Abstract
LIM domain only 3 (LMO3) interacts with transcription factors to regulate target genes involved in embryonic development. The oncogenic role of LMO3 in hepatocellular carcinoma, gastric cancer, and neuroblastoma has been reported recently. However, little is known about the biological function of LMO3 in papillary thyroid carcinoma (PTC). First, expression of LMO3 was dramatically enhanced in the PTC tissues and cell lines. Second, knockdown of LMO3 in PTC cells repressed cell proliferation and promoted cell apoptosis with downregulated Bcl-2 and upregulated cleaved caspase-3/PARP. In vitro cell migration and invasion of PTC were also retarded by siRNA-mediated silence of LMO3. Third, protein expression of LIM kinase (LIMK) 1-mediated phosphorylation of cofilin and nuclear translocation of β-catenin were reduced by the knockdown of LMO3. pcDNA-mediated overexpression of LIMK1 promoted cofilin phosphorylation and attenuated LMO3 silence-induced decrease of cofilin phosphorylation. Last, enhanced LIMK1 expression promoted PTC cell proliferation and metastasis and counteracted the suppressive effects of LMO3 silence on PTC cell proliferation and metastasis. In conclusion, LMO3 promoted PTC cell proliferation and metastasis by regulating LIMK1-mediated cofilin and the β-catenin pathway.
1 Introduction
Thyroid cancer, including papillary thyroid carcinoma (PTC), follicular thyroid cancer (FTC), medullary thyroid cancer (MTC), and anaplastic thyroid cancer (ATC), is the most common cancer of the endocrine system [1]. The increased incidence and the stable mortality rate of thyroid cancer appear to be due to the devoid of effective therapeutic strategies [1]. PTC, the most common subtype of thyroid cancer, accounts for 80% of all the cases [2]. PTC presents polycentrality in the thyroid gland and often metastases to local lymph nodes, which increases morbidity and mortality [3]. Therefore, it is necessary to find effective diagnostic markers or therapeutic targets for the treatment of PTC.
LIM domain only 3 (LMO3) belongs to the LMO protein family and is involved in the differentiation of various cells and the development of embryos, thus playing an important role in the development of the nervous system [4]. Moreover, LMO3 has been reported to regulate tumor signal transduction pathways through binding with other transcriptional factors. For example, LMO3 is a key downstream target of transcription signal of and participates in the NK2 Homeobox 1-mediated occurrence of lung cancer [5]. Nescient helix-loop-helix 2 binds to LMO3 to downregulate the expression of hes family bHLH transcription factor 1 through transactivation of achaete-scute complex-like 1 and induces malignant transformation of neuroblastoma [6]. LMO3 also binds to the tumor suppressor gene p53 and inhibits the transcriptional activation of apoptotic proteins downstream of p53 [7]. Therefore, LMO3 was considered to be an oncogene in the progression of gastric cancer [8], glioma [9], and hepatocellular carcinoma [10]. Recent research has reported that the expression level of LMO3 was increased in thyroid tumor [11]. However, little is known about the biological function of LMO3 in tumorigenicity of PTC.
Research has shown that LMO3 directly interacts with large tumor suppressor kinase (LATS) 1 to inhibit the phosphorylation of LATS1 and promote Rho GTPases activities, thus suppressing Hippo signal to promote the invasion and metastasis of hepatocellular carcinoma [10]. LATS1 binds to LIM kinase (LIMK) 1 and inhibits the activity of LIMK1 to regulate cytokinesis [12], and LIMK1 was implicated in the pathogenesis of thyroid cancer [13] and ATC [14]. Therefore, we hypothesized that LMO3 might affect the activity of LIMK1 to participate in the tumorigenicity of PTC.
In this study, the expression pattern and role of LMO3 in PTC were examined, and the mechanism of LMO3-mediated PTC cell metastasis was investigated by the loss of functional assays.
2 Materials and methods
2.1 Human tumor tissues
Pairs of PTC and adjacent normal tissues (N = 43) were acquired from patients that were recruited at the Yongchuan Hospital of Chongqing Medical University from 2015 to 2019 through thyroidectomies. All the patients signed informed consent. This study was approved by Yongchuan Hospital of Chongqing Medical University and in accordance with the 1964 Helsinki Declaration and its later amendments for ethical research involving human subjects.
2.2 Immunohistochemistry
PTC and adjacent normal tissues were fixed with 10% formalin and then embedded in paraffin. Formalin-fixed and paraffin-embedded tissues were then sectioned into 4 µm thick sections. The sections were incubated with 3% H2O2, and then immersed in Tris-EDTA buffer (pH 9.0) with 0.05% Tween 20 for 30 min at 95°C. After blocking in 4% dry milk and 0.3% goat serum, the sections were incubated overnight with anti-LMO3 antibody (1:100; Abcam, Cambridge, MA, USA). Following incubation with horseradish peroxidase-labeled secondary antibody and counterstaining with hematoxylin, the slides were examined under a light microscope (Olympus, Tokyo, Japan).
2.3 Cell culture
Human PTC cell lines (TPC-1, CAL62, IHH-4) and normal human thyroid cell lines (Nthy-ori3-1) were purchased from Shanghai Huiying biological technology (Shanghai, China). Cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum (Lonza, Basel, Switzerland) in a 37°C incubator.
2.4 Cell transfection
siRNAs targeting LMO3 (siLMO3-1#: F: 5′-GGACUACGAGGAAGGUUUAdTdT-3′, R: 5′-UAAACCUUCCUCGUAGUCCdTdT-3′; or 2#: F: 5′-GCUGCAACCGAAAGAUCAAdTdT-3′, R: 5′-UUGAUCUUUCGGUUGCAGCdTdT-3′) and the negative control (siNC: 5′-CCAUUCCGAUCCUGAUCCG-3′) were synthesized by GenePharma (Suzhou, China). pcDNA vector was used to upregulate LIMK1. TPC-1 and CAL62 were seeded into 96-well plates and transfected with siNC, siLMO3-1#, or 2# via Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). TPC-1 and CAL62 were also cotransfected with siLMO3-2# and pcDNA-LIMK1 by Lipofectamine 2000. Two days later, the cells were conducted with functional assays.
2.5 qRT-PCR
The transfected TPC-1 and CAL62 were performed with RNAiso Plus reagent (Takara, Kusatsu, Japan) for the isolation of RNAs. RNA was then reverse-transcribed into cDNA with the First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA), and the qRT-PCR analysis was performed with Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA). The primer sequences of selected genes are listed in Table 1 with GAPDH as the endogenous control. The fold change of SFRP1 was calculated with 2−ΔΔCt with the following primers.
Primers
ID | Sequence (5′-3′) |
---|---|
GAPDH F | AGGTCGGTGTGAACGGATTTG |
GAPDH R | TGTAGACCATGTAGTTGAGGTC |
LMO3 F | TCTGAGGCTCTTTGGTGTAACG |
LMO3 R | CCAGGTGGTAAACATTGTCCTTGx |
2.6 Cell viability and EdU staining
The transfected TPC-1 and CAL62 were reseeded into the 96-well plate and incubated for 24, 48, and 72 h. A total of 10 µL of CCK-8 solution (Beyotime, Beijing, China) was added to each well and incubated for 1 h. A Microplate Reader (BioTek, Winooski, VT, USA) was then used to measure the absorbance at 450 nm. For EdU staining, the transfected TPC-1 and CAL62 were reseeded into the 96-well plate and incubated with 50 µM EdU (RiboBio, Guangzhou, China) for 12 h. Paraformaldehyde-fixed cells were incubated with 2 mg/mL glycine and then with 0.5% Triton X-100. EdU antibody (1:500; Abcam) was used to stain the cells, and DAPI was used to stain the nuclei. The Apollo staining reaction buffer was used for EdU immunostaining, and the cells were examined under a microscope (Olympus).
2.7 Flow cytometer
The transfected TPC-1 and CAL62 were detached by trypsinization and then resuspended in the binding buffer of Annexin V-FITC/PI double staining apoptosis detection kit (KeyGEN BioTech, Jiangning, Nanjing, China). Cells were then stained with 5 µL of PI and 5 µL of annexin V (KeyGEN BioTech). The apoptotic ratio was analyzed with a FACS flow cytometer (Life Technologies, Darmstadt, Germany).
2.8 Western blot
The transfected TPC-1 and CAL62 were lysed with RIPA buffer (Ding Guo Chang Sheng Biotech, Beijing, China) for 30 min on ice. Following centrifugation at 12,000×g, the concentrations of the cell lysates were measured with a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). The cell lysates (30 µg) were analyzed with SDS-PAGE, and electro-transferred onto the PVDF membrane (Thermo Fisher Scientific). The primary antibodies, including anti-LATS1 (ab70561) and anti-p-LATS1 (ab111344) (1:1,500; Abcam); anti-YAP (ab52771) and anti-p-YAP (ab62751) (1:2,000; Abcam); anti-LMO3 (ab230490), anti-LIMK1 (ab39641), and anti-p-LIMK1 (ab194798) (1:2,500; Abcam); anti-Bcl-2 (ab194583) and anti-β-actin (ab8227) (1:3,000; Abcam); anti-cleaved caspase-3 (ab2302) and anti-cleaved PARP (ab4830) (1:3,500; Abcam); anti-cofilin (ab42824) and anti-p-cofilin (ab12866) (1:4,000; Abcam); anti-β-catenin (ab6302), anti-β-tubulin (ab6046), and anti-Histone H3 (ab18521) (1:4,500; Abcam); were used to probe the membranes that were blocked with 5% bovine serum albumin. The membranes were incubated with horseradish peroxidase-conjugated immunoglobulin G (ab6721) (1:6,000; Abcam), and the blots were detected by enhanced chemiluminescence (KeyGen, Nanjin, China).
2.9 Wound healing and transwell assays
The transfected TPC-1 and CAL62 were reseeded into 6-well plates for 24 h. A sterile pipette tip was used to generate a scratch. The widths of the scratches were calculated 48 h later under a microscope. For transwell assay, the transfected TPC-1 and CAL62 in serum-free medium were planted in the apical chamber with Matrigel (Biosciences, San Jose, CA, USA). The medium containing 20% fetal bovine serum was added into the basolateral chamber. After 24 h, cells in the basolateral chamber were fixed in 10% formaldehyde, stained with 0.1% crystal violet, and measured under a microscope.
2.10 Statistical analysis
Results of the experiments performed in triplicates independently were presented as mean ± SD. Statistical analyses between different groups were performed with one-way analysis of variance or Student’s t-test with SPSS19.0 software. Values were considered significant at p < 0.05.
-
Ethics approval: Ethical approval was obtained from the Ethics Committee of thw Yongchuan Hospital of Chongqing Medical University.
-
Statement of informed consent: Written informed consent was obtained from a legally authorized representative(s) for anonymized patient information to be published in this article.
3 Results
3.1 Upregulation of LMO3 in PTC
We first measured mRNA expression of LMO3 in 43 pairs of PTC and adjacent normal tissues by qRT-PCR. The result showed that LMO3 expression was elevated in the PTC tissues compared to the adjacent normal tissues (Figure 1a). Immunohistochemical analysis also confirmed the higher expression of LMO3 in the PTC tissues than the adjacent normal tissues (Figure 1b). Moreover, we identified the higher mRNA (Figure 1c) and protein (Figure 1d) expression of LMO3 in the human PTC cell lines (TPC-1, CAL62, IHH-4) than that in the normal human thyroid cell line (Nthy-ori3-1), suggesting the possible relation between LMO3 and PTC progression.

Upregulation of LMO3 in PTC. (a) LMO3 expression was elevated in the PTC tissues compared to that in the adjacent normal tissues via qRT-PCR analysis. (b) LMO3 expression was elevated in the PTC tissues compared to that in the adjacent normal tissues via immunohistochemical analysis. (c) LMO3 expression was elevated in the PTC cell lines (TPC-1, CAL62, IHH-4) compared to that in the normal human thyroid cell line (Nthy-ori3-1) via qRT-PCR analysis. (d) LMO3 expression was elevated in the PTC cell lines (TPC-1, CAL62, IHH-4) compared to that in the normal human thyroid cell line (Nthy-ori3-1) via western blot analysis. ** vs normal or Nthy-ori3-1, p < 0.01.
3.2 LMO3 promoted PTC cell proliferation
To unravel the regulatory role of LMO3 on PTC progression, TPC-1 and CAL62 were transfected with siRNAs targeting LMO3. Western blot analysis showed lower expression of LMO3 by siLMO3-1# and 2# (Figure 2a). Knockdown of LMO3 decreased cell viability of TPC-1 and CAL62 (Figure 2b), reduced cell proliferation (Figure 2c), and promoted cell apoptosis (Figure 2d). Protein expression of cleaved caspase-3 and cleaved PARP were enhanced, while Bcl-2 was reduced in TPC-1 and CAL62 that were transfected with siLMO3-1# and 2# (Figure 2e), suggesting the anti-proliferative and pro-apoptotic effects of LMO3 silence on PTC.

LMO3 promoted PTC cell proliferation. (a) LMO3 protein expression was downregulated in the PTC cell lines (TPC-1, CAL62) by transfection with siLMO3-1# and 2#. Knockdown of LMO3 (b) decreased cell viability of TPC-1 and CAL62, (c) reduced the cell proliferation of TPC-1 and CAL62, (d) promoted the cell apoptosis of TPC-1 and CAL62, and (e) enhanced protein expression of cleaved caspase-3 and cleaved PARP and reduced Bcl-2 in TPC-1 and CAL62. ** vs siNC, p < 0.01.
3.3 LMO3 promoted PTC cell metastasis
Cell migrations of TPC-1 and CAL62 were suppressed by the knockdown of LMO3 (Figure 3a). Moreover, transfection with siLMO3-1# and 2# repressed the cell invasion of TPC-1 and CAL62 (Figure 3b). These results demonstrated the anti-invasive effect of LMO3 silence on PTC.

LMO3 promoted PTC cell metastasis. Knockdown of LMO3 (a) repressed cell migration of TPC-1 and CAL62 and (b) repressed cell invasion of TPC-1 and CAL62. ** vs siNC, p < 0.01.
3.4 LMO3 contributed to LIMK1-mediated activation of cofilin and β-catenin pathways
Protein expressions of LIMK1 and cofilin were not affected by the knockdown of LMO3 in TPC-1 and CAL62 (Figure 4a). However, phosphorylation of LIMK1 and cofilin was reduced by knockdown of LMO3 (Figure 4a). Moreover, protein expression of cytoplasmic β-catenin was enhanced, while nuclear β-catenin was reduced in TPC-1 and CAL62 that were transfected with siLMO3-1# and 2# (Figure 4b), while the nuclear translocation of β-catenin was decreased by knockdown of LMO3 (Figure 4b). Overexpression of LIMK1 promoted phosphorylation of cofilin (Figure 4c) and attenuated LMO3 silence-induced decrease of cofilin phosphorylation (Figure 4c). Moreover, overexpression of LIMK1 attenuated LMO3 silence-induced upregulation of cytoplasmic β-catenin and downregulation of nuclear β-catenin (Figure 4d), suggesting that silence of LMO3 suppressed LIMK1-mediated activation of cofilin and β-catenin in PTC. The knockdown of LMO3 reduced the phosphorylation of LATS1 and YAP in TPC-1 and CAL62 (Figure A1), thus promoting the activation of the Hippo signaling pathway in PTC.

LMO3 contributed to LIMK1-mediated activation of cofilin and β-catenin pathways. (a) Knockdown of LMO3 decreased protein expression of cofilin and LIMK1 phosphorylation, while it had no significant effect on LIMK1 and cofilin in TPC-1 and CAL62. (b) Knockdown of LMO3 increased protein expression of cytoplasmic β-catenin and decreased nuclear translocation of β-catenin in TPC-1 and CAL62. (c) Overexpression of LIMK1 promoted protein expression of cofilin phosphorylation and attenuated LMO3 silence-induced decrease of cofilin phosphorylation in TPC-1 and CAL62. (d) Overexpression of LIMK1 attenuated LMO3 silence-induced upregulation of cytoplasmic β-catenin and downregulation of nuclear β-catenin in TPC-1 and CAL62. ** vs siNC or siNC + vector, p < 0.01. #, ## vs siNC + LIMK1, p < 0.05, p < 0.01.
3.5 Overexpression of LIMK1 counteracted with the suppressive effects of LMO3 silence on the PTC cell growth and metastasis
TPC-1 and CAL62 were cotransfected with siLMO3-2# and pcDNA-LIMK1 to investigate the role of the LMO3/LIMK1 axis on PTC progression. Overexpression of LIMK1 increased the cell viability of TPC-1 and CAL62 (Figure 5a) and weakened the silence of LMO3-induced decrease of PTC cell viability (Figure 5a). Overexpression of LIMK1 showed reversed effects on protein expression of Bcl-2, cleaved caspase-3, and cleaved PARP compared to the silence of LMO3 (Figure 5b), and ectopic LIMK1 expression attenuated LMO3 silence-induced decrease of Bcl-2 and increase of cleaved caspase-3 and cleaved PARP (Figure 5b). Moreover, LIMK1 overexpression promoted cell migration (Figure 5c) and invasion (Figure 5d) of TPC-1 and CAL62, and counteracted the suppressive effects of LMO3 silence on PTC cell metastasis.

Overexpression of LIMK1 counteracted the suppressive effects of LMO3 silence on PTC cell growth and metastasis. (a) Overexpression of LIMK1 increased cell viability of TPC-1 and CAL62 and weakened silence of LMO3-induced decrease of PTC cell viability. (b) Overexpression of LIMK1 increased protein expression of Bcl-2, decreased cleaved caspase-3 and cleaved PARP in TPC-1 and CAL62, and weakened silence of LMO3-induced decrease of Bcl-2 and increase of cleaved caspase-3 and cleaved PARP. (c) Overexpression of LIMK1 promoted cell migration of TPC-1 and CAL62 and weakened silence of LMO3-induced decrease of PTC cell migration. (d) Overexpression of LIMK1 promoted cell invasion of TPC-1 and CAL62 and weakened silence of LMO3-induced decrease of PTC cell invasion. ** vs siNC or siNC + vector, p < 0.01. ## vs siNC + LIMK1, p < 0.01.
4 Discussion
The LMO protein family contains conserved LIM domains to bind with other transcriptional factors to mediate gene expression programs during developmental processes, thus participating in the onset and progression of cancers, such as neuroblastoma, breast cancer, and T cell leukemia [15]. Activation of LMO4 expression was implicated in the progression of PTC [16]. Since LMO3 was found to be upregulated in the thyroid tumor [11], the biological function of LMO3 on PTC progression was investigated in this study.
Our results first demonstrated that LMO3 was elevated in PTC tissues and cells. The previous study has shown that LMO3 expression was significantly associated with disease-free survival and overall survival of patients with gastric cancer [8], and the relation between LMO3 expression and clinicopathological factors of PTC patients should be investigated to suggest the diagnostic or prognostic roles of LMO3 on PTC. The oncogenic role of LMO3 on PTC was then identified, and it demonstrated that knockdown of LMO3 reduced cell viability of PTC, promoted cell apoptosis, and suppressed cell proliferation, migration, and invasion.
LATS1, the key regulator of the Hippo pathway, was found to be a binding partner of LMO3 during tumorigenesis of hepatocellular carcinoma [10]. Upregulation of LATS1 through downregulation of miR-103a-3p repressed malignancy of thyroid cancer [17]. Moreover, LATS1 colocalizes with LIMK1 to regulate cytokinesis [12] and mediates activation of LIMK1 through phosphorylation of kinesin-like motor protein KIF23 [18]. LIMK1 phosphorylates the potent regulator of actin filament dynamics, cofilin, to regulate cell migration [19] and actin dynamics [20]. Here, our results showed that knockdown of LMO3 decreased protein expression of cofilin phosphorylation, while it had no significant effects on LIMK1 and cofilin expression. Moreover, overexpression of LIMK1 promoted cofilin phosphorylation and attenuated the silence of LMO3-induced decrease of cofilin phosphorylation. The phosphorylation of LIMK1 should be investigated to unravel whether LMO3 contributed to LIMK1 phosphorylation to promote cofilin phosphorylation.
A previous study has shown that LIMK1-mediated phosphorylation of cofilin promoted colorectal cancer progression [21], and silence of LIMK1/cofilin pathway abrogated tumor cell growth and metastasis [22]. Moreover, the active form of cofilin was implicated in aurora kinase A-induced PTC metastasis [23]. Overexpression of LIMK1 in this study enhanced the cell viability of PTC, reduced cell apoptosis, and promoted migration and invasion. In addition, ectopic expression of LIMK1 attenuated knockdown of LMO3-induced inhibition of PTC cell growth and metastasis. Therefore, LMO3 might contribute to PTC progression through LIMK1-mediated cofilin phosphorylation.
LIMK1 was reported to be overexpressed in colorectal cancer tissues and functioned as a competitive inhibitor of LIMK2 to promote the nuclear translocation of β-catenin, thus promoting tumor progression through activation of the Wnt/β-catenin pathway [24]. Enhanced Wnt/β-catenin pathway was essential for the cell growth and survival of PTC [25]. Our results showed that knockdown of LMO3 decreased the nuclear translocation of β-catenin in PTC cells, suggesting that LMO3 might also contribute to PTC progression through LIMK1-mediated nuclear translocation of β-catenin.
In conclusion, this study for the first time proved that reduced LMO3 expression in PTC promoted apoptosis, and suppressed proliferation, migration, and invasion. LIMK1-mediated cofilin phosphorylation and β-catenin nuclear translocation were identified as novel mechanisms of LMO3 in tumors. These results would advance the understanding of the pathogenesis of PTC and might provide a potential therapeutic target for the treatment of PTC.
Acknowledgements
Not applicable.
-
Funding information: Not applicable.
-
Author contributions: Zeyi Ling and Xiaoli Long designed the study and supervised the data collection; Ying Wu analyzed and interpreted the data; Jie Li and Mingliang Feng prepared the manuscript for publication and reviewed the draft of the manuscript. All authors have read and approved the manuscript.
-
Conflict of interest: The authors state that there are no conflicts of interest to disclose.
-
Data availability statement: The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.
Appendix

Knockdwon of LMO3 reduced the phosphorylation of LATS1 and YAP expression in TPC-1 and CAL62. *, ** vs siNC, p < 0.05, p < 0.01.
References
[1] Raue F, Frank-Raue K. Thyroid cancer: risk-stratified management and individualized therapy. Clin Cancer Res. 2016;22(20):5012. 10.1158/1078-0432.CCR-16-0484.Suche in Google Scholar
[2] Agrawal N, Akbani R, Aksoy BA, Ally A, Arachchi H, Asa Sylvia L, et al. Integrated genomic characterization of papillary thyroid carcinoma. Cell. 2014;159(3):676–90. 10.1016/j.cell.2014.09.050.Suche in Google Scholar
[3] Massoni F, Simeone C, Ricci P, Onofri E, Ricci S. Papillary thyroid carcinoma and medicolegal considerations. Minerva Medica. 2013;104:493–4.Suche in Google Scholar
[4] Rétaux S, Bachy I. A short history of LIM domains (1993–2002). Mol Neurobiol. 2002;26(2):269–81. 10.1385/MN:26:2-3:269.Suche in Google Scholar
[5] Watanabe H, Francis JM, Woo MS, Etemad B, Lin W, Fries DF, et al. Integrated cistromic and expression analysis of amplified NKX2-1 in lung adenocarcinoma identifies LMO3 as a functional transcriptional target. Genes Dev. 2013;27(2):197–210. 10.1101/gad.203208.112.Suche in Google Scholar
[6] Isogai E, Ohira M, Ozaki T, Oba S, Nakamura Y, Nakagawara A. Oncogenic LMO3 collaborates with HEN2 to enhance neuroblastoma cell growth through transactivation of Mash1. PLoS One. 2011;6(5):e19297-e. 10.1371/journal.pone.0019297.Suche in Google Scholar PubMed PubMed Central
[7] Larsen S, Yokochi T, Isogai E, Nakamura Y, Ozaki T, Nakagawara A. LMO3 interacts with p53 and inhibits its transcriptional activity. Biochem Biophys Res Commun. 2010;392(3):252–7. 10.1016/j.bbrc.2009.12.010.Suche in Google Scholar PubMed
[8] Qiu Y-S, Jiang N-N, Zhou Y, Yu K-Y, Gong H-Y, Liao G-J. LMO3 promotes gastric cancer cell invasion and proliferation through Akt-mTOR and Akt-GSK3β signaling. Int J Mol Med. 2018;41(5):2755–63. 10.3892/ijmm.2018.3476.Suche in Google Scholar PubMed PubMed Central
[9] Zhang Y, An J, Pei Y. LncRNA SNHG6 promotes LMO3 expression by sponging miR-543 in glioma. Mol Cell Biochem. 2020;472(1):9–17. 10.1007/s11010-020-03772-0.Suche in Google Scholar PubMed
[10] Cheng Y, Hou T, Ping J, Chen T, Yin B. LMO3 promotes hepatocellular carcinoma invasion, metastasis and anoikis inhibition by directly interacting with LATS1 and suppressing Hippo signaling. J Exp Clin Cancer Res: CR. 2018;37(1):228. 10.1186/s13046-018-0903-3.Suche in Google Scholar PubMed PubMed Central
[11] Abend M, Pfeiffer RM, Ruf C, Hatch M, Bogdanova TI, Tronko MD, et al. Iodine-131 dose dependent gene expression in thyroid cancers and corresponding normal tissues following the Chernobyl accident. PLoS One. 2012;7(7):e39103-e. 10.1371/journal.pone.0039103.Suche in Google Scholar PubMed PubMed Central
[12] Yang X, Yu K, Hao Y, Li DM, Stewart R, Insogna KL, et al. LATS1 tumour suppressor affects cytokinesis by inhibiting LIMK1. Nat Cell Biol. 2004;6(7):609–17. 10.1038/ncb1140.Suche in Google Scholar PubMed
[13] Xiong Y, Zhang L, Kebebew E. Abstract 4191: MiR-20a inhibits thyroid cancer cell growth and invasion through LIMK1. Cancer Res. 2013;73:4191. 10.1158/1538-7445.AM2013-4191.Suche in Google Scholar
[14] Xiong Y, Zhang L, Kebebew E. MiR-20a Is upregulated in anaplastic thyroid cancer and targets LIMK1. PLoS One. 2014;9:e96103. 10.1371/journal.pone.0096103.Suche in Google Scholar PubMed PubMed Central
[15] Matthews JM, Lester K, Joseph S, Curtis DJ. LIM-domain-only proteins in cancer. Nat Rev Cancer. 2013;13(2):111–22. 10.1038/nrc3418.Suche in Google Scholar PubMed
[16] Liu L, Yan C, Tao S, Wang H. Circ_0058124 aggravates the progression of papillary thyroid carcinoma by activating LMO4 expression via targeting miR-370-3p. Cancer Manag Res. 2020;12:9459–70. 10.2147/CMAR.S271778.Suche in Google Scholar PubMed PubMed Central
[17] Zhang M, Sun W, Wu H, Liu Z, Wang P. Knockdown of microRNA-103a-3p inhibits the malignancy of thyroid cancer cells through Hippo signaling pathway by upregulating LATS1. Neoplasma. 2020;67(6):1266–78. 10.4149/neo_2020_191224N1331.Suche in Google Scholar PubMed
[18] Okamoto A, Yabuta N, Mukai S, Torigata K, Nojima H. Phosphorylation of CHO1 by Lats1/2 regulates the centrosomal activation of LIMK1 during cytokinesis. Cell Cycle (Georgetown, Tex). 2015;14(10):1568–82. 10.1080/15384101.2015.1026489.Suche in Google Scholar PubMed PubMed Central
[19] Nishita M, Tomizawa C, Yamamoto M, Horita Y, Ohashi K, Mizuno K. Spatial and temporal regulation of cofilin activity by LIM kinase and Slingshot is critical for directional cell migration. J Cell Biol. 2005;171(2):349–59. 10.1083/jcb.200504029.Suche in Google Scholar PubMed PubMed Central
[20] Ishaq M, Lin B-R, Bosche M, Zheng X, Yang J, Huang D, et al. LIM kinase 1 - dependent cofilin 1 pathway and actin dynamics mediate nuclear retinoid receptor function in T lymphocytes. BMC Mol Biol. 2011;12:41. 10.1186/1471-2199-12-41.Suche in Google Scholar PubMed PubMed Central
[21] Aggelou H, Chadla P, Nikou S, Karteri S, Maroulis I, Kalofonos HP, et al. LIMK/cofilin pathway and Slingshot are implicated in human colorectal cancer progression and chemoresistance. Virchows Arch. 2018;472(5):727–37. 10.1007/s00428-018-2298-0.Suche in Google Scholar PubMed
[22] Lee M-H, Kundu JK, Chae J-I, Shim J-H. Targeting ROCK/LIMK/cofilin signaling pathway in cancer. Arch Pharmacal Res. 2019;42(6):481–91. 10.1007/s12272-019-01153-w.Suche in Google Scholar PubMed
[23] Maimaiti Y, Jie T, Jing Z, Changwen W, Pan Y, Chen C, et al. Aurora kinase A induces papillary thyroid cancer lymph node metastasis by promoting cofilin-1 activity. Biochem Biophys Res Commun. 2016;473(1):212–8. 10.1016/j.bbrc.2016.03.081.Suche in Google Scholar PubMed
[24] Zhang Y, Li A, Shi J, Fang Y, Gu C, Cai J, et al. Imbalanced LIMK1 and LIMK2 expression leads to human colorectal cancer progression and metastasis via promoting β-catenin nuclear translocation. Cell Death Dis. 2018;9(7):749. 10.1038/s41419-018-0766-8.Suche in Google Scholar PubMed PubMed Central
[25] Yang D, Wang C, Luo Y, Li X, Song Q, Zhang J, et al. Activated E2F activity induces cell death in papillary thyroid carcinoma K1 cells with enhanced Wnt signaling. PLoS One. 2017;12(6):e0178908-e. 10.1371/journal.pone.0178908.Suche in Google Scholar PubMed PubMed Central
© 2022 Zeyi Ling et al., published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Artikel in diesem Heft
- Research Articles
- AMBRA1 attenuates the proliferation of uveal melanoma cells
- A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
- Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
- Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
- Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
- Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
- Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
- The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
- Gene signature to predict prognostic survival of hepatocellular carcinoma
- Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
- Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
- Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
- Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
- Pericentric inversion of chromosome 6 and male fertility problems
- Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
- Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
- Expression of DNM3 is associated with good outcome in colorectal cancer
- Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
- CRRT influences PICCO measurements in febrile critically ill patients
- SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
- lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
- circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
- Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
- GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
- A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
- Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
- Association between preventable risk factors and metabolic syndrome
- miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
- Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
- Quercitrin protects human bronchial epithelial cells from oxidative damage
- Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
- circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
- Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
- Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
- Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
- LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
- Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
- Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
- Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
- Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
- Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
- miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
- Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
- circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
- miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
- hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
- circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
- TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
- Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
- Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
- circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
- Human amniotic fluid as a source of stem cells
- lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
- NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
- Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
- Risk factors for adverse drug reactions associated with clopidogrel therapy
- Serum zinc associated with immunity and inflammatory markers in Covid-19
- The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
- LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
- Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
- Moscatilin suppresses the inflammation from macrophages and T cells
- Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
- Epithelial-mesenchymal transition-related genes in coronary artery disease
- The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
- Repeated partial splenic artery embolization for hypersplenism improves platelet count
- Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
- Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
- miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
- The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
- Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
- Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
- A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
- Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
- MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
- miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
- Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
- circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
- Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
- Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
- Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
- Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
- Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
- β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
- Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
- In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
- Potential biomarkers for inflammatory response in acute lung injury
- A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
- Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
- ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
- Risk prediction of cardiovascular disease using machine learning classifiers
- Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
- Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
- Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
- Protective effects of glaucocalyxin A on the airway of asthmatic mice
- Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
- Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
- Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
- Identification of osteoporosis based on gene biomarkers using support vector machine
- Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
- miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
- Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
- LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
- The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
- Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
- Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
- lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
- Protective effect of ghrelin on intestinal I/R injury in rats
- In vivo knee kinematics of an innovative prosthesis design
- Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
- lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
- Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
- LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
- Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
- SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
- Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
- Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
- Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
- Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
- Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
- Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
- TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
- Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
- NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
- The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
- miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
- Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
- lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
- Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
- lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
- circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
- LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
- Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
- lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
- SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
- Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
- Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
- Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
- Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
- Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
- Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
- Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
- The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
- Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
- HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
- Meta-analysis of early-life antibiotic use and allergic rhinitis
- Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
- HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
- Amino acid profiles in the tissue and serum of patients with liver cancer
- Pain in critically ill COVID-19 patients: An Italian retrospective study
- Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
- Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
- Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
- The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
- Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
- SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
- The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
- TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
- Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
- Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
- The incidence of bronchiectasis in chronic obstructive pulmonary disease
- Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
- Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
- Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
- lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
- Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
- lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
- DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
- Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
- MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
- Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
- circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
- EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
- Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
- miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
- Review Articles
- Current management of cancer pain in Italy: Expert opinion paper
- Hearing loss and brain disorders: A review of multiple pathologies
- The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
- Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
- Interleukin-35 in autoimmune dermatoses: Current concepts
- Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
- Advantages of ketamine in pediatric anesthesia
- Congenital adrenal hyperplasia. Role of dentist in early diagnosis
- Migraine management: Non-pharmacological points for patients and health care professionals
- Atherogenic index of plasma and coronary artery disease: A systematic review
- Physiological and modulatory role of thioredoxins in the cellular function
- Case Reports
- Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
- A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
- Unusual neurological manifestations of bilateral medial medullary infarction: A case report
- Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
- A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
- A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
- Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
- Fungal infection mimicking COVID-19 infection – A case report
- Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
- Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
- Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
- Trismus during tracheal extubation as a complication of general anaesthesia – A case report
- Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
- Two case reports of skin vasculitis following the COVID-19 immunization
- Ureteroiliac fistula after oncological surgery: Case report and review of the literature
- Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
- Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
- Commentary
- Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
- Rapid Communication
- COVID-19 fear, post-traumatic stress, growth, and the role of resilience
- Erratum
- Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
- Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
- Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
- Retraction
- Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
- Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
- Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Artikel in diesem Heft
- Research Articles
- AMBRA1 attenuates the proliferation of uveal melanoma cells
- A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
- Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
- Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
- Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
- Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
- Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
- The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
- Gene signature to predict prognostic survival of hepatocellular carcinoma
- Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
- Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
- Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
- Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
- Pericentric inversion of chromosome 6 and male fertility problems
- Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
- Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
- Expression of DNM3 is associated with good outcome in colorectal cancer
- Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
- CRRT influences PICCO measurements in febrile critically ill patients
- SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
- lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
- circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
- Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
- GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
- A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
- Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
- Association between preventable risk factors and metabolic syndrome
- miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
- Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
- Quercitrin protects human bronchial epithelial cells from oxidative damage
- Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
- circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
- Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
- Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
- Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
- LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
- Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
- Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
- Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
- Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
- Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
- miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
- Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
- circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
- miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
- hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
- circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
- TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
- Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
- Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
- circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
- Human amniotic fluid as a source of stem cells
- lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
- NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
- Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
- Risk factors for adverse drug reactions associated with clopidogrel therapy
- Serum zinc associated with immunity and inflammatory markers in Covid-19
- The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
- LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
- Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
- Moscatilin suppresses the inflammation from macrophages and T cells
- Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
- Epithelial-mesenchymal transition-related genes in coronary artery disease
- The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
- Repeated partial splenic artery embolization for hypersplenism improves platelet count
- Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
- Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
- miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
- The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
- Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
- Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
- A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
- Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
- MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
- miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
- Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
- circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
- Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
- Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
- Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
- Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
- Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
- β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
- Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
- In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
- Potential biomarkers for inflammatory response in acute lung injury
- A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
- Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
- ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
- Risk prediction of cardiovascular disease using machine learning classifiers
- Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
- Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
- Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
- Protective effects of glaucocalyxin A on the airway of asthmatic mice
- Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
- Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
- Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
- Identification of osteoporosis based on gene biomarkers using support vector machine
- Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
- miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
- Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
- LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
- The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
- Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
- Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
- lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
- Protective effect of ghrelin on intestinal I/R injury in rats
- In vivo knee kinematics of an innovative prosthesis design
- Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
- lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
- Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
- LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
- Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
- SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
- Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
- Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
- Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
- Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
- Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
- Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
- TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
- Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
- NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
- The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
- miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
- Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
- lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
- Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
- lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
- circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
- LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
- Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
- lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
- SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
- Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
- Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
- Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
- Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
- Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
- Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
- Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
- The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
- Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
- HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
- Meta-analysis of early-life antibiotic use and allergic rhinitis
- Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
- HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
- Amino acid profiles in the tissue and serum of patients with liver cancer
- Pain in critically ill COVID-19 patients: An Italian retrospective study
- Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
- Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
- Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
- The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
- Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
- SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
- The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
- TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
- Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
- Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
- The incidence of bronchiectasis in chronic obstructive pulmonary disease
- Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
- Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
- Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
- lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
- Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
- lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
- DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
- Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
- MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
- Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
- circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
- EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
- Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
- miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
- Review Articles
- Current management of cancer pain in Italy: Expert opinion paper
- Hearing loss and brain disorders: A review of multiple pathologies
- The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
- Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
- Interleukin-35 in autoimmune dermatoses: Current concepts
- Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
- Advantages of ketamine in pediatric anesthesia
- Congenital adrenal hyperplasia. Role of dentist in early diagnosis
- Migraine management: Non-pharmacological points for patients and health care professionals
- Atherogenic index of plasma and coronary artery disease: A systematic review
- Physiological and modulatory role of thioredoxins in the cellular function
- Case Reports
- Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
- A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
- Unusual neurological manifestations of bilateral medial medullary infarction: A case report
- Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
- A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
- A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
- Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
- Fungal infection mimicking COVID-19 infection – A case report
- Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
- Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
- Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
- Trismus during tracheal extubation as a complication of general anaesthesia – A case report
- Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
- Two case reports of skin vasculitis following the COVID-19 immunization
- Ureteroiliac fistula after oncological surgery: Case report and review of the literature
- Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
- Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
- Commentary
- Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
- Rapid Communication
- COVID-19 fear, post-traumatic stress, growth, and the role of resilience
- Erratum
- Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
- Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
- Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
- Retraction
- Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
- Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
- Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy