffer (37530, Thermo Fisher Scientific, Waltham, MA, USA) at room temperature for 1 h, and then washed with Western Wash Buffer (P0023C3, Beyotime, Shanghai, China). Next, the PVDF membrane was incubated with diluted solution of primary antibodies at 4°C overnight, and then incubated with secondary antibodies at room temperature for 1 h. Lastly, PVDF membrane was visualized by ECL solution (1705062, Bio-Rad, Hercules, CA, USA), and the results were analyzed using the Western blot imaging system (ChemiDoc XRS+, Bio-Rad, Hercules, CA, USA). The information of all antibodies used in this research is listed in Table 2.

Table 2

All antibodies information and sources in Western blot in this study

ID Catalog number Company (country) Molecular weight (kDa) Dilution ratio
Bax ab182733 Abcam (Cambridge, UK) 21 1/2,000
Bcl-2 ab182858 Abcam (Cambridge, UK) 26 1/2,000
Cleaved caspase-3 ab32042 Abcam (Cambridge, UK) 17 1/500
ATG5 ab108327 Abcam (Cambridge, UK) 32 1/1,000
ATG7 ab52472 Abcam (Cambridge, UK) 70 1/10,000
P62 ab109012 Abcam (Cambridge, UK) 62 1/10,000
LC3B ab192890 Abcam (Cambridge, UK) 14, 16 1/2,000
GAPDH ab181602 Abcam (Cambridge, UK) 36 1/10,000
Rabbit IgG ab205718 Abcam (Cambridge, UK) 1/5,000

2.10 Statistical analysis

In this study, all measured data were described as mean ± standard deviation (SD). The data of the LVF group and IDD group were compared by independent sample t-test. One-way analysis of variance (ANOVA) was used for the comparison among multiple groups, and Pearson’s correlation analysis was applied to evaluate the correlation between the expression levels of LINC00689 and miR-3127-5p. All statistical analyses were implemented using GraphPad 8.0 software. The data with P < 0.05 were considered as statistically significant.

3 Results

3.1 LINC00689 was down-regulated in IDD tissue, and overexpressed LINC00689 promoted the proliferation yet inhibited the apoptosis of NPCs, whereas LINC00689 silencing did the opposite

The NP tissues were collected at first, and the level of LINC00689 in the tissue samples was then measured by qRT-PCR. The results suggested that the level of LINC00689 was down-regulated in IDD group as compared with that in LVF group (Figure 1a, P < 0.001). Next, the NPCs were extracted from the tissue samples and then the morphology of NPCs was observed as appropriate. It was seen that the morphology of NPCs in LVF group was mostly polygonal and fusiform, whereas that of NPCs in IDD group was mostly irregular and fusiform (Figure 1b). As such, these NPCs which had been isolated from NP tissues in IDD group were collected for the following study.

Figure 1 The level of LINC00689 was down-regulated in IDD tissue. (a) The level of LINC00689 in NP tissue samples was measured by qRT-PCR, and the expression of LINC00689 was lower in IDD group than that in LVF group. (b) The NPCs were extracted from collected NP tissues, and then the cell morphology of NPCs was observed under an inverted microscope (under 200× magnification, scale bar = 50 μm). (c) The expression of LINC00689 in transfected NPCs was measured by qRT-PCR. ^^^ P < 0.001 vs LVF; *** P < 0.001 vs NC; ### P < 0.001 vs siNC (LINC00689: long non-coding RNA LINC00689, IDD: intervertebral disc degeneration, LVF: lumbar vertebrae fractures, NPCs: human nucleus pulposus cells, NP: nucleus pulposus, siLINC00689: small interfering RNA specifically targeting LINC00689, NC: negative control, qRT-PCR: quantitative RT-PCR).
Figure 1

The level of LINC00689 was down-regulated in IDD tissue. (a) The level of LINC00689 in NP tissue samples was measured by qRT-PCR, and the expression of LINC00689 was lower in IDD group than that in LVF group. (b) The NPCs were extracted from collected NP tissues, and then the cell morphology of NPCs was observed under an inverted microscope (under 200× magnification, scale bar = 50 μm). (c) The expression of LINC00689 in transfected NPCs was measured by qRT-PCR. ^^^ P < 0.001 vs LVF; *** P < 0.001 vs NC; ### P < 0.001 vs siNC (LINC00689: long non-coding RNA LINC00689, IDD: intervertebral disc degeneration, LVF: lumbar vertebrae fractures, NPCs: human nucleus pulposus cells, NP: nucleus pulposus, siLINC00689: small interfering RNA specifically targeting LINC00689, NC: negative control, qRT-PCR: quantitative RT-PCR).

NPCs were transfected with LINC00689 overexpression plasmids or siLINC00689 or the corresponding NC as needed. The results of qRT-PCR showed that LINC00689 expression was up-regulated by the overexpression plasmids of LINC00689 yet down-regulated by siLINC00689 (Figure 1c, P < 0.001). Subsequently, we found that the number of EdU-positive cells was elevated by the overexpression plasmids of LINC00689 and decreased by siLINC00689, suggesting that the proliferation of NPCs was promoted by the overexpression of LINC00689 yet inhibited by the silence of LINC00689 (Figure 2a). Furthermore, overexpressed LINC00689 remarkably reduced the apoptosis of NPCs, while LINC00689 silencing evidently accelerated the apoptosis of NPCs (Figure 2b, P < 0.001). In addition, we examined the expressions of apoptosis-related factors (Bax, Bcl-2, and Cleaved caspase-3) in the transfected NPCs. It was observed in these results that overexpressed LINC00689 inhibited the levels of Bax and Cleaved caspase-3, while promoting the level of Bcl-2 (Figure 2c, P < 0.001). On the contrary, LINC00689 silencing increased the levels of Bax and Cleaved caspase-3, but decreased the level of Bcl-2 in NPCs (Figure 2c, P < 0.05). These data demonstrated that overexpressed LINC00689 promoted the proliferation yet inhibited the apoptosis of NPCs, whereas LINC00689 silencing exerted the opposite effects. Therefore, we hypothesized that LINC00689, with an aberrant expression, was involved in the progression of IDD.

Figure 2 Overexpressed LINC00689 promoted the proliferation and autophagy yet inhibited the apoptosis of NPCs, whereas siLINC00689 did the opposite. (a) The proliferation of NPCs was measured by EdU staining after NPCs were transfected with LINC00689 overexpression plasmid or siLINC00689 (under 200× magnification, scale bar = 100 μm). (b) The apoptosis of NPCs was detected by flow cytometry. (c) The expressions of apoptosis-related factor (Bax, Bcl-2, and Cleaved caspase-3) in transfected NPCs were examined using the Western blot. (d) The levels of autophagy-related proteins (ATG5, ATG7, p62, and LC3Ⅱ/LC3I) in transfected NPCs were analyzed by the Western blot. *** P < 0.001 vs NC; # P < 0.05, ## P < 0.01, ### P < 0.001 vs siNC (LINC00689: long non-coding RNAs LINC00689, NPCs: human nucleus pulposus cells, siLINC00689: small interfering RNA specifically targeting LINC00689, NC: negative control, ATG7: autophagy related 7).
Figure 2

Overexpressed LINC00689 promoted the proliferation and autophagy yet inhibited the apoptosis of NPCs, whereas siLINC00689 did the opposite. (a) The proliferation of NPCs was measured by EdU staining after NPCs were transfected with LINC00689 overexpression plasmid or siLINC00689 (under 200× magnification, scale bar = 100 μm). (b) The apoptosis of NPCs was detected by flow cytometry. (c) The expressions of apoptosis-related factor (Bax, Bcl-2, and Cleaved caspase-3) in transfected NPCs were examined using the Western blot. (d) The levels of autophagy-related proteins (ATG5, ATG7, p62, and LC3Ⅱ/LC3I) in transfected NPCs were analyzed by the Western blot. *** P < 0.001 vs NC; # P < 0.05, ## P < 0.01, ### P < 0.001 vs siNC (LINC00689: long non-coding RNAs LINC00689, NPCs: human nucleus pulposus cells, siLINC00689: small interfering RNA specifically targeting LINC00689, NC: negative control, ATG7: autophagy related 7).

3.2 Overexpressed LINC00689 inhibited the apoptosis of NPCs via activating ATG7-dependent canonical autophagy in NPCs, whereas LINC00689 silencing exerted the opposite effect

Activation of autophagy in NPCs has been found to decrease cellular senescence and apoptosis [26]. In light of this, we measured the levels of autophagy-related proteins (ATG5, ATG7, p62, and LC3II/LC3I) in transfected NPCs. As shown in Figure 2d, the overexpression of LINC00689 raised the ATG7 level and LC3II/LC3I value, while reducing the p62 level (P < 0.001). However, the knockdown of LINC00689 markedly weakened ATG7 level and LC3II/LC3I value, but elevated the p62 level in NPCs (Figure 2d, P < 0.01). Furthermore, ATG7 silencing abolished the effects of overexpressed LINC00689 on promoting ATG7 level and LC3II/LC3I value and on inhibiting p62 expression (Figure 3a, P < 0.001). Subsequently, the apoptosis of transfected NPCs was analyzed, the results of which showed that the overexpression of LINC00689 notably repressed the apoptosis of NPCs (P < 0.001). Conversely, the knockdown of ATG7 decreased the suppressive effect of overexpressed LINC00689 on the apoptosis of NPCs (Figure 3b, P < 0.001). These data herein suggested that overexpressed LINC00689 inhibited the apoptosis of NPCs via activating ATG7-dependent canonical autophagy in NPCs, whereas LINC00689 silencing exerted the opposite effect.

Figure 3 SiATG7 abolished the effect of overexpressed LINC00689 on promoting the autophagy and on inhibiting the apoptosis of NPCs. (a) The levels of autophagy-related proteins (ATG7, p62, and LC3Ⅱ/LC3I) were quantified by the Western blot. (b) Following the transfection of NPCs with LINC00689 overexpression plasmid and siATG7, the apoptosis of NPCs was detected by using flow cytometry. *** P < 0.001 vs NC; ### P < 0.001 vs LINC00689 (NPCs: human nucleus pulposus cells, ATG7: autophagy related 7).
Figure 3

SiATG7 abolished the effect of overexpressed LINC00689 on promoting the autophagy and on inhibiting the apoptosis of NPCs. (a) The levels of autophagy-related proteins (ATG7, p62, and LC3Ⅱ/LC3I) were quantified by the Western blot. (b) Following the transfection of NPCs with LINC00689 overexpression plasmid and siATG7, the apoptosis of NPCs was detected by using flow cytometry. *** P < 0.001 vs NC; ### P < 0.001 vs LINC00689 (NPCs: human nucleus pulposus cells, ATG7: autophagy related 7).

3.3 LINC00689 could competitively bind with miR-3127-5p, and ATG7 was targeted by miR-3127-5p in NPCs

As shown in Figure 4a, five potential upstream miRNAs that could target ATG7 were obtained, namely, miR-3127-5p, miR-769-5p, miR-3179, miR-129-5p, and miR-766-5p. A previous study has reported the high expression of miR-3127-5p in lumbar IDD [9]. Here, the complementary binding sites in between LINC00689/ATG7 and miR-3127-5p are shown in Figure 4b and c. Moreover, we found that the luciferase activity was decreased when NPCs were co-transfected with ATG7-WT or LINC00689-WT and miR-3127-5p mimic (Figure 4d and e, P < 0.001). Besides, there was no difference in the luciferase activity when NPCs were co-transfected with ATG7-MUT or LINC00689-MUT and miR-3127-5p mimic or mimic control. These results thus signified that ATG7 was indeed targeted by miR-3127-5p, and miR-3127-5p was further targeted by LINC00689 in NPCs. Additionally, miR-3127-5p expression was proved to be up-regulated in NP tissues of the IDD group when compared with that in LVF group (Figure 4f, P < 0.001). It was clearly mirrored in correlation analysis that LINC00689 expression was negatively correlated with miR-3127-5p expression in IDD tissues (Figure 4g, r = −0.684, P = 0.029). These results confirmed that LINC00689 could competitively bind with miR-3127-5p, the miRNA which could target ATG7 in IDD.

Figure 4 LINC00689 could competitively bind with miR-3127-5p, and ATG7 was targeted by miR-3127-5p in NPCs. (a) The upstream miRNAs of ATG7 were predicted by Starbase, TargetScan, and LncBase Predicted v.2 websites. By analyzing the data, five potential upstream miRNAs of ATG7 (miR-3127-5p, miR-769-5p, miR-3179, miR-129-5p, and miR-766-5p) were obtained. (b) TargetScan was used to predict the binding site of miR-3127-5p and ATG7. (c) The binding site of LINC00689 and miR-3127-5p was predicted via Starbase. (d and e) The interrelations of LINC00689, miR-3127-5p, and ATG7 were analyzed using dual-luciferase reporter assay. (f) The level of miR-3127-5p in NP tissue samples was measured by qRT-PCR. (g) The correlation between miR-3127-5p and LINC00689 levels was analyzed. ^^^ P < 0.001 vs MC; *** P < 0.001 vs LVF (NPCs: human nucleus pulposus cells, qRT-PCR: quantitative RT-PCR, M: miR-3127-5p mimic, MC: mimic control, LVF: lumbar vertebrae fractures, IDD: intervertebral disc degeneration, ATG7: autophagy related 7, NP: nucleus pulposus).
Figure 4

LINC00689 could competitively bind with miR-3127-5p, and ATG7 was targeted by miR-3127-5p in NPCs. (a) The upstream miRNAs of ATG7 were predicted by Starbase, TargetScan, and LncBase Predicted v.2 websites. By analyzing the data, five potential upstream miRNAs of ATG7 (miR-3127-5p, miR-769-5p, miR-3179, miR-129-5p, and miR-766-5p) were obtained. (b) TargetScan was used to predict the binding site of miR-3127-5p and ATG7. (c) The binding site of LINC00689 and miR-3127-5p was predicted via Starbase. (d and e) The interrelations of LINC00689, miR-3127-5p, and ATG7 were analyzed using dual-luciferase reporter assay. (f) The level of miR-3127-5p in NP tissue samples was measured by qRT-PCR. (g) The correlation between miR-3127-5p and LINC00689 levels was analyzed. ^^^ P < 0.001 vs MC; *** P < 0.001 vs LVF (NPCs: human nucleus pulposus cells, qRT-PCR: quantitative RT-PCR, M: miR-3127-5p mimic, MC: mimic control, LVF: lumbar vertebrae fractures, IDD: intervertebral disc degeneration, ATG7: autophagy related 7, NP: nucleus pulposus).

3.4 Up-regulation of miR-3127-5p reversed the effects of overexpressed LINC00689 on promoting the proliferation and autophagy and on inhibiting the apoptosis of NPCs

The results of qRT-PCR manifested that miR-3127-5p mimic notably enhanced the level of miR-3127-5p in NPCs (Figure 5a, P < 0.001). As depicted in Figure 5b, overexpressed LINC00689 inhibited the expression of miR-3127-5p, while miR-3127-5p mimic enhanced miR-3127-5p level and reversed the inhibitory effect of LINC00689 overexpression on miR-3127-5p expression in NPCs (Figure 5b, P < 0.001). Meanwhile, LINC00689 overexpression obviously facilitated the proliferation of NPCs, while overexpressed miR-3127-5p inhibited the proliferation of NPCs (Figure 5c). Additionally, the up-regulation of miR-3127-5p reversed the effect of LINC00689 overexpression on promoting the proliferation of NPCs (Figure 5c). Moreover, the apoptosis of NPCs was reduced following the overexpression of LINC00689 yet raised by the up-regulation of miR-3127-5p, and more importantly, the up-regulation of miR-3127-5p reversed the effect of overexpressed LINC00689 on inhibiting the apoptosis of NPCs (Figure 5d and e, P < 0.001).

Figure 5 Up-regulation of miR-3127-5p reversed the effect of overexpressed LINC00689 on promoting the proliferation and autophagy, and on inhibiting the apoptosis of NPCs. (a and b) The expression of miR-3127-5p in transfected NPCs was analyzed using the qRT-PCR. (c) The proliferation of NPCs was measured by EdU staining (under 200× magnification, scale bar = 100 μm). (d and e) The apoptosis of NPCs was detected by flow cytometer. (f) The expressions of apoptosis-related factors (Bax, Bcl-2, and Cleaved caspase-3) in transfected NPCs were examined using the Western blot. (g) The levels of autophagy-related proteins (ATG7, p62, and LC3Ⅱ/LC3I) in transfected NPCs were analyzed by the Western blot. ** P < 0.01, *** P < 0.001 vs MC (Figure 5a) or NC + MC (Figure 5b–g); ^^ P < 0.01, ^^^ P < 0.001 vs LINC00689 + MC; ### P < 0.001 vs NC + M. (LINC00689: long non-coding RNAs LINC00689, NPCs: human nucleus pulposus cells, M: miR-3127-5p mimic, MC: mimic control, NC: negative control, ATG7: autophagy related 7).
Figure 5

Up-regulation of miR-3127-5p reversed the effect of overexpressed LINC00689 on promoting the proliferation and autophagy, and on inhibiting the apoptosis of NPCs. (a and b) The expression of miR-3127-5p in transfected NPCs was analyzed using the qRT-PCR. (c) The proliferation of NPCs was measured by EdU staining (under 200× magnification, scale bar = 100 μm). (d and e) The apoptosis of NPCs was detected by flow cytometer. (f) The expressions of apoptosis-related factors (Bax, Bcl-2, and Cleaved caspase-3) in transfected NPCs were examined using the Western blot. (g) The levels of autophagy-related proteins (ATG7, p62, and LC3Ⅱ/LC3I) in transfected NPCs were analyzed by the Western blot. ** P < 0.01, *** P < 0.001 vs MC (Figure 5a) or NC + MC (Figure 5b–g); ^^ P < 0.01, ^^^ P < 0.001 vs LINC00689 + MC; ### P < 0.001 vs NC + M. (LINC00689: long non-coding RNAs LINC00689, NPCs: human nucleus pulposus cells, M: miR-3127-5p mimic, MC: mimic control, NC: negative control, ATG7: autophagy related 7).

The results of Western blot displayed that overexpressed LINC00689 suppressed the levels of Bax and Cleaved caspase-3 and promoted that of Bcl-2 in NPCs, while the overexpression of miR-3127-5p up-regulated the levels of Bax and Cleaved caspase-3 yet down-regulated the levels of Bcl-2 in NPCs (Figure 5f, P < 0.001). Also, the up-regulation of miR-3127-5p counteracted the effects of overexpressed LINC00689 on inhibiting the levels of Bax and Cleaved caspase-3 yet promoting the Bcl-2 level in NPCs (Figure 5f, P < 0.01). In addition, the up-regulation of LINC00689 raised the ATG7 level and LC3Ⅱ/LC3I value, while reducing p62 level (Figure 5g, P < 0.001). However, the overexpression of miR-3127-5p not only led to the inhibited ATG7 level and LC3Ⅱ/LC3I ratio and the promoted p62 level, but also reversed the effects of LINC00689 overexpression on increasing the ATG7 level and LC3Ⅱ/LC3I ratio yet decreasing the p62 expression in NPCs (Figure 5g, P < 0.001). These results suggested that up-regulation of miR-3127-5p has the ability to reverse the effects of LINC00689 overexpression on promoting the proliferation and autophagy and on inhibiting the apoptosis of NPCs.

4 Discussion

IDD is one of the main causes of back pain [27]. The IVD is comprised of the inner NP, which is encircled by the cartilaginous endplates and annulus fibrosis lying between the adjacent vertebral bodies and IVD [28]. It has already been suggested that the functional changes of NPCs are considered to be the initiating factors of IDD [28]. Additionally, current research has already shown that the molecular biological process of IDD is abnormally complex and that numerous cytokines and proteins, such as inflammatory factors, growth factors, and matrix-degrading enzymes, are abnormally expressed at the molecular level [27,29,30].

A great deal of researchers have reported that lncRNAs are involved in numerous processes, with the regulatory effects on gene expression [31]. In addition, dysregulated expression of lncRNAs is closely linked to many human diseases, such as neurological diseases, cancer, osteoarthritis, and IDD [32]. Similarly, aberrantly expressed lncRNAs are involved in the initiation and development of IDD by regulating the abnormal phenotypes of NPCs, the proliferation and apoptosis of cells, for instance [33]. In this study, some significant changes concerning the morphology of NPCs have been evidenced in IDD patients. It has been reported that lncRNA ANPODRT expression was reduced in degenerative NP tissues and that lncRNA ANPODRT inhibited the apoptosis of NPCs via activating Nrf2 signaling [34]. Chen et al. have demonstrated that LINC00324 level was increased in IDD patients, and LINC00324 may accelerate the IDD progression via up-regulating the expression of Fas ligand [35]. Also, recent evidence has additionally suggested that lncRNA LINC00689 expression was down-regulated in IDD, despite its vague effect in IDD, which awaited to be further elucidated [9]. In this research, we also found that LINC00689 expression was down-regulated in IDD tissue. Apart from this, for the first time, we found that overexpressed LINC00689 promoted the proliferation yet inhibited the apoptosis of NPCs, whereas LINC00689 silencing did the opposite. These results suggested that LINC00689 indeed regulated the biological behaviors of NPCs.

To further validate the experimental results above, we examined the expressions of apoptosis-related factors (Bax, Bcl-2, and Cleaved caspase-3) in treated NPCs as needed [36]. Bcl-2 family plays a vital role in the intrinsic apoptosis of cells. Bax and Bcl-2 belong to the Bcl-2-related family, in which Bcl-2 is an apoptosis inhibitor, while Bax is an apoptosis promoter [37,38]. Moreover, the cell apoptosis has been proposed to be orchestrated by caspases family, among which caspase-3 is responsible for the majority of proteolysis during apoptosis, making Cleaved caspase-3 level thereby considered as a marker for evaluating the apoptosis of cells [39]. In this study, we discovered that overexpressed LINC00689 inhibited the levels of Bax and Cleaved caspase-3, while promoting Bcl-2 level. On the contrary, the silence of LINC00689 increased the levels of Bax and Cleaved caspase-3 yet decreased the level of Bcl-2 in NPCs. In the previous studies it has been suggested that activating the autophagy of NPCs reduced cell senescence and apoptosis [20,21]. ATG5 and ATG7 are thought to be essential for the induction of autophagy [40]. A recent evidence has profiled that miR-210 promoted extracellular matrix degradation via suppressing ATG7-mediated autophagy in human degenerated NPCs [41]. Additionally, p62 and LC3Ⅱ/LC3I belong to the autophagy-related proteins, of which p62 level is accumulated yet LC3Ⅱ/LC3I ratio is reduced upon the inhibition of autophagy [42,43]. In this study, we also found that the overexpression of LINC00689 raised the ATG7 level and LC3Ⅱ/LC3I value yet reduced that of p62, whereas the knockdown of LINC00689 weakened the ATG7 level and LC3Ⅱ/LC3I ratio, but elevated the p62 level in NPCs. However, ATG7 silencing abolished the effect of overexpressed LINC00689 in NPCs. These data, collectively, indicated that overexpressed LINC00689 inhibited the apoptosis of NPCs via activating ATG7-dependent canonical autophagy in NPCs, whereas LINC00689 silencing exerted the opposite effect.

Furthermore, it has already been reported that lncRNA–miRNA–mRNA network plays a critical role in IDD [9]. Zhang et al. have demonstrated that the up-regulation of lncRNA MALAT1 promoted the proliferation of NPCs and attenuated the severity of disc degeneration in IDD-modeled rats via sponging miR-503 [44]. Yang et al. have indicated that lncRNA-SLC20A1 elevated the extracellular matrix degradation in IDD NP cells via regulating the miR-31-5p/MMP3 axis [45]. In addition to that, the expression of miR-3127-5p was previously reported to be up-regulated in lumbar IDD [9]. Likewise, in our current research, we discovered that miR-3127-5p expression was up-regulated in IDD, and that LINC00689 could competitively bind with miR-3127-5p, an miRNA which could target ATG7 in NPCs. Besides, the up-regulation of miR-3127-5p reversed the effects of overexpressed LINC00689 in NPCs. These results uncovered that LINC00689 regulated the apoptosis of NPCs via miR-3127-5p/ATG7 axis-mediated autophagy.

In conclusion, in this research, we unveiled that the up-regulation of LINC00689 inhibited the apoptosis of NPCs via miR-3127-5p/ATG7 axis-mediated autophagy. These results may offer some important insights for the gene therapy of IDD.

# These authors contributed equally to this work.

tel: +86-591-87983333

Acknowledgment

Not applicable.

  1. Funding information: None.

  2. Author contributions: C.W. and X.Z. performed the immunohistochemistry, X.Z. carried out the molecular genetics studies, C.W. and R.C. designed the study and drafted the manuscript. All authors have read and approved the final manuscript.

  3. Conflict of interest: The authors declare no conflicts of interest.

  4. Data availability statement: The analyzed datasets generated during the study are available from the corresponding author on reasonable request.

References

[1] Yang J, Liu J, Zhao S, Tian F. N(6)-methyladenosine METTL3 modulates the proliferation and apoptosis of lens epithelial cells in diabetic cataract. Mol Ther Nucleic Acids. 2020;20:111–6. 10.1016/j.omtn.2020.02.002.Search in Google Scholar PubMed PubMed Central

[2] Kos N, Gradisnik L, Velnar T. A brief review of the degenerative intervertebral disc disease. Med Arch. 2019;73(6):421–4. 10.5455/medarh.2019.73.421-424.Search in Google Scholar PubMed PubMed Central

[3] Wang Y, Che M, Xin J, Zheng Z, Li J, Zhang S. The role of IL-1beta and TNF-alpha in intervertebral disc degeneration. Biomed Pharmacother. 2020;131:110660. 10.1016/j.biopha.2020.110660.Search in Google Scholar PubMed

[4] Tang N, Dong Y, Xiao T, Zhao H. LncRNA TUG1 promotes the intervertebral disc degeneration and nucleus pulposus cell apoptosis though modulating miR-26a/HMGB1 axis and regulating NF-kappaB activation. Am J Transl Res. 2020;12(9):5449–64.10.2139/ssrn.3493212Search in Google Scholar

[5] Zhang GZ, Deng YJ, Xie QQ, Ren EH, Ma ZJ, He XG, et al. Sirtuins and intervertebral disc degeneration: roles in inflammation, oxidative stress, and mitochondrial function. Clin Chim Acta. 2020;508:33–42. 10.1016/j.cca.2020.04.016.Search in Google Scholar PubMed

[6] Dowdell J, Erwin M, Choma T, Vaccaro A, Iatridis J, Cho SK. Intervertebral disk degeneration and repair. Neurosurgery. 2017;80(3S):S46–54. 10.1093/neuros/nyw078.Search in Google Scholar PubMed PubMed Central

[7] Oichi T, Taniguchi Y, Oshima Y, Tanaka S, Saito T. Pathomechanism of intervertebral disc degeneration. JOR Spine. 2020;3(1):e1076. 10.1002/jsp2.1076.Search in Google Scholar PubMed PubMed Central

[8] Chen S, Luo M, Kou H, Shang G, Ji Y, Liu H. A review of gene therapy delivery systems for intervertebral disc degeneration. Curr Pharm Biotechnol. 2020;21(3):194–205. 10.2174/1389201020666191024171618.Search in Google Scholar PubMed

[9] Zhu J, Zhang X, Gao W, Hu H, Wang X, Hao D. lncRNA/circRNAmiRNAmRNA ceRNA network in lumbar intervertebral disc degeneration. Mol Med Rep. 2019;20(4):3160–74. 10.3892/mmr.2019.10569.Search in Google Scholar PubMed PubMed Central

[10] Hombach S, Kretz M. Non-coding RNAs: classification, biology and functioning. Adv Exp Med Biol. 2016;937:3–17. 10.1007/978-3-319-42059-2_1.Search in Google Scholar PubMed

[11] Matsui M, Corey DR. Non-coding RNAs as drug targets. Nat Rev Drug Discov. 2017;16(3):167–79. 10.1038/nrd.2016.117.Search in Google Scholar PubMed PubMed Central

[12] Dastmalchi N, Safaralizadeh R, Nargesi MM. LncRNAs: potential novel prognostic and diagnostic biomarkers in colorectal cancer. Curr Med Chem. 2020;27(30):5067–77. 10.2174/0929867326666190227230024.Search in Google Scholar PubMed

[13] Chen WK, Yu XH, Yang W, Wang C, He WS, Yan YG, et al. lncRNAs: novel players in intervertebral disc degeneration and osteoarthritis. Cell Prolif. 2017;50(1):e12313. 10.1111/cpr.12313.Search in Google Scholar PubMed PubMed Central

[14] Zhan S, Wang K, Song Y, Li S, Yin H, Luo R, et al. Long non-coding RNA HOTAIR modulates intervertebral disc degenerative changes via Wnt/beta-catenin pathway. Arthritis Res Ther. 2019;21(1):201. 10.1186/s13075-019-1986-8.Search in Google Scholar PubMed PubMed Central

[15] Cui S, Liu Z, Tang B, Wang Z, Li B. LncRNA MAGI2-AS3 is down-regulated in intervertebral disc degeneration and participates in the regulation of FasL expression in nucleus pulposus cells. BMC Musculoskelet Disord. 2020;21(1):149. 10.1186/s12891-020-3086-y.Search in Google Scholar PubMed PubMed Central

[16] Zhang Z, Huo Y, Zhou Z, Zhang P, Hu J. Role of lncRNA PART1 in intervertebral disc degeneration and associated underlying mechanism. Exp Ther Med. 2021;21(2):131. 10.3892/etm.2020.9563.Search in Google Scholar PubMed PubMed Central

[17] Yu Z, Wang Y, Wang B, Zhai J. Metformin affects paclitaxel sensitivity of ovarian cancer cells through autophagy mediated by long noncoding RNASNHG7/miR-3127-5p axis. Cancer Biother Radiopharm. 2020. 10.1089/cbr.2019.3390.Search in Google Scholar PubMed

[18] Li F, Sun X, Zheng B, Sun K, Zhu J, Ji C, et al. Arginase II promotes intervertebral disc degeneration through exacerbating senescence and apoptosis caused by oxidative stress and inflammation via the NF-κB pathway. Front Cell Dev Biol. 2021;9:737809. 10.3389/fcell.2021.737809.Search in Google Scholar PubMed PubMed Central

[19] Novais EJ, Tran VA, Johnston SN, Darris KR, Roupas AJ, Sessions GA, et al. Long-term treatment with senolytic drugs Dasatinib and Quercetin ameliorates age-dependent intervertebral disc degeneration in mice. Nat Commun. 2021;12(1):5213. 10.1038/s41467-021-25453-2.Search in Google Scholar PubMed PubMed Central

[20] Yi W, Wen Y, Tan F, Liu X, Lan H, Ye H, et al. Impact of NF-κB pathway on the apoptosis-inflammation-autophagy crosstalk in human degenerative nucleus pulposus cells. Aging (Albany NY). 2019;11(17):7294–306. 10.18632/aging.102266.Search in Google Scholar PubMed PubMed Central

[21] Wang XY, Jiao LY, He JL, Fu ZA, Guo RJ. Parathyroid hormone 1‑34 inhibits senescence in rat nucleus pulposus cells by activating autophagy via the m‑TOR pathway. Mol Med Rep. 2018;18(3):2681–8. 10.3892/mmr.2018.9229.Search in Google Scholar PubMed PubMed Central

[22] He R, Cui M, Lin H, Zhao L, Wang J, Chen S, et al. Melatonin resists oxidative stress-induced apoptosis in nucleus pulposus cells. Life Sci. 2018;199:122–30. 10.1016/j.lfs.2018.03.020.Search in Google Scholar PubMed

[23] Gong C, Pan W, Hu W, Chen L. Bone morphogenetic protein-7 retards cell subculture-induced senescence of human nucleus pulposus cells through activating the PI3K/Akt pathway. Biosci Rep. 2019;39(3):BSR20182312. 10.1042/BSR20182312.Search in Google Scholar PubMed PubMed Central

[24] Chen D, Xia D, Pan Z, Xu D, Zhou Y, Wu Y, et al. Metformin protects against apoptosis and senescence in nucleus pulposus cells and ameliorates disc degeneration in vivo. Cell Death Dis. 2016;7(10):e2441. 10.1038/cddis.2016.334.Search in Google Scholar PubMed PubMed Central

[25] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods (San Diego, CA). 2001;25(4):402–8. 10.1006/meth.2001.1262.Search in Google Scholar PubMed

[26] Chen J, Xie JJ, Jin MY, Gu YT, Wu CC, Guo WJ, et al. Sirt6 overexpression suppresses senescence and apoptosis of nucleus pulposus cells by inducing autophagy in a model of intervertebral disc degeneration. Cell Death Dis. 2018;9(2):56. 10.1038/s41419-017-0085-5.Search in Google Scholar PubMed PubMed Central

[27] Navone SE, Marfia G, Giannoni A, Beretta M, Guarnaccia L, Gualtierotti R, et al. Inflammatory mediators and signalling pathways controlling intervertebral disc degeneration. Histol Histopathol. 2017;32(6):523–42. 10.14670/HH-11-846.Search in Google Scholar PubMed

[28] Cui S, Zhang L. circ_001653 silencing promotes the proliferation and ECM synthesis of NPCs in IDD by downregulating miR-486-3p-mediated CEMIP. Mol Ther Nucleic Acids. 2020;20:385–99. 10.1016/j.omtn.2020.01.026.Search in Google Scholar PubMed PubMed Central

[29] Zhang Y, He F, Chen Z, Su Q, Yan M, Zhang Q, et al. Melatonin modulates IL-1beta-induced extracellular matrix remodeling in human nucleus pulposus cells and attenuates rat intervertebral disc degeneration and inflammation. Aging (Albany NY). 2019;11(22):10499–512. 10.18632/aging.102472.Search in Google Scholar PubMed PubMed Central

[30] McCann MR, Veras MA, Yeung C, Lalli G, Patel P, Leitch KM, et al. Whole-body vibration of mice induces progressive degeneration of intervertebral discs associated with increased expression of Il-1beta and multiple matrix degrading enzymes. Osteoarthr Cartil. 2017;25(5):779–89. 10.1016/j.joca.2017.01.004.Search in Google Scholar PubMed

[31] Gil N, Ulitsky I. Regulation of gene expression by cis-acting long non-coding RNAs. Nat Rev Genet. 2020;21(2):102–17. 10.1038/s41576-019-0184-5.Search in Google Scholar PubMed

[32] Chen Y, Zhou J. LncRNAs: macromolecules with big roles in neurobiology and neurological diseases. Metab Brain Dis. 2017;32(2):281–91. 10.1007/s11011-017-9965-8.Search in Google Scholar PubMed

[33] Li Z, Li X, Chen C, Li S, Shen J, Tse G, et al. Long non-coding RNAs in nucleus pulposus cell function and intervertebral disc degeneration. Cell Prolif. 2018;51(5):e12483. 10.1111/cpr.12483.Search in Google Scholar PubMed PubMed Central

[34] Kang L, Tian Y, Guo X, Chu X, Xue Y. Long noncoding RNA ANPODRT overexpression protects nucleus pulposus cells from oxidative stress and apoptosis by activating Keap1-Nrf2 signaling. Oxid Med Cell Longev. 2021;2021:6645005. 10.1155/2021/6645005.Search in Google Scholar PubMed PubMed Central

[35] Chen Y, Wu Y, Chen R, Xu C, Chen Q. LncRNA LINC00324 is upregulated in intervertebral disk degeneration and upregulates FasL in nucleus pulposus cells. Mol Cell Biochem. 2021;476(5):1995–2000. 10.1007/s11010-021-04058-9.Search in Google Scholar PubMed

[36] Dai S, Liang T, Shi X, Luo Z, Yang H. Salvianolic acid B protects intervertebral discs from oxidative stress-induced degeneration via activation of the JAK2/STAT3 signaling pathway. Oxid Med Cell Longev. 2021;2021:6672978. 10.1155/2021/6672978.Search in Google Scholar PubMed PubMed Central

[37] Banjara S, Suraweera CD, Hinds MG, Kvansakul M. The Bcl-2 family: ancient origins, conserved structures, and divergent mechanisms. Biomolecules. 2020;10(1):128. 10.3390/biom10010128.Search in Google Scholar PubMed PubMed Central

[38] Luo X, O’Neill KL, Huang K. The third model of Bax/Bak activation: a Bcl-2 family feud finally resolved? F1000Res. 2020;9:F1000 Faculty Rev-935. 10.12688/f1000research.25607.1.Search in Google Scholar PubMed PubMed Central

[39] Crowley LC, Waterhouse NJ. Detecting Cleaved Caspase-3 in apoptotic cells by flow cytometry. Cold Spring Harb Protoc. 2016;2016(11). 10.1101/pdb.prot087312.Search in Google Scholar PubMed

[40] Arakawa S, Honda S, Yamaguchi H, Shimizu S. Molecular mechanisms and physiological roles of Atg5/Atg7-independent alternative autophagy. Proc Jpn Acad Ser B Phys Biol Sci. 2017;93(6):378–85. 10.2183/pjab.93.023.Search in Google Scholar PubMed PubMed Central

[41] Wang C, Zhang ZZ, Yang W, Ouyang ZH, Xue JB, Li XL, et al. MiR-210 facilitates ECM degradation by suppressing autophagy via silencing of ATG7 in human degenerated NP cells. Biomed Pharmacother. 2017;93:470–9. 10.1016/j.biopha.2017.06.048.Search in Google Scholar PubMed

[42] Bjorkoy G, Lamark T, Pankiv S, Overvatn A, Brech A, Johansen T. Monitoring autophagic degradation of p62/SQSTM1. Methods Enzymol. 2009;452:181–97. 10.1016/S0076-6879(08)03612-4.Search in Google Scholar PubMed

[43] Kang Y, Jia Y, Wang Q, Zhao Q, Song M, Ni R, et al. Long noncoding RNA KCNQ1OT1 promotes the progression of non-small cell lung cancer via regulating miR-204-5p/ATG3 axis. Onco Targets Ther. 2019;12:10787–97. 10.2147/OTT.S226044.Search in Google Scholar PubMed PubMed Central

[44] Zheng H, Wang T, Li X, He W, Gong Z, Lou Z, et al. LncRNA MALAT1 exhibits positive effects on nucleus pulposus cell biology in vivo and in vitro by sponging miR-503. BMC Mol Cell Biol. 2020;21(1):23. 10.1186/s12860-020-00265-2.Search in Google Scholar PubMed PubMed Central

[45] Yang Y, Zhong Z, Zhao Y, Ren K, Li N. LincRNA-SLC20A1 (SLC20A1) promotes extracellular matrix degradation in nucleus pulposus cells in human intervertebral disc degeneration by targeting the miR-31-5p/MMP3 axis. Int J Clin Exp Pathol. 2019;12(9):3632–43.Search in Google Scholar
Received: 2022-03-16
Revised: 2022-07-20
Accepted: 2022-07-20
Published Online: 2022-11-22

© 2022 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
https://doi.org/10.1515/med-2022-0544
Keywords for this article
intervertebral disc degeneration; LINC00689; MiR-3127-5p; ATG7; autophagy
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 18.11.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0544/html
Scroll to top button