Abstract
MiRNAs play an important role in spermatogonial stem cells (SSCs). The purpose of this study was to investigate the basic function of miR-22-5p in cryptorchidism. The results of RT-PCR, western blot, and immunohistochemistry showed that miR-22-5p was increased while EZH2 decreased in the testicular tissues of patients with cryptorchidism. Overexpression of miR-22-5p inhibited the proliferation of SSCs, increased cell apoptosis rate, and reduced expression of SSC marker proteins (GDNF and DAZL); however, knockout of miR-22-5p has the opposite effect. The Luciferase reporter gene assays demonstrated that EZH2 is a direct target of miR-22-5p. Moreover, EZH2 overexpression could reverse the effect of miR-22-5p mimic on SSCs’ proliferation, apoptosis, and expression of SSC marker proteins. Our results demonstrated that miR-22-5p regulates SSCs’ self-renewal by targeting EZH2, which indicated that miR-22-5p may serve as a biological marker for the treatment of infertility caused by cryptorchidism.
1 Introduction
Cryptorchidism, also known as undescended testis (UDT), is the most common birth defect involving male genitalia. About 3% of full-term and 30% of premature male infants are born with one or both testicles undescended [1]. Affected by hormone, temperature, genes, and other factors, the testes that did not fall into the scrotum appear as spermatogenesis obstruction and germ cell apoptosis, which is a common cause of male infertility [2,3]. Understanding the molecular mechanism of spermatogenesis disorder and germ cell apoptosis is helpful to better understand germ cell differentiation and find a new method for the treatment of infertility caused by cryptorchidism.
Spermatogonial stem cells (SSCs) are the only adult stem cells that can transmit genetic information to their offspring, which is the basis of spermatogenesis [4,5]. SSCs maintain a stable number of SSCs and sperm in males through self-renewal and differentiation. Excessive proliferation of SSCs will lead to excessive accumulation of SSCs and affect normal spermatogenesis. On the contrary, it will lead to the depletion of SSCs [6]. Therefore, maintaining the balance between self-renewal and differentiation of SSCs is an important prerequisite for the sustained sperm production of the testis.
MicroRNAs (miRNAs) play a key role in the control of gene expression in a wide array of tissue systems, where their functions include the regulation of self-renewal, cellular differentiation, proliferation, and apoptosis [7,8]. Studies have shown that miRNAs play an important role in spermatogenesis [9,10]. Li et al. [11] have reported that miR-130a could negatively regulate AR expression in mouse Sertoli cells, which further causes defects in spermatogenesis. In addition, miR-322 [12], miR-30a-5p [13], miR-31-5p [14], miR-122-5p [15], and so on were reported to regulate self-renewal, differentiation, proliferation and apoptosis of SSCs. Previous studies have shown that miR-22-5p is abnormally expressed in acute myocardial infarction [16,17], cancer [18,19], Alzheimer’s disease [20], and other diseases [21], which could be considered promising novel diagnostic biomarkers for these diseases. Using microarray analysis, Moritoki et al. [22] compared total miRNA expression in unilateral undescended testes with that in contralateral descended and normal testes and found that miR-22-5p was significantly highly expressed in testicular tissues of cryptorchidism patients (FD = 2.53, p < 0.05), suggesting that miR-22-5p may be involved in the regulation of cryptorchidism disorder.
Enhancer of zeste homolog 2 (EZH2) is a histone H3 lysine 27 (H3K27) methyltransferase that plays a vital role in spermatogenesis and self-renewal of SSCs, [23,24]. The predicted analysis of the target gene of miR-22-5p showed that there was a binding site between miR-22-5p and EZH2 3′UTR. Therefore, we speculate that miR-22-5p may regulate the self-renewal of SSCs by regulating the expression of EZH2.
2 Materials and methods
2.1 Tissue samples collection
Human testicular tissues were obtained from the First Affiliated Hospital of the University of Science and Technology of China (USTC, Hefei, China). A total of 10 samples of testicular tissues from patients with cryptorchidism and another 10 samples of testicular tissues from people with normal fertility were collected for comparison. The normal testicular tissues were collected from patients during surgical treatment or biopsy. Johnsen score was used to objectively evaluate spermatogenesis in the two groups. In this study, the Johnsen score in patients with obstructive azoospermia was 8–9, and that in patients with cryptorchidism was only 3–4, indicating that there was significant spermatogenesis disorder in testicular tissues of patients with cryptorchidism compared with obstructive azoospermia.
Clinical characteristics of the cryptorchidism patients were as follows: among the 10 patients, there were 3 cases of left cryptorchidism (30.00%), 6 cases of right cryptorchidism (60.00%), and 1 case of bilateral cryptorchidism (10.00%); one case was complicated with penile malformation, accounting for 10.00%; testicular location: 4 cases (40.00%) in the abdominal cavity and 6 cases (60.00%) in the inguinal area. This study was approved by the Ethics Committee of the First Affiliated Hospital of USTC. All participants signed informed consent.
2.2 RT-PCR analysis
Extraction of total RNA in testicular tissues or cells was performed using the TRIzol reagent (Invitrogen). RNAs were subjected to reverse transcription. The extracted cDNA was applied for PCR using the SYBR-Green method. Primer sequences are shown in Table 1. The stem-loop RT-PCR was used to perform the qPCR of miR-22-5p. Complementary DNA was synthesized from RNA with the FastQuant RT Kit according to the manufacturer’s protocol. The primer of miR-22-5p used for cDNA synthesis is shown in Table 1. Real-time PCR was performed with the SuperReal PreMix Plus (SYBR Green) Kit in an ABI7500 Real Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The expression level of mature miR-22-5p or mRNA was normalized to U6 or GAPDH, respectively. Relative expression levels were calculated using DataAssist software (Applied Biosystems)using the formula 2−ΔΔCt.
Primer sequences used in miRNA reverse transcription and PCR
Name | Primer (5′-3′) |
---|---|
Reverse transcription primers | |
miR-22-5p | GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCA |
CTGGATACGACTAAAGC | |
PCR primers | |
miR-22-5p | F: GAGCTGCACTGACCAGTAGG |
R: GTGCTGGCAGATGGATCACT | |
U6 | F: CTCGCTTCGGCAGCACA |
R: AACGCTTCACGAATTTGCGT | |
EZH2 | F: CGGGGTACCGAGTCATACTTGTGAAG |
R: GCACTCGAGCCTGTTTTTGTTTGATG | |
GAPDH | F: GCACCGTCAAGGCTGAGAAC |
R: TGGTGAAGACGCCAGTGGA |
2.3 Western blot analysis
The testicular tissues or human SSCs with the treatment of miRNA oligonucleotides/overexpression plasmid were lysed with RIPA buffer. The concentrations of proteins were measured by the BCA kit. Thirty micrograms of cell lysate from each cell sample were used for SDS-PAGE (Bio-Rad). Then, the proteins were transferred into PVDF membranes (Roche, Germany) and blocked with 5 % non-fat dry milk (Carnation, CA). Subsequently, the samples were incubated with primary antibodies against EZH2 (ab191250, Abcam), GDNF (ab176564, Abcam), DAZL (ab34139, Abcam), Caspase-3 (ab32042, Abcam), Bax (ab32503, Abcam), and Bcl-2 (ab32124, Abcam) overnight at 4°C. The nitrocellulose membrane was incubated for 2 h after adding appropriate secondary antibodies (HRP-conjugated goat anti-rabbit) (Abcam). Finally, the expression of proteins was evaluated using enhanced chemiluminescence.
2.4 Immunohistochemical analysis
The testicular tissue sections were heated in pH 6.0 sodium citrate buffer and then dipped in deionized water containing 3% H2O2 to inhibit endogenous peroxidase activity. The sections were incubated with an EZH2 specific antibody (ab191250, Abcam) and HRP-labelled secondary antibody, respectively. Finally, the sections were stained with diaminobenzidine and counterstained with Harris’s hematoxylin.
2.5 Human SSC culture and transfection
The human SSC line was cultured with DMEM/F12 supplemented with 10% FBS and 100 units/mL penicillin and streptomycin (Invitrogen). The cells were passaged every 3-4 days using 0.05% trypsin (Invitrogen) and 0.53 mM EDTA (Invitrogen), and they were maintained at 34°C in a humidified 5% CO2 incubator. The EZH2 overexpressing plasmid was purchased by Ribobio (Guangzhou, China). The miR-22-5p mimic/inhibitor was synthesized by Ribobio (Guangzhou, China). Transfection of RNA mimic/inhibitor was conducted with Oligofectamine (Invitrogen) according to the manufacturer’s protocol. Plasmid transfection was conducted with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol.
2.6 EdU staining assay for cell proliferation
Transfected cells were spread on a round coverslip and incubated with 100 mM EdU (EdU Assay Kit, Beyotime Biotechnology). Cells were then washed with PBS, fixed with 4% PFA, and washed with 2 mg/mL glycine for 5 min. Next, cells were permeabilized in PBS containing 0.5% Triton X-100 for 20 min after removing the glycine solution. After washing with PBS, cell nuclei were stained with Hoechst (Abcam, 1:2,000). The coverslip was then sealed with an antifade mounting medium, and a laser scanning confocal microscope (Zeiss, LSM700) was used to photograph the samples using the same conditions.
2.7 Flow cytometry analysis for cell apoptosis
Human SSCs were seeded at a density of 5 × 104 cells/well in 12-well plates, and cells were collected on day 3 after transfection. Apoptosis in the human SSC line was measured using the Annexin V and PI apoptosis detection kit and flow cytometry according to the manufacturer’s instructions.
2.8 Luciferase reporter assays
EZH23′UTR including the predicted binding site of miR-22-5p (wt) or a site-directed gene mutated miR-22-5p-binding site (mut) was inserted downstream of the firefly luciferase gene of the psiCHECK2 vector (Promega). The wt or mut vector was co-transfected into SSCs with miR-22-5p mimic or mimic NC in 24-well plates. After 48 h, the cells were harvested and assayed by a Dual Luciferase Assay (Promega) following the manufacturer’s protocol.
2.9 Statistical analysis
The data are presented as the mean ± standard deviation (SD) and analyzed with GraphPad Prism 7.0 using one-way ANOVA and Tukey post-hoc test. The statistical significance was set at 0.05 (p < 0.05).
3 Results
3.1 The expression of miR-22-5p was increased in the testicular tissues of patients with cryptorchidism.
To investigate whether miR-22-5p functioned in the testicular tissues of patients with cryptorchidism, ten samples of testicular tissues from patients with cryptorchidism (cry group) and another ten samples of testicular tissues from people with normal fertility (NC group) were used for comparison. The RT-PCR results showed that the expression of miR-22-5p in the cry group was significantly higher than that in the NC group (Figure 1a), but the mRNA and protein expression of EZH2 were markedly reduced in the cry group (Figure 1b–d). In addition, the IHC results showed that there are more brown yellow, or brown dots in the NC group, indicating that EZH2 protein in the cry group is significantly lower than that of the NC group (Figure 1e). These data showed that miR-22-5p expression was increased while EZH2 expression was decreased in the testicular tissues of patients with cryptorchidism.

miR-22-5p was significantly upregulated in the testicular tissues of patients with cryptorchidism. Testicular tissues of cryptorchidism patients (cry group) and normal testicular tissues of fertile participants (NC group) were collected. (a) The expression of miR-22-5p was detected by QRT-PCR. (b–e) The expression of EZH2 in the testicular tissues was detected by QRT-PCR, western blot, and immunohistochemistry (scale bar = 50 µm). ***p < 0.001 vs NC group.
3.2 miR-22-5p regulates SSCs’ self-renewal
Knowing the abnormal expression of miR-22-5p in the testicular tissues of patients with cryptorchidism, next, to investigate the effect of miR-22-5p on SSCs’ self-renewal, human SSCs were transfected with miR-22-5p mimic or miR-22-5p inhibitor to overexpress or knock outmiR-22-5p, respectively. As shown in Figure 2a, the miR-22-5p overexpression, and knockout efficiency were detected by QRT-PCR. Then, the EdU assay showed that miR-22-5p mimic the reduced EdU positive cell number, while miR-22-5p inhibitor increased the EdU positive cell number (Figure 2b and c), indicating that miR-22-5p had a significant regulatory effect on the proliferation of SSCs. Meanwhile, the flow cytometry analysis showed that miR-22-5p mimic transfection increased cell apoptosis rate, while miR-22-5p inhibitor transfection decreased the cell apoptosis rate (Figure 2d and e). Furthermore, the western blot results showed that the trend of apoptotic proteins expression (Caspase-3, Bax and Bcl-2) was consistent with that of flow cytometry (Figure 2f and g), indicating that miR-22-5p had a significant regulatory effect on the apoptosis of SSCs. In addition, the expression of SSC marker proteins (GDNF and DAZL) were decreased by miR-22-5p mimic but increased by the miR-22-5p inhibitor, implying the effect of miR-22-5p on SSCs’ self-renewal.

Effect of miR-22-5p on SSCs. Human SSCs were transfected with the miR-22-5p mimic or miR-22-5p inhibitor, respectively. (a) The miR-22-5p overexpression and interference efficiency were detected by QRT-PCR. (b and c) Cell proliferation was measured by EdU staining. (d and e) Cell apoptosis was analyzed by Annexin V/PI staining. (f and g) The expression of SSC markers (GDNF and DAZL) and apoptosis-related proteins (Caspase-3, Bax, and Bcl-2) were detected by western blot. *p < 0.05, **p < 0.01 vs mimic NC; #p < 0.05, ##p < 0.01 vs inhibitor NC.
3.3 EZH2 is a direct target of miR-22-5p
To explore the mechanism of miR-22-5p promoting self-renewal of SSCs, TargetScan was used to predict the possible target genes. Then, we found that EZH2 is a target gene of miR-22-5p (Figure 3a). Subsequently, the luciferase reporter gene assays demonstrated that miR-22-5p can bind to the EZH2 mRNA 3′ UTR (Figure 3b). Furthermore, the mRNA and protein expression of EZH2 were remarkably reduced by the miR-22-5p mimic and increased by the miR-22-5p inhibitor (Figure 3c–e), which suggested that EZH2 is a direct target of miR-22-5p.

miR-22-5p directly targets EZH2. (a) The target region of the EZH2 3′UTR for miR-22-5p and the mutant type of EZH2 3′UTR. (b) Effects of miR-22-5p on the activity of firefly luciferase reporters containing either wild-type (Wt) or mutant-type (Mut) 3′UTR were assessed by luciferase reporter gene assays. (c–e) Effects of miR-22-5p on EZH2 expression levels were examined by qRT-PCR and western blot analyses. *p < 0.05, **p < 0.01 vs mimic NC; ##p < 0.01 vs inhibitor NC.
3.4 miR-22-5p regulates SSCs’ self-renewal by targeting EZH2
Finally, to explore whether miR-22-5p participates in spermatogenesis by regulating EZH2, we examined the reverse effect of EZH2 overexpression on the regulation of miR-22-5p on SSCs’ self-renewal. As shown in Figure 4a and b, the miR-22-5p mimic reduced the EdU positive cell number, the EZH2 overexpression plasmid increased the EdU positive cell number, and EZH2 overexpression could reverse the effect of the miR-22-5p mimic on SSCs’ proliferation. The flow cytometry results showed that miR-22-5p mimic increased SSCs’ apoptosis rate, the EZH2 overexpression plasmid decreased SSCs’ apoptosis rate, and EZH2 overexpression could reverse the effect of miR-22-5p mimic on SSCs’ apoptosis (Figure 4c and d). EZH2 overexpression could reverse the effect of miR-22-5p mimic on the expression of apoptosis-related proteins (Caspase-3, Bax, and Bcl-2) (Figure 4e and f). Besides, the expression of SSCs’ marker proteins (GDNF and DAZL) was decreased by miR-22-5p mimic, increased by the EZH2 overexpression plasmid, and EZH2 overexpression could reverse the effect of miR-22-5p mimic on the expression of GDNF and DAZL. These data demonstrated that miR-22-5p regulates SSCs’ self-renewal by targeting EZH2.

miR-22-5p regulates SSCs’ self-renewal by targeting EZH2. Human SSCs were co-transfected with miR-22-5p mimics and the EZH2 overexpression plasmid. (a and b) Cell proliferation was measured by EdU staining. (c and d) Cell apoptosis was analyzed by Annexin V/PI staining. (e and f) The expression of SSC markers (GDNF and DAZL) and apoptosis-related proteins (Caspase-3, Bax and Bcl-2) were detected by western blot. *p < 0.05, **p < 0.01 vs mimic NC + vector; #p < 0.05, ##p < 0.01 vs miR-22-5p mimic + vector.
4 Discussion
Spermatogonia, especially SSCs, is the key factor to maintain spermatogenesis [6]. Spermatogenesis is a process of proliferation and differentiation of male germ cells, in which post-transcriptional regulation is indispensable. As well known, miRNAs are one of the most common genes involved in post-transcriptional regulation [7,8]. Up to now, many miRNAs have been reported to be upregulated in the testicular tissues of patients with cryptorchidism [9,10]. Moritoki et al. [22] found that miR-22-5p was significantly highly expressed in unilateral undescended testes than that in normal testes in a rat model of cryptorchidism. In this study, we found that miR-22-5p was significantly upregulated in the testicular tissues of patients with cryptorchidism, which is consistent with the previous report.
Recent studies have reported that miR-22-5p is involved in hair follicle stem cell proliferation and differentiation [25]. Here, we propose that miR-22-5p may serve as a novel target for the proliferation and differentiation of SSCs. Subsequently, the effect of miR-22-5p on proliferation and differentiation of SSCs was studied by transfecting with the miR-22-5p mimic or miR-22-5p inhibitor. Our result reveals that the miR-22-5p mimic inhibited the proliferation of SSCs, increased cell apoptosis rate, and reduced the expression of SSC marker proteins (GDNF and DAZL); however, the miR-22-5p inhibitor has the opposite effect. The data suggested that miR-22-5p regulates SSCs’ self-renewal.
EZH2 is required for stable embryonic stem cells (ESCs) self-renewal by reducing H3K27me3 [26,27], and its expression in the testes has been previously reported [28]. Here, we found that EZH2 mRNA and protein expression were both significantly decreased in the testicular tissues of patients with cryptorchidism. According to many literature studies, EZH2 is the downstream target gene of multiple miRNAs [29]. Through TargetScan prediction, miR-22-5p could bind to the EZH2 mRNA 3′ UTR. Then, we confirmed their target binding relationship by the luciferase reporter gene assay. And further tests showed that the mRNA and protein expression of EZH2 were remarkably reduced by the miR-22-5p mimic and increased by miR-22-5p inhibitor, which suggested that EZH2 is a direct target of miR-22-5p. A recent study showed that EZH2 plays a pivotal role in the self-renewal of goat SSCs, and the knockdown of EZH2 might impair spermatogenesis in goats [24]. Here, we also demonstrated that EZH2 overexpression could reverse the effect of miR-22-5p mimic on SSCs’ proliferation, apoptosis, and SSCs; marker proteins expression, implying that miR-22-5p regulates SSCs’ self-renewal by targeting EZH2.
In conclusion, our results suggest that upregulation of miR-22-5p affects the self-renewal of human SSCs by targeting EZH2, which plays a key role in spermatogenesis, including the inhibition of cell proliferation, an increase of apoptosis, and changes of related gene expression. Our research provides new insights into the mechanism of male infertility caused by cryptorchidism. We propose that miR-22-5p may serve as a novel target for the treatment of infertility caused by cryptorchidism.
Acknowledgements
Not applicable.
-
Funding information: No funding was received in this study.
-
Authors contributions: W. Lv designed the study and drafted the paper; W. Lv, M. Yu, Y. Su performed the experiments; W. Lv, Y. Su analyzed the data; Y. Su revised the paper. All authors read and approved the paper.
-
Conflict of interest: All authors declare no conflict of interest.
-
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
[1] Gurney J, McGlynn K, Stanley J, Merriman T, Signal V, Shaw C, et al. Risk factors for cryptorchidism. Nat Rev Urol. 2017;14(9):534–48. 10.1038/nrurol.2017.90.Suche in Google Scholar PubMed PubMed Central
[2] Hughes I, Acerini C. Factors controlling testis descent. Eur J Endocrinol. 2008;159(Suppl 1):S75–82. 10.1530/EJE-08-0458.Suche in Google Scholar PubMed
[3] Mäkelä JA, Koskenniemi JJ, Virtanen HE, Toppari J. Testis Development. Endocr Rev. 2019;40(4):857–905. 10.1210/er.2018-00140.Suche in Google Scholar PubMed
[4] Kanatsu-Shinohara M, Shinohara T. Spermatogonial stem cell self-renewal and development. Annu Rev Cell Dev Biol. 2013;29:163–87. 10.1146/annurev-cellbio-101512-122353.Suche in Google Scholar PubMed
[5] Mäkelä J, Hobbs R. Molecular regulation of spermatogonial stem cell renewal and differentiation. Reproduction. 2019;158(5):R169–87. 10.1530/REP-18-0476.Suche in Google Scholar PubMed
[6] Subash S, Kumar P. Spermatogonial stem cells: a story of self-renewal and differentiation. Front Biosci (Landmark Ed). 2021;26:163–205. 10.2741/4891.Suche in Google Scholar PubMed
[7] Divisato G, Passaro F, Russo T, Parisi S. The key role of microRNAs in self-renewal and differentiation of embryonic stem cells. Int J Mol Sci. 2020;21(17):6285. 10.3390/ijms21176285.Suche in Google Scholar PubMed PubMed Central
[8] Chen W, Cui Y, Ning M, Zhang H, Yin C, He Z. The mechanisms and functions of microRNAs in mediating the fate determinations of human spermatogonial stem cells and Sertoli cells. Semin Cell Dev Biol. 2022;121:32–9. 10.1016/j.semcdb.2021.05.003.Suche in Google Scholar PubMed
[9] Procópio M, de Avelar G, Costa G, Lacerda S, Resende R, de França L. MicroRNAs in Sertoli cells: implications for spermatogenesis and fertility. Cell Tissue Res. 2017;370(3):335–46. 10.1007/s00441-017-2667-z.Suche in Google Scholar PubMed
[10] Kotaja N. MicroRNAs and spermatogenesis. Fertil Steril. 2014;101(6):1552–62. 10.1016/j.fertnstert.2014.04.025.Suche in Google Scholar PubMed
[11] Li C, Yang B, Pan P, Ma Q, Wu Y, Zhang Z, et al. MicroRNA-130a inhibits spermatogenesis by directly targeting androgen receptor in mouse Sertoli cells. Mol Reprod Dev. 2018;85(10):768–77. 10.1002/mrd.23058.Suche in Google Scholar PubMed
[12] Wang Y, Li X, Gong X, Zhao Y, Wu J. MicroRNA-322 regulates self-renewal of mouse spermatogonial stem cells through. Int J Biol Sci. 2019;15(4):857–69. 10.7150/ijbs.30611.Suche in Google Scholar PubMed PubMed Central
[13] Khanehzad M, Nourashrafeddin S, Abolhassani F, Kazemzadeh S, Madadi S, Shiri E, et al. MicroRNA-30a-5p promotes differentiation in neonatal mouse spermatogonial stem cells (SSCs). Reprod Biol Endocrinol. 2021;19(1):85. 10.1186/s12958-021-00758-5.Suche in Google Scholar PubMed PubMed Central
[14] Fu H, Zhou F, Yuan Q, Zhang W, Qiu Q, Yu X, et al. MiRNA-31-5p mediates the proliferation and apoptosis of human spermatogonial stem cells via targeting JAZF1 and Cyclin A2. Mol Ther Nucleic Acids. 2019;14:90–100. 10.1016/j.omtn.2018.11.004.Suche in Google Scholar PubMed PubMed Central
[15] Zhou F, Chen W, Cui Y, Liu B, Yuan Q, Li Z, et al. MiRNA-122-5p stimulates the proliferation and DNA synthesis and inhibits the early apoptosis of human spermatogonial stem cells by targeting CBL and competing with lncRNA CASC7. Aging (Albany NY). 2020;12(24):25528–46. 10.18632/aging.104158.Suche in Google Scholar PubMed PubMed Central
[16] Wang Y, Chang W, Zhang Y, Zhang L, Ding H, Qi H, et al. Circulating miR-22-5p and miR-122-5p are promising novel biomarkers for diagnosis of acute myocardial infarction. J Cell Physiol. 2019;234(4):4778–86. 10.1002/jcp.27274.Suche in Google Scholar PubMed
[17] Li H, Zhang P, Li F, Yuan G, Wang X, Zhang A, et al. Plasma miR-22-5p, miR-132-5p, and miR-150-3p are associated with acute myocardial infarction. Biomed Res Int. 2019;2019:5012648. 10.1155/2019/5012648.Suche in Google Scholar PubMed PubMed Central
[18] Jusoh AR, Mohan SV, Ping TL, Tengku Din TADAAB, Haron J, Romli RC, et al. Plasma circulating mirnas profiling for identification of potential breast cancer early detection biomarkers. Asian Pac J Cancer Prev. 2021;22(5):1375–81. 10.31557/APJCP.2021.22.5.1375.Suche in Google Scholar PubMed PubMed Central
[19] Wang J, Zhang H, Zhou X, Wang T, Zhang J, Zhu W, et al. Five serum-based miRNAs were identified as potential diagnostic biomarkers in gastric cardia adenocarcinoma. Cancer Biomark. 2018;23(2):193–203. 10.3233/CBM-181258.Suche in Google Scholar PubMed
[20] Dakterzada F, Targa A, Benítez I, Romero-ElKhayat L, de Gonzalo-Calvo D, Torres G, et al. Identification and validation of endogenous control miRNAs in plasma samples for normalization of qPCR data for Alzheimer’s disease. Alzheimers Res Ther. 2020;12(1):163. 10.1186/s13195-020-00735-x.Suche in Google Scholar PubMed PubMed Central
[21] Ragni E, Perucca Orfei C, De Luca P, Viganò M, Colombini A, Lugano G, et al. miR-22-5p and miR-29a-5p are reliable reference genes for analyzing extracellular vesicle-associated miRNAs in adipose-derived mesenchymal stem cells and are stable under inflammatory priming mimicking osteoarthritis condition. Stem Cell Rev Rep. 2019;15(5):743–54. 10.1007/s12015-019-09899-y.Suche in Google Scholar PubMed
[22] Moritoki Y, Hayashi Y, Mizuno K, Kamisawa H, Nishio H, Kurokawa S, et al. Expression profiling of microRNA in cryptorchid testes: miR-135a contributes to the maintenance of spermatogonial stem cells by regulating FoxO1. J Urol. 2014;191(4):1174–80. 10.1016/j.juro.2013.10.137.Suche in Google Scholar PubMed
[23] Jin C, Zhang Y, Wang Z, Wang X, Sun T, Li X, et al. EZH2 deletion promotes spermatogonial differentiation and apoptosis. Reproduction. 2017;154(5):615–25. 10.1530/REP-17-0302.Suche in Google Scholar PubMed
[24] Cai Y, Deng M, Liu Z, Zhang G, Pang J, An S, et al. EZH2 expression and its role in spermatogonial stem cell self-renewal in goats. Theriogenology. 2020;155:222–31. 10.1016/j.theriogenology.2020.06.013.Suche in Google Scholar PubMed
[25] Yan H, Gao Y, Ding Q, Liu J, Li Y, Jin M, et al. Exosomal micro RNAs derived from dermal papilla cells mediate hair follicle stem cell proliferation and differentiation. Int J Biol Sci. 2019;15(7):1368–82. 10.7150/ijbs.33233.Suche in Google Scholar PubMed PubMed Central
[26] Collinson A, Collier A, Morgan N, Sienerth A, Chandra T, Andrews S, et al. Deletion of the polycomb-group protein EZH2 leads to compromised self-renewal and differentiation defects in human embryonic stem cells. Cell Rep. 2016;17(10):2700–14. 10.1016/j.celrep.2016.11.032.Suche in Google Scholar PubMed PubMed Central
[27] Yu Y, Deng P, Yu B, Szymanski J, Aghaloo T, Hong C, et al. Inhibition of EZH2 promotes human embryonic stem cell differentiation into mesoderm by reducing H3K27me3. Stem Cell Reports. 2017;9(3):752–61. 10.1016/j.stemcr.2017.07.016.Suche in Google Scholar PubMed PubMed Central
[28] Hinz S, Magheli A, Weikert S, Schulze W, Krause H, Schrader M, et al. Deregulation of EZH2 expression in human spermatogenic disorders and testicular germ cell tumors. World J Urol. 2010;28(5):631–5. 10.1007/s00345-009-0498-6.Suche in Google Scholar PubMed
[29] Tremblay-LeMay R, Rastgoo N, Pourabdollah M, Chang H. EZH2 as a therapeutic target for multiple myeloma and other haematological malignancies. Biomark Res. 2018;6:34. 10.1186/s40364-018-0148-5.Suche in Google Scholar PubMed PubMed Central
© 2022 Wenqiang Lv et al., published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Artikel in diesem Heft
- Research Articles
- AMBRA1 attenuates the proliferation of uveal melanoma cells
- A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
- Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
- Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
- Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
- Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
- Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
- The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
- Gene signature to predict prognostic survival of hepatocellular carcinoma
- Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
- Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
- Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
- Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
- Pericentric inversion of chromosome 6 and male fertility problems
- Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
- Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
- Expression of DNM3 is associated with good outcome in colorectal cancer
- Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
- CRRT influences PICCO measurements in febrile critically ill patients
- SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
- lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
- circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
- Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
- GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
- A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
- Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
- Association between preventable risk factors and metabolic syndrome
- miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
- Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
- Quercitrin protects human bronchial epithelial cells from oxidative damage
- Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
- circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
- Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
- Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
- Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
- LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
- Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
- Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
- Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
- Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
- Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
- miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
- Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
- circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
- miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
- hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
- circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
- TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
- Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
- Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
- circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
- Human amniotic fluid as a source of stem cells
- lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
- NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
- Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
- Risk factors for adverse drug reactions associated with clopidogrel therapy
- Serum zinc associated with immunity and inflammatory markers in Covid-19
- The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
- LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
- Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
- Moscatilin suppresses the inflammation from macrophages and T cells
- Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
- Epithelial-mesenchymal transition-related genes in coronary artery disease
- The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
- Repeated partial splenic artery embolization for hypersplenism improves platelet count
- Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
- Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
- miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
- The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
- Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
- Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
- A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
- Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
- MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
- miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
- Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
- circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
- Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
- Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
- Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
- Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
- Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
- β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
- Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
- In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
- Potential biomarkers for inflammatory response in acute lung injury
- A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
- Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
- ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
- Risk prediction of cardiovascular disease using machine learning classifiers
- Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
- Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
- Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
- Protective effects of glaucocalyxin A on the airway of asthmatic mice
- Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
- Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
- Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
- Identification of osteoporosis based on gene biomarkers using support vector machine
- Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
- miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
- Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
- LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
- The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
- Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
- Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
- lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
- Protective effect of ghrelin on intestinal I/R injury in rats
- In vivo knee kinematics of an innovative prosthesis design
- Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
- lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
- Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
- LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
- Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
- SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
- Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
- Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
- Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
- Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
- Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
- Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
- TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
- Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
- NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
- The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
- miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
- Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
- lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
- Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
- lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
- circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
- LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
- Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
- lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
- SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
- Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
- Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
- Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
- Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
- Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
- Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
- Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
- The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
- Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
- HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
- Meta-analysis of early-life antibiotic use and allergic rhinitis
- Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
- HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
- Amino acid profiles in the tissue and serum of patients with liver cancer
- Pain in critically ill COVID-19 patients: An Italian retrospective study
- Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
- Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
- Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
- The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
- Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
- SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
- The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
- TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
- Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
- Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
- The incidence of bronchiectasis in chronic obstructive pulmonary disease
- Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
- Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
- Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
- lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
- Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
- lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
- DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
- Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
- MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
- Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
- circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
- EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
- Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
- miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
- Review Articles
- Current management of cancer pain in Italy: Expert opinion paper
- Hearing loss and brain disorders: A review of multiple pathologies
- The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
- Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
- Interleukin-35 in autoimmune dermatoses: Current concepts
- Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
- Advantages of ketamine in pediatric anesthesia
- Congenital adrenal hyperplasia. Role of dentist in early diagnosis
- Migraine management: Non-pharmacological points for patients and health care professionals
- Atherogenic index of plasma and coronary artery disease: A systematic review
- Physiological and modulatory role of thioredoxins in the cellular function
- Case Reports
- Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
- A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
- Unusual neurological manifestations of bilateral medial medullary infarction: A case report
- Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
- A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
- A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
- Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
- Fungal infection mimicking COVID-19 infection – A case report
- Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
- Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
- Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
- Trismus during tracheal extubation as a complication of general anaesthesia – A case report
- Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
- Two case reports of skin vasculitis following the COVID-19 immunization
- Ureteroiliac fistula after oncological surgery: Case report and review of the literature
- Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
- Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
- Commentary
- Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
- Rapid Communication
- COVID-19 fear, post-traumatic stress, growth, and the role of resilience
- Erratum
- Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
- Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
- Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
- Retraction
- Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
- Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
- Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Artikel in diesem Heft
- Research Articles
- AMBRA1 attenuates the proliferation of uveal melanoma cells
- A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
- Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
- Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
- Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
- Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
- Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
- The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
- Gene signature to predict prognostic survival of hepatocellular carcinoma
- Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
- Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
- Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
- Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
- Pericentric inversion of chromosome 6 and male fertility problems
- Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
- Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
- Expression of DNM3 is associated with good outcome in colorectal cancer
- Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
- CRRT influences PICCO measurements in febrile critically ill patients
- SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
- lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
- circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
- Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
- GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
- A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
- Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
- Association between preventable risk factors and metabolic syndrome
- miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
- Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
- Quercitrin protects human bronchial epithelial cells from oxidative damage
- Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
- circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
- Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
- Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
- Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
- LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
- Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
- Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
- Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
- Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
- Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
- miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
- Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
- circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
- miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
- hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
- circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
- TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
- Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
- Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
- circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
- Human amniotic fluid as a source of stem cells
- lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
- NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
- Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
- Risk factors for adverse drug reactions associated with clopidogrel therapy
- Serum zinc associated with immunity and inflammatory markers in Covid-19
- The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
- LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
- Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
- Moscatilin suppresses the inflammation from macrophages and T cells
- Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
- Epithelial-mesenchymal transition-related genes in coronary artery disease
- The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
- Repeated partial splenic artery embolization for hypersplenism improves platelet count
- Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
- Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
- miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
- The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
- Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
- Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
- A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
- Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
- MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
- miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
- Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
- circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
- Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
- Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
- Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
- Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
- Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
- β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
- Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
- In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
- Potential biomarkers for inflammatory response in acute lung injury
- A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
- Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
- ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
- Risk prediction of cardiovascular disease using machine learning classifiers
- Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
- Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
- Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
- Protective effects of glaucocalyxin A on the airway of asthmatic mice
- Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
- Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
- Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
- Identification of osteoporosis based on gene biomarkers using support vector machine
- Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
- miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
- Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
- LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
- The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
- Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
- Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
- lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
- Protective effect of ghrelin on intestinal I/R injury in rats
- In vivo knee kinematics of an innovative prosthesis design
- Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
- lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
- Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
- LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
- Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
- SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
- Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
- Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
- Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
- Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
- Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
- Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
- TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
- Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
- NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
- The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
- miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
- Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
- lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
- Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
- lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
- circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
- LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
- Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
- lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
- SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
- Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
- Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
- Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
- Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
- Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
- Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
- Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
- The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
- Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
- HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
- Meta-analysis of early-life antibiotic use and allergic rhinitis
- Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
- HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
- Amino acid profiles in the tissue and serum of patients with liver cancer
- Pain in critically ill COVID-19 patients: An Italian retrospective study
- Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
- Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
- Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
- The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
- Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
- SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
- The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
- TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
- Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
- Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
- The incidence of bronchiectasis in chronic obstructive pulmonary disease
- Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
- Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
- Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
- lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
- Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
- lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
- DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
- Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
- MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
- Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
- circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
- EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
- Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
- miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
- Review Articles
- Current management of cancer pain in Italy: Expert opinion paper
- Hearing loss and brain disorders: A review of multiple pathologies
- The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
- Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
- Interleukin-35 in autoimmune dermatoses: Current concepts
- Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
- Advantages of ketamine in pediatric anesthesia
- Congenital adrenal hyperplasia. Role of dentist in early diagnosis
- Migraine management: Non-pharmacological points for patients and health care professionals
- Atherogenic index of plasma and coronary artery disease: A systematic review
- Physiological and modulatory role of thioredoxins in the cellular function
- Case Reports
- Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
- A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
- Unusual neurological manifestations of bilateral medial medullary infarction: A case report
- Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
- A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
- A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
- Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
- Fungal infection mimicking COVID-19 infection – A case report
- Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
- Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
- Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
- Trismus during tracheal extubation as a complication of general anaesthesia – A case report
- Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
- Two case reports of skin vasculitis following the COVID-19 immunization
- Ureteroiliac fistula after oncological surgery: Case report and review of the literature
- Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
- Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
- Commentary
- Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
- Rapid Communication
- COVID-19 fear, post-traumatic stress, growth, and the role of resilience
- Erratum
- Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
- Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
- Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
- Retraction
- Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
- Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
- Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy