Home Medicine Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
Article Open Access

Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1

  • , , , , , , , , , EMAIL logo and EMAIL logo
Published/Copyright: June 7, 2022

Abstract

Dysregulated microRNAs are closely related to the malignant progression of colorectal cancer (CRC). Although abnormal let-7i-3p expression has been reported in various human cancers, its biological role and potential mechanism in CRC remain unclear. Therefore, the purpose of this study was to investigate the expression and regulation of let-7i-3p in CRC. Here, we demonstrated that let-7i-3p expression was significantly downregulated in three CRC cell lines while CyclinD1 (CCND1) was upregulated compared with the normal colon epithelial FHC cells. Moreover, bioinformatics and luciferase reporter assays revealed that CCND1 was a direct functional target of let-7i-3p. In addition, let-7i-3p overexpression or CCND1 silencing inhibited cell cycle, proliferation, invasion, and migration and diminished the activation of p-ERK in HCT116 cells. However, exogenously expressing CCND1 alleviated these effects. Taken together, our findings may provide new insight into the pathogenesis of CRC and let-7i-3p/CCND1 might function as new therapeutic targets for CRC.

1 Introduction

Colorectal cancer (CRC) poses a serious threat to human life and health as it is the third most common cancer in the world and the fourth leading cause of cancer death [1,2]. Patients with advanced colorectal cancer cannot receive surgical treatment due to the development of liver and lung metastases [3,4]. Therefore, it is necessary to elucidate the pathogenesis and potential molecular mechanisms of CRC tumor metastasis, which will help to find potential therapeutic targets for CRC.

MicroRNAs (miRNAs) are a class of endogenous regulatory non-coding RNAs found in eukaryotes with a length of about 20–25 nucleotides [5]. miRNAs can downregulate the expression of target genes by inhibiting mRNA cleavage or translation repression [6,7]. In recent years, a large number of studies have shown that miRNAs are involved in a variety of cell processes, such as cell proliferation, invasion, migration, and cell cycle progression. For example, miR-BART10-3p regulates EBVaGC cell proliferation and migration by directly targeting DKK1 [8]. Transient activation of miR-294 leads to myocyte cell cycle reactivation [9]. Let-7i downregulates GREB1 to inhibit the progression of esophageal cancer [10]. Let-7i inhibits gastric cancer invasion and metastasis by targeting COL1A1 [11]. Interestingly, the microarray data of previous studies have shown that let-7i-3p levels are significantly reduced in CRC cell lines (SW620, LoVo) compared to normal colon epithelial FHC cells [12]. However, the molecular mechanisms and specific biological functions of let-7i-3p in CRC remain largely unknown.

Cyclin D1 is encoded by the CCND1 gene and is a promoter of the cell cycle, which is involved in the tumorigenesis of many cancers [13,14,15]. Previous studies have shown that high levels of CCND1 are associated with poor prognosis in CRC patients [16,17,18]. Therefore, understanding the regulatory mechanisms of CCND1 may help to develop strategies to combat colorectal cancer cell migration and invasion.

Based on the above considerations, this study aimed to investigate whether let-7i-3p regulates the cell cycle, proliferation, migration, and invasion of colorectal cancer cells by targeting CCND1.

2 Materials and methods

2.1 Cell lines and cell culture

The human colorectal cancer cell lines SW480, HCT116, LoVo, RKO, and HT29 and the normal colon epithelial cell lines FHC and 293T were obtained from the Chinese Academy of Sciences (Shanghai, China). All cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, USA) containing 10% fetal bovine serum (FBS) and 1% antibiotics (100 U mL−1 penicillin and 100 mg mL−1 streptomycin). They were incubated in a humidified atmosphere at 37°C containing 5% CO2.

2.2 Oligonucleotide transfection

Let-7i-3p mimic (named as let-7i-3p), negative control duplex (named as NC), and siRNA against CCND1 (named as siCCND1) were synthesized by GenePharma (Shanghai, China) and were applied for transfection. Oligonucleotide transfection was performed using Lipofectamine 3000 reagents (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The sequences are listed in Table 1.

Table 1

Oligonucleotide sequences

Namea Sequence (5′–3′)b Usage
let-7i-3p (sense) CUGCGCAAGCUACUGCCUUGCU Transfection
NC (sense) UUCUCCGAACGUGUCACGUTT Transfection
siCCND1-1 (sense) CGCUGGAGCCCGUGAAAAATT Transfection
siCCND1-2 (sense) CCAGAGUGAUCAAGUGUGATT Transfection
U6-F CTCGCTTCGGCAGCACA qRT-PCR
U6-R AACGCTTCACGAATTTGCGT qRT-PCR
CCND1-F ATCAAGTGTGACCCGGACTG qRT-PCR
CCND1-R CTTGGGGTCCATGTTCTGCT qRT-PCR
let-7i-3p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCAAG RT
let-7i-3p-Q CGCTGCGCAAGCTACTGC qRT-PCR
GAPDH-F AAATCCCATCACCATCTTCC qRT-PCR
GAPDH-R TCACACCCATGACGAACA qRT-PCR
CCND1-wt-F CCGGAGCTCTTCAACCCACAGCTACTTGG Plasmid construction
CCND1-wt-R CCCGTCGACTCAGATGACTCTGGGAAACG Plasmid construction
CCND1-mut-F AGGCTGGTGGGAACTCGCCGGGGCACAGCGGAGTCT Mutagenesis
CCND1-mut-R GCGAGTTCCCACCAGCCTTTGGCCTCTCGATAC Mutagenesis
CCND1-FL-F CGCGGATCCATGGAACACCAGCTCCTGTG Plasmid construction
CCND1-FL-R CCGCTCGAGTCAGATGTCCACGTCCCGC Plasmid construction

aF, forward primer; R, reverse primer.

bMutated target sites are underlined.

2.3 RNA extractions and qRT-PCR

Total RNA was extracted from cells using the TRIzol reagent (Invitrogen, CA, USA) following the manufacturer’s protocol. Then, we used FastKing RT Kit (with gDNase) (TIANGEN, China) to synthesize cDNA. qRT-PCR was performed on a Quant Studio5 Real-time PCR System (Applied Biosystems, USA) with ChamQ™ Universal SYBR® qPCR Master Mix (Vazyme Biotech, Nanjing, China).

2.4 miRNA expression

miRNA expression was measured using miRNA Universal SYBR® qPCR Master Mix Assays (Vazyme Biotech, Nanjing, China). The reverse transcription reaction was performed with the miRNA 1st-Strand cDNA Synthesis Kit (by stem-loop) (Vazyme Biotech, Nanjing, China) according to the manufacturer’s protocol. Quantitative real-time PCR was performed on a Quant Studio5 Real-time PCR System (Applied Biosystems, USA). Amplification data were normalized to endogenous U6 expression. All procedures were carried out in triplicate and the relative expression was calculated by the 2−ΔΔCT method.

2.5 Plasmid construction and dual-luciferase assay

The fragment of the 3′-UTR of CCND1 containing the predicted let-7i-3p-binding site was amplified by PCR and inserted between the SacI and SaII restriction sites of the pmirGLO Dual-Luciferase miRNA Target Expression Vector (kindly provided by Prof. Qifa Li of Nanjing Agricultural University, Nanjing, China). For mutation, the let-7i-3p-binding motif in the 3′-UTR of the CCND1 gene was mutated by using the Mut Express MultiS Fast Mutagenesis Kit V2 (Vazyme Biotech, Nanjing, China). Luciferase activity was measured 24 h after transfection using the Dual-Glo luciferase assay system (Promega, USA). Renilla luciferase activity served as the internal control. The CCND1 cDNA was amplified by PCR and cloned into the pcDNA3.1 (+) (kindly provided by Prof. Qifa Li of Nanjing Agricultural University, Nanjing, China). All of the constructs were verified by sequencing.

2.6 Western blot analysis

The cell pellets were harvested and re-suspended in lysis buffer (20 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 25 mM β-glycerol-phosphate, 1 mM Na3VO4, 10% glycerol, 1× PMSF, with the sigma phosphatase inhibitors and protease inhibitor; Pierce, Rockford, IL, USA). The re-suspended cell pellet was then incubated on ice for 20 min, followed by centrifugation at 12,000×g for 20 min at 4°C. The supernatants were collected and protein concentrations were measured using the BCA Protein Assay Kit (Beyotime, Shanghai, China). Finally, cell lysates were subjected to western blot analysis of the following antibodies: CCND1 (CST, 55506S), α-tubulin (CST, 3873S), p-Erk1/2 (CST, 4370S), Erk1/2 (CST, 4695S), and GAPDH (protein-tech, 60004-1).

2.7 Cell proliferation assay

Cell Counting Kit-8 (CCK-8) (Beyotime, Shanghai, China) was used to measure the cell proliferation according to the manufacturer’s recommendations. Cells were transfected with let-7i-3p mimic or mimic NC, siCCND1, or pcDNA-CCND1 + let-7i-3p mimic. Forty-eight hours later, the transfected cells were trypsinized, counted, and replated at a density of 2000 cells/well in a 96-well plate, 10 μL of CCK-8 solution was added into the medium at different time points, and the absorbance (450 nm) was assessed on a SpectraMax iD3 Multi-Mode Microplate Reader (Molecular Devices, USA). All the experiments were performed at least three times, and the mean was calculated.

2.8 Colony formation assay

The transfected cells as described above were plated in a six-well plate (1,000 cells per well) and cultured with DMEM for about 2 weeks. Proliferating colonies resulting from the surviving cells were fixed with 3.7% methanol, stained with 0.1% crystal violet, and counted. Colonies containing at least 50 cells were scored. Each assay was performed in triplicate.

2.9 Cell cycle and apoptosis assays by flow cytometry

For cycle analysis, the test was performed using a cell cycle and apoptosis analysis kit (C1052; Beyotime, Shanghai, China). For apoptosis analysis, the test was performed using the Annexin-V-PE/7-AAD apoptosis detection kit (Vazyme Biotech, Nanjing, China). The transfected cells were harvested, washed, and stained according to the manufacturer’s protocol. Then, the stained cells were measured by CytoFLEX (Beckman Coulter, USA) and analyzed using FlowJo software version 7.6. Three independent assays were conducted.

2.10 Scratch wound-healing assay

A scratch wound-healing assay was performed for the analysis of cell migration. The transfected cells were incubated on six-well plates (3 × 105 cells per well) with 5% CO2 at 37°C. After 24 h, the plate was scratched using a pipette. Then, the cells were washed and incubated with fresh serum-free DMEM in the incubator and observed at 0 and 48 h. Images were acquired under an inverted microscope. Experiments were performed in triplicate.

2.11 Cell invasion assay

For the invasion assay, the transfected cells were put into the upper chamber of each well of a 24-well transwell polycarbonate membrane (8 μm pore size, millepore) coated with Matrigel (BD, USA). Medium containing 10% FBS, which served as a chemoattractant, was put into the lower chambers. After wells were incubated for 24 h at 37°C, the surface of cells on the upper membrane was removed. The cells were fixed and stained with 0.05% crystal violet. Six random fields of each chamber were photographed using an inverted microscope at 200× magnification. The mean of triplicate assays for each experimental condition was used.

2.12 Statistical analysis

All measurement data are represented as mean ± standard deviation. The statistical differences between groups were analyzed using t-tests of GraphPad Prism9. P-values were determined by paired-samples t-tests: *P < 0.05, **P < 0.01, and ***P < 0.001.

3 Results

3.1 Let-7i-3p is significantly downregulated but CCND1 upregulated in CRC cells

To verify whether let-7i-3p was abnormally expressed in CRC cells, we analyzed the expression level of let-7i-3p in three CRC cells (HCT116, SW480, and LoVo) and normal colon epithelial cell line (FHC) (Figure 1a). Consistent with the microarray data of previous reports [12], our qRT-PCR results showed that the expression of let-7i-3p in CRC cells was significantly reduced compared with FHC cells. Considering that let-7i-3p mainly plays a role through its target genes, we screened potential target genes by RNAhybrid. Comprehensive data analysis and literature review predicted that CCND1 might be a putative target gene of let-7i-3p. To evaluate the relation between let-7i-3p and CCND1 expression levels in CRC. Similarly, we detected CCND1 expression levels in three CRC cells and FHC. As shown in Figure 1b, the expression of CCND1 was upregulated in CRC cells compared with FHC cells. Next, CCND1 expression was detected in CRC cells and FHC by western blot. The results showed that the relative expression of CCND1 protein level in CRC cells (HCT116, SW480) was significantly upregulated compared with FHC cells (Figure 1c and d). These results further supported CCND1 as a potential target gene regulated by let-7i-3p.

Figure 1 
                  The expression of let-7i-3p and CCND1 in CRC cells. (a) The expression of let-7i-3p in four cell lines was determined by qRT-PCR. (b) The expression of CCND1 mRNA in four cell lines. (c) The expression of CCND1 protein in six cell lines was determined by western blot. (d) Quantification of CCND1 was normalized to α-tubulin. *P < 0.05 and **P < 0.01.
Figure 1

The expression of let-7i-3p and CCND1 in CRC cells. (a) The expression of let-7i-3p in four cell lines was determined by qRT-PCR. (b) The expression of CCND1 mRNA in four cell lines. (c) The expression of CCND1 protein in six cell lines was determined by western blot. (d) Quantification of CCND1 was normalized to α-tubulin. *P < 0.05 and **P < 0.01.

3.2 Let-7i-3p inhibits cell cycle, proliferation, migration, and invasion in HCT116

To examine the potential roles of let-7i-3p in CRC cells, the HCT116 was transfected with let-7i-3p or NC. Following transfection, the expression of let-7i-3p was significantly increased in the HCT116 transfected with the let-7i-3p (Figure 2a; P < 0.001). To verify the biological function of let-7i-3p in HCT116 cells, CCK8 assay, colony formation assay, flow cytometry, wound-healing migration assay, and transwell assay are performed. No difference was detected from Annexin-V/7-AAD staining, suggesting that let-7i-3p had no impact on apoptosis (Figure 2b and c). However, compared to the control group, significantly more cells were detected in the G1 phase, while fewer cells were detected in the S phase in the let-7i-3p-overexpressed cells (Figure 2d and e). Moreover, cck-8 and colony assay demonstrated that the cell proliferation capacity of HCT116 cells was remarkably suppressed (Figure 2f and h). In addition, as shown in Figure 2i–l, the width of the wound was significantly broader in let-7i-3p-overexpressed CRC cells compared with that in the control cells. In line with the wound-healing assay data, the results of the transwell assay indicated that overexpression of let-7i-3p inhibited the invasiveness of HCT116 cell. Moreover, let-7i-3p played the same role in the SW480 (Figure S1). Taken together, these data indicated that overexpression of let-7i-3p inhibited cell cycle, proliferation, migration, and invasion, but not apoptosis in CRC cells.

Figure 2 
                  Let-7i-3p inhibits the cell cycle, proliferation, migration, and invasion but does not affect the apoptosis in HCT116. (a) The expressions of let-7i-3p were measured after transfecting let-7i-3p or NC into HCT116 cells. (b and c) Cell viability was determined by Annexin-V/7-AAD staining. Representative flow cytometric analysis of apoptosis (b) and statistical histogram was shown at right (c). (d) Relative cell cycle distribution detected by flow cytometry and statistical histogram was shown at right (e). (f) The effects of let-7i-3p mimics or NC on HCT116 cells’ proliferation as determined by CCK-8 assay. (g) A colony formation assay was used to detect the cell colony formation ability after the transfection of let-7i-3p in HCT116 cells and a statistical histogram was shown at right (h). (i) The effects of let-7i-3p mimics and NC on HCT116 cells’ invasion determined by transwell assay and statistical histogram was shown at right (j). (k) Images were acquired at 0 and 48 h after wounding. The percentage of the wound healing was calculated as (the width of wound at 0 h − the width of wound at 48 h)/the width of wound at 0 h and a statistical histogram was shown at right (l). *P < 0.05, **P < 0.01, and ***P < 0.001.
Figure 2

Let-7i-3p inhibits the cell cycle, proliferation, migration, and invasion but does not affect the apoptosis in HCT116. (a) The expressions of let-7i-3p were measured after transfecting let-7i-3p or NC into HCT116 cells. (b and c) Cell viability was determined by Annexin-V/7-AAD staining. Representative flow cytometric analysis of apoptosis (b) and statistical histogram was shown at right (c). (d) Relative cell cycle distribution detected by flow cytometry and statistical histogram was shown at right (e). (f) The effects of let-7i-3p mimics or NC on HCT116 cells’ proliferation as determined by CCK-8 assay. (g) A colony formation assay was used to detect the cell colony formation ability after the transfection of let-7i-3p in HCT116 cells and a statistical histogram was shown at right (h). (i) The effects of let-7i-3p mimics and NC on HCT116 cells’ invasion determined by transwell assay and statistical histogram was shown at right (j). (k) Images were acquired at 0 and 48 h after wounding. The percentage of the wound healing was calculated as (the width of wound at 0 h − the width of wound at 48 h)/the width of wound at 0 h and a statistical histogram was shown at right (l). *P < 0.05, **P < 0.01, and ***P < 0.001.

3.3 CCND1 is a direct target of let-7i-3p

RNA-hybrid was used to analyze the potential let-7i-3p target gene. We constructed a dual-luciferase reporter plasmid recombined with either wild-type (WT) or mutant (MUT) type 3′-UTR of CCND1 (Figure 3a). The result showed that co-transfection of let-7i-3p significantly decreased the luciferase activity in HCT116 and 293T cells with WT 3′-UTR of CCND1 but not in those with MUT type (Figure 3b and c). To verify that CCND1 is the true downstream target of let-7i-3p, we examined the effect of the let-7i-3p expression on CCND1 expression by qRT-PCR and western blot. As shown in Figure 3d–f, let-7i-3p significantly suppressed both mRNA and protein expression levels of CCND1. These data suggested that CCND1 was a direct target of let-7i-3p.

Figure 3 
                  Let-7i-3p directly targets CCND1. (a) Putative WT and mutant‐type (MUT) let-7i-3p target sequences of CCND1 mRNA 3′-UTR. (b and c) Relative luciferase activity in HCT116 and 293T cells co-transfected with constructs carrying WT or mutant-type CCND1 mRNA 3′-UTR with let-7i-3p or NC. (d and e) The overexpression of let-7i-3p in the HCT116 cells attenuated the expression of CCND1 mRNA and protein levels, respectively, and a statistical histogram was shown at right (f). *P < 0.05 and **P < 0.01.
Figure 3

Let-7i-3p directly targets CCND1. (a) Putative WT and mutant‐type (MUT) let-7i-3p target sequences of CCND1 mRNA 3′-UTR. (b and c) Relative luciferase activity in HCT116 and 293T cells co-transfected with constructs carrying WT or mutant-type CCND1 mRNA 3′-UTR with let-7i-3p or NC. (d and e) The overexpression of let-7i-3p in the HCT116 cells attenuated the expression of CCND1 mRNA and protein levels, respectively, and a statistical histogram was shown at right (f). *P < 0.05 and **P < 0.01.

3.4 Knockdown of CCND1 inhibits cell cycle, proliferation, migration, and invasion in HCT116

To investigate whether siCCND1 has a similar function to let-7i-3p in CRC cells, two siCCND1s were transfected into HCT116 cells. The silencing of CCND1s was confirmed by real-time RT-PCR and western blot. The result showed that the siCCND1s’ transfection of HCT116 cells efficiently knocked down CCND1 mRNA and protein expression (Figure 4a and c). To further explore the role of CCND1 in HCT116 cells, we analyzed the effect of siCCND1 in controlling cell proliferation, cell cycle, migration, and invasion. The results showed that the silencing of CCND1 led to the significant inhibition of proliferation, migration, and invasion, in a pattern similar to that of let-7i-3p overexpression (Figure 4d and l).

Figure 4 
                  siCCND1 inhibits the proliferation, cell cycle, migration, and invasion of HCT116 cells. (a) QRT-PCR was used to detect the mRNA expression of CCND1 in siCCND1 and siNC. (b) Western blot was used to detect the protein expression of CCND1 in si-CCND1 and siNC and a statistical histogram was shown at right (c). (d) CCK-8 assay was used to detect the HCT116 cell viability after the knockdown of CCND1. (e) A colony formation assay was used to detect the cell colony formation ability after the knockdown of CCND1 and a statistical histogram was shown at right (f). (g) Cell cycle distribution was measured by flow cytometry and a statistical histogram was shown at right (h). (i) Transwell assay was used to detect the invasion of HCT116 cells after knocking down CCND1 and a statistical histogram was shown at right (j). (k) The change in cell migration was examined by wound-healing assay in HCT116 cells after knocking down CCND1 and a statistical histogram was shown at right (l). *P < 0.05, **P < 0.01, and ***P < 0.001.
Figure 4

siCCND1 inhibits the proliferation, cell cycle, migration, and invasion of HCT116 cells. (a) QRT-PCR was used to detect the mRNA expression of CCND1 in siCCND1 and siNC. (b) Western blot was used to detect the protein expression of CCND1 in si-CCND1 and siNC and a statistical histogram was shown at right (c). (d) CCK-8 assay was used to detect the HCT116 cell viability after the knockdown of CCND1. (e) A colony formation assay was used to detect the cell colony formation ability after the knockdown of CCND1 and a statistical histogram was shown at right (f). (g) Cell cycle distribution was measured by flow cytometry and a statistical histogram was shown at right (h). (i) Transwell assay was used to detect the invasion of HCT116 cells after knocking down CCND1 and a statistical histogram was shown at right (j). (k) The change in cell migration was examined by wound-healing assay in HCT116 cells after knocking down CCND1 and a statistical histogram was shown at right (l). *P < 0.05, **P < 0.01, and ***P < 0.001.

3.5 CCND1 overexpression reverses the effects of let-7i-3p on HCT116 cells

To confirm the function of CCND1 in CRC cells, we tested the effect of CCND1 overexpression on the cell cycle, proliferation, migration, and invasion. We ectopically expressed CCND1 together with let-7i-3p in HCT116 cells. qRT-PCR and western blot analyses showed that CCND1 mRNA and protein levels dramatically increased in pcDNA-CCND1-transfected HCT116 cells (Figure 5a and c). Furthermore, we performed CCK8 assay, colony-forming assay, flow cytometry, transwell assay, and wound-healing migration assay in HCT116 cells. As expected, the results showed that there was no significant difference between the pcDNA-CCND1 + let-7i-3p group and the control group (Figure 5d and l). Taken together, these results displayed that let-7i-3p inhibited cell cycle, proliferation, migration, and invasion in HCT116 by targeting CCND1.

Figure 5 
                  Overexpressed CCND1 could reverse the effects of let-7i-3p on HCT116 cells. (a) The level of CCND1 mRNA expression was detected by RT-PCR. (b) The level of CCND1 protein expression was detected by western blot and a statistical histogram was shown at right (c). (d) CCK-8 assay was used to explore the proliferation of HCT116 cells. (e) A colony formation assay was conducted to verify that ectopic CCND1 expression could reverse proliferation induced by let-7i-3p overexpression in HCT116 cells and a statistical histogram was shown at right (f). (g) Cell cycle distribution was measured by flow cytometry and a statistical histogram was shown at right (h). (i) Transwell assay was carried out to confirm the effects of CCND1 alteration in the invasion of HCT116 cells and a statistical histogram was shown at right (j). (k) The change in cell migration was examined by wound-healing assay in HCT116 cells and a statistical histogram was shown at right (l). *P < 0.05, **P < 0.01, and ***P < 0.001.
Figure 5

Overexpressed CCND1 could reverse the effects of let-7i-3p on HCT116 cells. (a) The level of CCND1 mRNA expression was detected by RT-PCR. (b) The level of CCND1 protein expression was detected by western blot and a statistical histogram was shown at right (c). (d) CCK-8 assay was used to explore the proliferation of HCT116 cells. (e) A colony formation assay was conducted to verify that ectopic CCND1 expression could reverse proliferation induced by let-7i-3p overexpression in HCT116 cells and a statistical histogram was shown at right (f). (g) Cell cycle distribution was measured by flow cytometry and a statistical histogram was shown at right (h). (i) Transwell assay was carried out to confirm the effects of CCND1 alteration in the invasion of HCT116 cells and a statistical histogram was shown at right (j). (k) The change in cell migration was examined by wound-healing assay in HCT116 cells and a statistical histogram was shown at right (l). *P < 0.05, **P < 0.01, and ***P < 0.001.

3.6 Let-7i-3p decreases the ERK signaling pathway by downregulation of CCND1

To examine the mechanisms of how let-7i-3p and CCND1 inhibited the cell cycle, proliferation, migration, and invasion in CRC; we investigated whether these effects were mediated by activating the ERK signaling pathway. Western blot was used to examine CCND1 expression levels and p-ERK. As shown in Figure 6a and c, overexpressed let-7i-3p caused a significant decrease in p-ERK in HCT116 cells by comparison to the control group. However, there was no significant difference in total-ERK expression. Similarly, the same results can be obtained by downregulating the CCND1 expression in HCT116 cells (Figure 6d and e). We ectopically expressed CCND1 in HCT116 cells that increased significantly the p-ERK compared to the control group (Figure 6f and g). These results suggested that CCND1 played a catalytic role in the ERK signaling pathway.

Figure 6 
                  Effects of let-7i-3p and CCND1 on the ERK signaling pathway. (a) Western bolts of Erk1/2 and p-Erk1/2 after the transfection of let-7i-3p mimics or NC in HCT116 cells and statistical histogram was shown at right (b and c). (d) Western bolts of p-Erk1/2 after transfection of siCCND1 or NC in HCT116 cells and statistical histogram was shown at right (e). (f) Western bolts of p-Erk1/2 after transfection of pcDNA-CCND1 or pcDNA3.1 in HCT116 cells and statistical histogram was shown at right (g). *P < 0.05 and **P < 0.01.
Figure 6

Effects of let-7i-3p and CCND1 on the ERK signaling pathway. (a) Western bolts of Erk1/2 and p-Erk1/2 after the transfection of let-7i-3p mimics or NC in HCT116 cells and statistical histogram was shown at right (b and c). (d) Western bolts of p-Erk1/2 after transfection of siCCND1 or NC in HCT116 cells and statistical histogram was shown at right (e). (f) Western bolts of p-Erk1/2 after transfection of pcDNA-CCND1 or pcDNA3.1 in HCT116 cells and statistical histogram was shown at right (g). *P < 0.05 and **P < 0.01.

All these results suggested that CCND1 was a downstream functional regulator of let-7i-3p through ERK signaling pathway.

4 Discussion

There are not many studies on let-7i-3p. Luo et al. reported that let-7i-3p inhibited the osteogenic differentiation of hASCs under cyclic strain in vitro acting as a negative regulator of the Wnt/β-catenin pathway by targeting LEF1 [19]. Sun et al. observed that low expression of let-7i-3p can enhance the osteoblast differentiation in ankylosing spondylitis (AS) mice by upregulating PDK1 [20]. Falzone et al. proved that let-7i-3p was associated with oral cancer recurrence [21]. Tang et al. reported that microarray data showed let-7i-3p levels significantly reduced in CRC cell lines (SW620, LoVo) compared to normal colon epithelial FHC cells [12]. However, there are few studies on the role of let-7i-3p in the pathogenesis of CRC.

In our study, we confirmed that the expression level of let-7i-3p in CRC cell lines (HCT116, SW480, and LoVo) was significantly lower than that in FHC by qRT-PCR (Figure 1a). Based on bioinformatics software prediction and literature review, we attempted to detect the expression level of the target gene CCND1 in CRC cell lines and FHC. As expected, the result showed that CCND1 levels in CRC cell lines (HCT116, SW480, and LoVo) were significantly higher than that in FHC by qRT-PCR (Figure 1b). Next, we demonstrated a role for let-7i-3p in the cell cycle, proliferation, invasion, and migration of HCT116 cells (Figure 2). Then, we performed a luciferase reporter assay to verify that CCND1 was a direct target of let-7i-3p (Figure 3). To elucidate the mechanism underlying the effects of let-7i-3p on proliferation, migration, and invasion, we tested whether CCND1 was required for the function of let-7i-3p by transfecting CCND1 siRNA into HCT116 cells. Likewise, silencing CCND1 inhibited the cell cycle, proliferation, invasion, and migration of HCT116 cells (Figure 4). Furthermore, ectopic expression of CCND1 offsets the inhibition of let-7i-3p overexpression on cell proliferation, migration, and invasion (Figure 5). These results suggested that CCND1 may act as a target of let-7i-3p and participate in the effect of let-7i-3p on the cell cycle, proliferation, migration, and invasion of CRC cells.

It is well known that the ERK signaling pathway plays an important role in several cellular processes, including cell cycle, proliferation, metastasis, survival, and apoptosis [22]. Leng et al. demonstrated that miR-29b suppressed the EMT and angiogenesis in CRC by disrupting the ETV4-dependent activation of the ERK signaling pathway [23]. Liu et al. revealed that miR-128-3p downregulated the deterioration rate of CRC by simultaneously silencing the activity of PI3K/AKT and MEK/ERK pathway [24]. Based on previous findings, we then investigated the effect of let-7i-3p and CCND1 on the regulation of the ERK pathway. As demonstrated that overexpression of the let-7i-3p resulted in the inhibition of the p-ERK signal in HCT116 cells. Similarly, the same results can be obtained by downregulating the CCND1 expression by siRNA. In contrast, overexpression of CCND1 in the HCT116 cells led to the abnormal activation of the ERK pathway (Figure 6).

In summary, we reported a tumor suppressor for let-7i-3p in CRC progression. We showed that let-7i-3p inhibited cell cycle, proliferation, migration, and invasion in HCT116 cells. We also confirmed that let-7i-3p inhibited the ERK signaling activity through direct suppression of CCND1. Overall, we have identified the role and molecular mechanism of let-7i-3p in HCT116 cells, and let-7i-3p may be a potential target for CRC treatment in the future.

Acknowledgments

We would like to thank Qifa Li (Nanjing Agricultural University, China) for providing the pmirGLO Dual-Luciferase miRNA Target Expression Vector and pcDNA3.1 (+) vector.

  1. Funding information: This work was financially supported by the National Natural Science Foundation of China (Grant No. 81671226), the Doctoral Scientific Research Foundation of Xinxiang Medical University (No. 505117), and the Science and technology project of Henan Province (No. 222102310513).

  2. Author contributions: Conceptualization: Fei Tu, Qingzhi Wang, and Zhiwei Feng. Data curation: Fei Tu, Mengfan Li, Yinyu Chen, Huiru Chu, Ting Xie, and Fangfang Geng. Funding acquisition: Fei Tu and Zhiwei Feng. Investigation: Fei Tu, Mengfan Li, Yinyu Chen, Huiru Chu, Ting Xie, Fangfang Geng, and Tiesuo Zhao. Resources: Shujie Wang, Lun Hai, and Tiesuo Zhao. Supervision: Fei Tu, Qingzhi Wang, and Zhiwei Feng. Validation: Yinyu Chen, Huiru Chu, Shujie Wang, and Lun Hai. Writing – original draft: Fei Tu, Qingzhi Wang, and Zhiwei Feng. Writing – review and editing: Fei Tu, Qingzhi Wang, and Zhiwei Feng.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Brenner H, Kloor M, Pox CP. Colorectal cancer. Lancet. 2014 Apr 26;383(9927):1490–502. 10.1016/S0140-6736(13)61649-9.Search in Google Scholar

[2] Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018 Nov;68(6):394–424. 10.3322/caac.21492. Epub 2018 Sep 12. Erratum in: CA Cancer J Clin. 2020 Jul;70(4):313.Search in Google Scholar

[3] Valderrama-Treviño AI, Barrera-Mera B, Ceballos-Villalva JC, Montalvo-Javé EE. Hepatic metastasis from colorectal cancer. Euroasian J Hepatogastroenterol. 2017 Jul–Dec;7(2):166–75. 10.5005/jp-journals-10018-1241. Epub 2017 Sep 29.Search in Google Scholar

[4] Wang Y, Jiang F, Xiong Y, Cheng X, Qiu Z, Song R. LncRNA TTN-AS1 sponges miR-376a-3p to promote colorectal cancer progression via upregulating KLF15. Life Sci. 2020 Mar 1;244:116936. 10.1016/j.lfs.2019.116936. Epub 2019 Oct 11.Search in Google Scholar

[5] Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004 Jan 23;116(2):281–97. 10.1016/s0092-8674(04)00045-5.Search in Google Scholar

[6] Hutvágner G, Zamore PD. A microRNA in a multiple-turnover RNAi enzyme complex. Science. 2002 Sep 20;297(5589):2056–60. 10.1126/science.1073827. Epub 2002 Aug 1.Search in Google Scholar PubMed

[7] Zeng Y, Cullen BR. Sequence requirements for micro RNA processing and function in human cells. RNA. 2003 Jan;9(1):112–23. 10.1261/rna.2780503.Search in Google Scholar PubMed PubMed Central

[8] Min K, Lee SK. EBV miR-BART10-3p promotes cell proliferation and migration by targeting DKK1. Int J Biol Sci. 2019 Jan 24;15(3):657–67. 10.7150/ijbs.30099.Search in Google Scholar PubMed PubMed Central

[9] Borden A, Kurian J, Nickoloff E, Yang Y, Troupes CD, Ibetti J, et al. Transient introduction of miR-294 in the heart promotes cardiomyocyte cell cycle reentry after injury. Circ Res. 2019 Jun 21;125(1):14–25. 10.1161/CIRCRESAHA.118.314223. Epub 2019 Apr 9.Search in Google Scholar PubMed PubMed Central

[10] Yang Y, Li W, Wei B, Wu K, Liu D, Zhu D, et al. MicroRNA let-7i inhibits histone lysine demethylase KDM5B to halt esophageal cancer progression. Mol Ther Nucleic Acids. 2020 Sep 16;22:846–61. 10.1016/j.omtn.2020.09.012.Search in Google Scholar PubMed PubMed Central

[11] Shi Y, Duan Z, Zhang X, Zhang X, Wang G, Li F. Down-regulation of the let-7i facilitates gastric cancer invasion and metastasis by targeting COL1A1. Protein Cell. 2019 Feb;10(2):143–8. 10.1007/s13238-018-0550-7.Search in Google Scholar PubMed PubMed Central

[12] Tang W, Zhou W, Xiang L, Wu X, Zhang P, Wang J, et al. The p300/YY1/miR-500a-5p/HDAC2 signalling axis regulates cell proliferation in human colorectal cancer. Nat Commun. 2019 Feb 8;10(1):663. 10.1038/s41467-018-08225-3.Search in Google Scholar PubMed PubMed Central

[13] Pestell RG. New roles of cyclin D1. Am J Pathol. 2013 Jul;183(1):3–9. 10.1016/j.ajpath.2013.03.001.Search in Google Scholar PubMed PubMed Central

[14] Gennaro VJ, Stanek TJ, Peck AR, Sun Y, Wang F, Qie S, et al. Control of CCND1 ubiquitylation by the catalytic SAGA subunit USP22 is essential for cell cycle progression through G1 in cancer cells. Proc Natl Acad Sci U S A. 2018 Oct 2;115(40):E9298–307. 10.1073/pnas.1807704115. Epub 2018 Sep 17.Search in Google Scholar PubMed PubMed Central

[15] Li Z, Li X, Li C, Su Y, Fang W, Zhong C, et al. Transcription factor OCT4 promotes cell cycle progression by regulating CCND1 expression in esophageal carcinoma. Cancer Lett. 2014 Nov 1;354(1):77–86. 10.1016/j.canlet.2014.07.049. Epub 2014 Aug 12.Search in Google Scholar PubMed

[16] Zhang Z, Li J, Huang Y, Peng W, Qian W, Gu J, et al. Upregulated miR-1258 regulates cell cycle and inhibits cell proliferation by directly targeting E2F8 in CRC. Cell Prolif. 2018 Dec;51(6):e12505. 10.1111/cpr.12505. Epub 2018 Aug 24.Search in Google Scholar PubMed PubMed Central

[17] Yu L, Ye F, Li YY, Zhan YZ, Liu Y, Yan HM, et al. Histone methyltransferase SETDB1 promotes colorectal cancer proliferation through the STAT1-CCND1/CDK6 axis. Carcinogenesis. 2020 Jul 10;41(5):678–88. 10.1093/carcin/bgz131.Search in Google Scholar PubMed

[18] Zhou J, Liu H, Zhang L, Liu X, Zhang C, Wang Y, et al. DJ-1 promotes colorectal cancer progression through activating PLAGL2/Wnt/BMP4 axis. Cell Death Dis. 2018 Aug 29;9(9):865. 10.1038/s41419-018-0883-4.Search in Google Scholar PubMed PubMed Central

[19] Luo Y, Ge R, Wu H, Ding X, Song H, Ji H, et al. The osteogenic differentiation of human adipose-derived stem cells is regulated through the let-7i-3p/LEF1/β-catenin axis under cyclic strain. Stem Cell Res Ther. 2019 Nov 21;10(1):339. 10.1186/s13287-019-1470-z.Search in Google Scholar PubMed PubMed Central

[20] Sun S, Xu Y, Zhu Z, Kong D, Liu H, Zhou Z, et al. MicroRNA let-7i-3p affects osteoblast differentiation in ankylosing spondylitis via targeting PDK1. Cell Cycle. 2021 Jun;20(12):1209–19. 10.1080/15384101.2021.1930680. Epub 2021 May 28.Search in Google Scholar PubMed PubMed Central

[21] Falzone L, Lupo G, La Rosa GRM, Crimi S, Anfuso CD, Salemi R, et al. Identification of novel microRNAs and their diagnostic and prognostic significance in oral cancer. Cancers (Basel). 2019 Apr 30;11(5):610. 10.3390/cancers11050610.Search in Google Scholar PubMed PubMed Central

[22] Kidger AM, Sipthorp J, Cook SJ. ERK1/2 inhibitors: New weapons to inhibit the RAS-regulated RAF-MEK1/2-ERK1/2 pathway. Pharmacol Ther. 2018 Jul;187:45–60. 10.1016/j.pharmthera.2018.02.007. Epub 2018 Feb 16.Search in Google Scholar PubMed

[23] Leng Y, Chen Z, Ding H, Zhao X, Qin L, Pan Y. Overexpression of microRNA-29b inhibits epithelial-mesenchymal transition and angiogenesis of colorectal cancer through the ETV4/ERK/EGFR axis. Cancer Cell Int. 2021 Jan 6;21(1):17. 10.1186/s12935-020-01700-2.Search in Google Scholar PubMed PubMed Central

[24] Liu X, Dong C, Ma S, Wang Y, Lin T, Li Y, et al. Nanocomplexes loaded with miR-128-3p for enhancing chemotherapy effect of colorectal cancer through dual-targeting silence the activity of PI3K/AKT and MEK/ERK pathway. Drug Deliv. 2020 Dec;27(1):323–33. 10.1080/10717544.2020.1716882.Search in Google Scholar PubMed PubMed Central

Received: 2021-11-29
Revised: 2022-05-14
Accepted: 2022-05-15
Published Online: 2022-06-07

© 2022 Fei Tu et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Downloaded on 1.4.2026 from https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0499/html
Scroll to top button