Home Studies on the extraction performance of phorate by aptamer-functionalized magnetic nanoparticles in plasma samples
Article Open Access

Studies on the extraction performance of phorate by aptamer-functionalized magnetic nanoparticles in plasma samples

  • Ting Wang , Junpeng Tan , Shenghui Xu , Yong Li and Hongxia Hao EMAIL logo
Published/Copyright: November 1, 2023
Download Article (PDF)
Become an author with De Gruyter Brill
Submit Manuscript Author Information
Green Processing and Synthesis
From the journal Green Processing and Synthesis Volume 12 Issue 1

Abstract

Phorate, a highly toxic organophosphorus pesticide, poses significant risks due to its efficiency, versatility, and affordability. Therefore, studying pretreatment and detection methods for phorate in complex samples is crucial. In this study, we synthesized core-shell phorate aptamer-functionalized magnetic nanoparticles using solvothermal and self-assembly techniques. Subsequently, we developed a magnetic dispersive solid-phase extraction and detection method to identifying phorate in plasma samples. Under optimal conditions, we achieved quantitation of phorate within a range of 2–700 ng·mL−1 using gas chromatography-mass spectrometry. The detection limit (S/N = 3) was 0.46 ng·mL−1, and the intraday and interday relative standard deviation were 3.4% and 4.1%, respectively. In addition, the material exhibited excellent specificity, an enrichment capacity (EF = 416), and reusability (≥15). During phorate extraction from real plasma samples, spiked recoveries ranged from 86.1% to 101.7%. These results demonstrate that our method offers superior extraction efficiency and detection capability for phorate in plasma samples.

Keywords: phorate; magnetic nanoparticle; aptamer; magnetic solid phase extraction

1 Introduction

Phorate, scientifically known as O,O-diethyl-S-(ethylthiomethyl) dithiophosphate, possesses the ability to inhibit acetylcholinesterase activity in organisms, leading to neurological dysfunction [1]. This highly toxic organophosphorus pesticide (OPP) is unfortunately often misused in crop cultivation due to its efficiency, versatility, long-lasting effects, and cost-effectiveness. Consequently, it has resulted in numerous cases of poisoning among humans and animals [2]. Furthermore, incidents of suicide and homicide involving phorate have become significant societal concerns [3–5]. Thus, it is imperative to qualitatively and quantitatively determine the presence of phorate in biological samples to study and assess poisoning cases and provide appropriate follow-up treatment to affected individuals.

In recent years, researchers have placed significant focus on investigating extraction and determination methods for phorate in complex biological samples, with particular emphasis on the extraction methodology [6–9]. Magnetic solid-phase extraction (MSPE) represents a promising approach in dispersive solid-phase extraction that utilizes magnetic nanoparticles (MNPs) as adsorbent substrates [10]. This method facilitates rapid analyte separation between the sorbent and substrate via an external magnetic field, effectively eliminating the shortcomings associated with traditional sample pretreatment techniques, such as the extensive use of organic solvents, specialized equipment, and labor-intensive, time-consuming processing [11,12,13]. Moreover, it streamlines the process by eliminating the need for additional centrifugation or filtration. MSPE adsorbents are environmentally friendly, offer a substantial specific surface area, exhibit excellent compatibility, and are reusable. Owing to their outstanding adsorption and extraction performance, as well as their ease of surface modification to enhance versatility and selectivity, MSPE has emerged as a popular approach for investigating phorate and other OPPs [14–17].

MSPE adsorbents can modify their chemical properties through surface enhancements using functional materials, thereby increasing stability and introducing new functional groups to enhance target adsorption capacity [18–22]. Researchers have employed functionalized MNPs as adsorbents for phorate extraction from samples. For example, Tang et al. [23] synthesized γ-Fe2O3/chitosan magnetic microspheres for extracting 10 OPP residues, including phorate, from fruits. Mahpishanian and Sereshti [24] utilized graphene (G) to craft 3D nanoporous 3D-G-Fe3O4 aerogels to extract phorate from fruit juice. Li et al. [25] used metal-organic framework materials to prepare magnetic nanoporous carbon materials, enabling the extraction of OPPs through π–π and hydrophobic interactions. These methodologies showed commendable extraction performance and yielded acceptable recoveries. Nevertheless, they exhibited limited specificity, compromised enrichment factors (EFs), and primarily underwent testing with uncomplicated sample matrices. Consequently, the exploration of new functionalized magnetic adsorbents is warranted to address these shortcomings.

Aptamers (Apt), comprising single-stranded oligonucleotide chains with specific sequences selected through the systematic evolution of ligands via exponential enrichment [26], present a distinctive opportunity. They can specifically bind to target substances [27], offering attributes such as high affinity, robust specificity, minimal molecular weight, in vitro selectivity, nonimmunogenicity, ease of modification, and excellent biocompatibility [28,29,30]. Apt, in comparison to antibodies, possesses a wider range of applications in biology [31], medicine [32], safety [33], environment [34], and other domains. Recent advances in aptamer technology have led to the selection or design of aptamer nucleic acid sequences with increased affinity and specificity for phorate. This has expanded the realm of possibilities for phorate extraction and detection methods. Wang et al. [35], for instance, employed ssDNA Apt for four OPPs, including phorate, and developed a method based on molecular beacon probes with a dissociation constant of 1.11 µmol·L−1 for phorate. Zhang et al. [36] optimized the aptamer sequence specific to phorate and established a fluorescence detection method grounded on the competition between the molecular beacon and the aptamer for quantitative phorate detection. Researchers have also integrated Apt with various techniques such as surface-enhanced Raman scattering [37], colorimetry [38,39], capillary electrophoresis [40], sensor methods [41], and fluorescence assays [42,43] to detect phorate, achieving remarkable performance.

In this work, we prepared a novel type of aptamer-functionalized MNPs specific to phorate. By using the superparamagnetic properties and biocompatibility of MNPs, as well as the strong specificity and adsorption ability of the aptamer for phorate, we developed an MSPE method for enriching and extracting phorate from plasma samples, followed by GC-MS analysis. We characterized the prepared magnetic materials through various methods and optimized extraction and elution conditions. In addition, we evaluated the extraction performance of phorate in plasma samples.

2 Experiments

2.1 Chemicals and reagents

We procured four methanol-soluble standard solutions, including phorate, parathion, chlorpyrifos, and methyl parathion, from the Chinese Academy of Metrology, each possessing a concentration of 1 mg·mL−1. The aptamer sequence employed was 5′- AAGCTTTTATATATGCGCAGCGATTTTGATCGAAAGGCTGAGAGCTACGC-3′, featuring NH2 modification at its 5′ terminus, and it was synthesized by Bioengineering Shanghai Co., Ltd. Other chemicals and reagents, such as FeCl3·6H2O, ethylene glycol, sodium acetate, tetraethoxysilane (TEOS), 3-aminopropyltriethoxysilane (APTES), succinic anhydride, and 2-(N-morpholino)ethanesulfonic acid (MES), were procured from Shanghai Aladdin Biochemical Technology Co., Ltd. In addition, ammonia, toluene, and N,N-dimethylformamide (DMF) were sourced from Tianjin Oubokai Chemical Co., Ltd. 1-Ethyl-(3-dimethylaminopropyl)carbodiimide (EDC), N-hydroxysuccinimide (NHS), tris(hydroxymethyl)aminomethane (Tris), and bovine serum albumin (BSA) were obtained from Bioengineering Shanghai Co., Ltd. Solvents employed, such as methanol, acetonitrile, ethanol, acetone, ethyl acetate, and dichloromethane, were acquired from Honeywell Trading Shanghai Co., Ltd. Purified water, characterized by a resistance of 18.2 MΩ, was generated in-house employing a Millipore pure water system.

2.2 Instrumentations

The morphology and dimensions of MNPs were ascertained through scanning electron microscopy (SEM) (Zeiss Merlin Compact) and transmission electron microscopy (TEM) (Jeol JEM 2100). Infrared spectra were acquired utilizing a Fourier-transform infrared spectrometer (FTIR) (Thermo Scientific Nicolet iS20). The ξ potential was determined through dynamic light scattering (DLS) (Malvern Zetasizer Nano ZS90). The hysteresis curve of MNPs was measured via a vibrating sample magnetometer (VSM) (LakeShore 7404). Additional instruments employed included a pH meter (METTLER TOLEDO FE20), a constant temperature culture oscillator (ZHICHENG ZWY-200D), and a confocal laser scanning microscope (CLSM) (Olympus FV1200).

For analytical purposes, gas chromatography-mass spectrometry (GCMS-QP2020 NX, SHIMADZU) was utilized and coupled with a chromatographic column (SH-Rxi-5Sil MS; 30 m × 0.25 mm; 0.25 µm). The chromatographic conditions featured helium as the carrier gas, a split injection method (10:1), and a column flow rate of 1 mL·min−1. The temperature program for the chromatographic column included an initial temperature of 100°C for 2 min, followed by a ramp to 280°C at a rate of 20°C·min−1, and succeeded by an 8 min hold at 280°C. The sample inlet and transmission line temperatures were set at 280°C and 260°C, respectively. Electron bombardment ionization (EI) was employed, with an EI energy of 70 eV and an ion source temperature of 250°C. Selective ion scanning mode was employed to detect characteristic fragment ions of phorate, including 75, 121, and 231.

2.3 Preparation of aptamer-functionalized MNPs

We synthesized core-shell aptamer-functionalized MNPs specific to phorate through a sequential process involving the solvothermal method and the self-assembly method, as delineated in Figure 1.

Figure 1 Schematic preparation of the aptamer-functionalized MNPs.
Figure 1

Schematic preparation of the aptamer-functionalized MNPs.

Synthesis of Fe3O4 MNPs via the solvothermal method [44]: Initially, 5.4 g of FeCl3·6H2O was entirely dissolved in 80 mL of ethylene glycol. Subsequently, 7.2 g of sodium acetate was added with continuous stirring until homogeneity was achieved. This mixture was subsequently placed into the reactor and subjected to a 10 h reaction at 200°C, followed by natural cooling to room temperature. The resulting product was magnetically separated, purified, and subjected to vacuum drying to obtain Fe3O4·MNPs.

Synthesis of Fe3O4@SiO2 MNPs [45]: In the first step, 1 g of Fe3O4 MNPs was introduced into a mixture comprising 150 mL of anhydrous ethanol and 50 mL of water, followed by stirring to attain a uniform mixture. Next, 5 mL of ammonia was added, and after 15 min of reaction time, 50 mL of TEOS ethanol solution (1:50) was added dropwise with continuous stirring for 8 h. The resulting product was then magnetically separated, washed, and activated using 1 mol·L−1 hydrochloric acid. Subsequently, it was rinsed and vacuum dried to yield Fe3O4@SiO2 MNPs.

Amination and carboxylation of Fe3O4@SiO2 MNPs: Initially, 0.5 g of Fe3O4@SiO2 MNPs was thoroughly mixed with 5 mL of APTES and 45 mL of toluene. The reaction was conducted at 60°C for 10 h with stirring under a nitrogen atmosphere. Following the reaction, the product was magnetically separated, rinsed with ethanol, and subjected to vacuum drying to yield Fe3O4@SiO2-NH2 MNPs. Subsequently, an additional 0.2 g of Fe3O4@SiO2-NH2 MNPs and 8 g of succinic anhydride were combined with 150 mL of anhydrous DMF, followed by ultrasonic dispersion and continuous stirring. The reaction was stirred at 60°C for 12 h under a nitrogen atmosphere. After the reaction, the product was magnetically separated, washed with DMF and water, and subjected to vacuum drying to obtain Fe3O4@SiO2-COOH MNPs.

Synthesis of aptamer-functionalized MNPs (Fe3O4@SiO2-Apt): Initially, 1 mg of Fe3O4@SiO2-COOH MNPs was dispersed in a MES buffer solution (0.025 mol·L−1, pH 5.5). The carboxyl group was activated using freshly prepared EDC and NHS (50 μL each at 50 mg·mL−1). The activated MNPs were then magnetically separated, rinsed, and subjected to the addition of 0.5 nmol Apt-NH2. This mixture was incubated with slow oscillation at 37°C for 6 h. The unreacted active carboxylic acid components were removed using Tris-HCl buffer (0.05 mol·L−1, pH 8.0). After further washing, 1% BSA was introduced to minimize nonspecific adsorption sites on the MNPs’ surface. Finally, the Fe3O4@SiO2-Apt MNPs were obtained through repeated washing.

2.4 Adsorption experiments

The binding capacity of Fe3O4@SiO2-Apt MNPs to the target was investigated through multiple adsorption experiments.

Adsorption kinetics study: 50 mg of Fe3O4@SiO2-Apt MNPs were introduced into a 5 mL sample solution with a concentration of 200 ng·mL−1 (pH = 7.0). Following dispersion and thorough mixing, the sample solution was placed into a thermostatic oscillator and incubated at 25°C with a rotating rate of 200 rpm for varying durations (2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 min). After the completion of adsorption, the adsorbent was separated magnetically by an external strong magnet, and the supernatant was collected.

Adsorption isotherm measurement: 50 mg of Fe3O4@SiO2-Apt MNPs were added to 5 mL sample solutions with different concentrations (50–1,200 ng·mL−1) for dispersion. Following dispersion and thorough mixing, the sample solution was placed into a thermostatic oscillator and incubated at 25°C with a rotating rate of 200 rpm for 10 min. Subsequent to adsorption completion, the adsorbent was separated magnetically by an external strong magnet, and the supernatant was collected.

2.5 Preparation of the standard solution and the sample solution

A 1 mg·mL−1 phorate standard solution in methanol was employed for this study. Standard solutions were prepared through stepwise dilution with methanol and stored at 4°C with a 1-month shelf life. Blank human plasma samples were obtained from the Zhangjiakou Blood Center. For the experiments, plasma samples were diluted with ultrapure water at a 1:4 ratio, and the pH was adjusted to 8.0 by the addition of an appropriate quantity of 0.1 mol·L−1 NaOH. After vortexing for 5 min, followed by centrifugation at 8,000 rpm for 5 min, the supernatant was collected as the experimental sample for subsequent extraction.

2.6 Magnetic dispersive solid-phase extraction process

Figure 2 depicts the extraction process of phorate from plasma samples utilizing Fe3O4@SiO2-Apt MNPs. A 5 mL plasma sample containing phorate was acquired, and the sample’s pH was adjusted to 7.0. To attain a salt concentration of 4% (w/v), NaCl was introduced. Subsequently, 50 mg of Fe3O4@SiO2-Apt MNPs were added to the sample and thoroughly mixed. The mixture was subsequently incubated at 25°C with continuous agitation at 200 rpm for 10 min in a constant temperature culture oscillator. During this incubation, phorate bound to the aptamer and adsorbed onto the MNPs. Following the incubation, MNPs were concentrated at the bottom of the container, employing an external magnetic field. The supernatant was meticulously removed, and the MNPs underwent multiple washes to eliminate nonspecific adsorbents. Next, 1.2 mL of the ethyl acetate eluate was introduced to the MNPs. Following vortexing and oscillation for 5 min, the phorate bound to the MNPs was successfully eluted. The eluate was carefully collected, slowly dried under a nitrogen stream, and subsequently re-dissolved in 200 μL of methanol for further phorate detection via GC-MS.

Figure 2 Schematic extraction procedure of phorate by Fe3O4@SiO2-Apt MNPs.
Figure 2

Schematic extraction procedure of phorate by Fe3O4@SiO2-Apt MNPs.

3 Results and discussion

3.1 Structure and adsorption mechanism of material

The nanosized Fe3O4 grains were synthesized using the solvothermal method and served as the core for the core-shell material. Subsequently, the SiO2 sol was continuously generated through the hydrolysis condensation effect of TEOS. In this process, the surface of Fe3O4 became positively charged, while SiO2 acquired a negative charge, enabling SiO2 to directly adhere to the surface of Fe3O4 particles. After further growth, the Fe3O4@SiO2 composite material was formed. At this juncture, the material’s surface was enriched with hydroxyl groups, facilitating further modification and enhancing stability, hydrophilicity, and biocompatibility. Following amination and carboxylation reactions, a substantial number of carboxyl groups were attached to the material’s surface. Subsequently, the EDC/NHS coupling reagent was added to connect the amine-modified aptamer to the material’s surface, ultimately yielding Fe3O4@SiO2-Apt. This material, which can capture phorate through its aptamer, underwent denaturation and annealing at 90°C to induce the randomly coiled aptamer to form a stem-ring secondary structure. This structure includes specific binding sites, enabling the aptamer to bind to phorate molecules in a highly specific and affinity-driven manner through potential molecular shape complementarity, van der Waals forces, and hydrogen bonding, thereby achieving phorate adsorption by the material.

3.2 Characterization of aptamer-functionalized MNPs

The morphology, particle size, and dispersion of Fe3O4 MNPs were analyzed using SEM, and the characterization results are presented in Figure 3(a). Fe3O4 MNPs exhibited a spherical shape with a particle size of approximately 300 nm. The particle size distribution was relatively uniform, and the dispersion was excellent. Furthermore, a comparison of the characterization between single particles of Fe3O4 MNPs and Fe3O4@SiO2 MNPs using TEM is displayed in Figure 3(b) and (c). In this comparison, it is evident that Fe3O4@SiO2 MNPs were uniformly coated with a SiO2 layer, approximately 20 nm thick, forming a core-shell structure. This SiO2 coating effectively reduced their surface energy and enhanced their stability. In addition, the hydrophilic hydroxyl groups added to the MNPs’ surface improved their hydrophilicity, enabling better dispersion in aqueous solutions [46].

Figure 3 (a) SEM image of Fe3O4 MNPs, (b) TEM image of Fe3O4 MNPs, and (c) TEM image of Fe3O4@SiO2 MNPs.
Figure 3

(a) SEM image of Fe3O4 MNPs, (b) TEM image of Fe3O4 MNPs, and (c) TEM image of Fe3O4@SiO2 MNPs.

Subsequently, FTIR spectroscopy was employed to characterize the functional groups present on the surfaces of Fe3O4 MNPs, Fe3O4@SiO2 MNPs, Fe3O4@SiO2-NH2 MNPs, and Fe3O4@SiO2-COOH MNPs, and the obtained results are presented in Figure 4. Notably, a distinctive stretching vibration peak corresponding to the Fe–O bond was observed at 580 cm–1 in the MNPs. Peaks at 1,085, 796, and 462 cm–1 were associated with the Si–O–Si antisymmetric stretching vibration and symmetric vibration. A stretching vibration peak characteristic of Si–OH appeared at 944 cm–1, indicating the presence of a SiO2 coating on the outer surface of the MNPs. On the surface of Fe3O4@SiO2-NH2 MNPs, peaks at 1,024, 1,577, and 640 cm–1 were indicative of the C–N stretching vibration, in-plane N–H bending vibration, and out-of-plane N–H bending vibration, respectively. These three peaks indicated the successful completion of amine modification on the MNPs. For Fe3O4@SiO2-COOH MNPs, the characteristic C═O absorption peak at 1,584 cm–1 was significantly enhanced. In addition, peaks at 1,380 and 1,400 cm–1 corresponded to the C–O symmetric vibration and O–H in-plane bending vibration in carboxylic acid, respectively, indicating the successful modification of carboxyl groups on the MNPs’ surface. Furthermore, we utilized DLS to measure the ξ potential of Fe3O4@SiO2 MNPs, Fe3O4@SiO2-NH2 MNPs, and Fe3O4@SiO2-COOH MNPs, revealing ξ potentials of approximately –26.79 ± 1.31, –18.05 ± 1.77, and 29.72 ± 0.93 mV, respectively. These results further substantiated the successful sequential modification of amino and carboxyl groups on the surface of the MNPs.

Figure 4 FTIR spectra of (a) Fe3O4, (b) Fe3O4@SiO2, (c) Fe3O4@SiO2-NH2, and (d) Fe3O4@SiO2-COOH MNPs.
Figure 4

FTIR spectra of (a) Fe3O4, (b) Fe3O4@SiO2, (c) Fe3O4@SiO2-NH2, and (d) Fe3O4@SiO2-COOH MNPs.

Additional surface information was derived from the X-ray photoelectron spectroscopy (XPS) analysis, and the variations in surface atomic content of the MNPs were quantified based on the measured XPS transitions (Table 1). This analysis demonstrated the sequential modification of functional groups on the MNPs. The wide scan XPS spectra (Figure 5(a)) exhibited peaks at 102.9, 154.4, 284.62, 399.61, 532.26, and 710.56 eV, corresponding to Si 2p, Si 2s, C 1s, N 1s, O 1s, and Fe 2p, respectively. In the Si 2p spectrum (Figure 5(e)), the presence of the Si–O bond at 102.9 eV in Fe3O4@SiO2-COOH MNPs was evident. Figure 5(b) displays characteristic peaks at 710.5 and 724.3 eV for Fe 2p3/2 and Fe 2p1/2, respectively, indicating the coexistence of multiple oxidation states of Fe in the Fe3O4. Carbon bonds were deconvoluted into C–C (284.3 eV), C–O (285.2 eV), and C═O (288.1 eV) (Figure 5(c)), while oxygen bonds were deconvoluted into C═O (529.9 eV) and C–OH (532.3 eV) (Figure 5(d)). These results further confirmed the successful attachment of carboxyl groups to the surface of Fe3O4 MNPs. The modification with carboxyl groups provided stable binding sites for the amino-modified Apt through a condensation reaction between carboxyl and amino groups. In addition, the surface-modified carboxyl groups (hydrophilic groups) enhanced the hydrophilicity and dispersibility of the MNPs.

Table 1

Comparison of element content on the surface of MNPs resulting from the XPS spectra

Compound Atomic %
C 1s O 1s Si 2p N 1s Fe 2p
Fe3O4 MNPs 25.56 45.82 2.11 0.42 26.09
Fe3O4@SiO2 MNPs 32.5 44.75 19.66 0.44 2.65
Fe3O4@SiO2 and the variations in surface NH2 MNPs 38.35 34.65 17.99 7.87 1.14
Fe3O4@SiO2 and the variations in surface COOH MNPs 24.52 52.81 16.95 2.55 3.17
Figure 5 (a) Survey XPS spectra of Fe3O4@SiO2-COOH MNPs; deconvoluted high-resolution XPS spectra of (b) Fe 2p, (c) C 1s, (d) O 1s, and (e) Si 2p of Fe3O4@SiO2-COOH MNPs.
Figure 5

(a) Survey XPS spectra of Fe3O4@SiO2-COOH MNPs; deconvoluted high-resolution XPS spectra of (b) Fe 2p, (c) C 1s, (d) O 1s, and (e) Si 2p of Fe3O4@SiO2-COOH MNPs.

To confirm the successful modification of the aptamer on the MNPs’ surface, the 3′ end of the aptamer was labeled with a fluorescent dye (6-carboxyfluorescein, 6-FAM), and Fe3O4@SiO2-Apt (6-FAM) MNPs were characterized using CLSM. The results shown in Figure 6 showed green fluorescence in the dark field of the CLSM when excited at 488 nm. The green fluorescence corresponded to the position of the MNPs in both the bright field and the combined field of views, confirming that the green fluorescence emanated from the surface of the MNPs. This affirmed the successful modification of the aptamer specific to phorate on the MNPs’ surface.

Figure 6 CLSM images of Fe3O4@SiO2-Apt (6-FAM) MNPs in (a) dark field, (b) bright field, and (c) merge channels.
Figure 6

CLSM images of Fe3O4@SiO2-Apt (6-FAM) MNPs in (a) dark field, (b) bright field, and (c) merge channels.

To evaluate the saturation magnetization of the sorbent, VSM was employed. The magnetization saturation values (Ms) for Fe3O4 MNPs, Fe3O4@SiO2 MNPs, and Fe3O4@SiO2-Apt MNPs were determined to be 83.63, 72.41, and 63.86 emu·g–1, respectively (Figure 7). The reduction in Ms value for Fe3O4@SiO2-Apt MNPs, compared to Fe3O4 MNPs, could be attributed to the presence of nonmagnetic materials such as SiO2, APTES, and the aptamer on the MNPs’ surface. Nevertheless, Fe3O4@SiO2-Apt MNPs still exhibited superparamagnetism and maintained sufficient magnetic response strength for effective magnetic separation, facilitating the reuse of the sorbent.

Figure 7 Magnetization curves of (a) Fe3O4 MNPs, (b) Fe3O4@SiO2 MNPs, and (c) Fe3O4@SiO2-Apt MNPs.
Figure 7

Magnetization curves of (a) Fe3O4 MNPs, (b) Fe3O4@SiO2 MNPs, and (c) Fe3O4@SiO2-Apt MNPs.

3.3 Optimization of the extraction conditions

To enhance the extraction of phorate from the sample using Fe3O4@SiO2-Apt MNPs, we conducted optimization of various extraction conditions employing a single-factor approach. These conditions included the binding mode, extraction time, solution pH, ionic strength, and the amount of sorbent. A sample solution with a phorate concentration of 200 ng·mL−1 was employed as the target for this research.

3.3.1 Binding mode

We explored various binding methods to enhance the phorate-capturing process by Fe3O4@SiO2-Apt MNPs, which could impact the extraction efficiency. Three methods were investigated: ultrasonication, vortexing, and incubation. The results showed that the incubation method produced higher recovery rates under the same conditions. This was because gentle oscillation promoted the dispersion of MNPs, facilitating the binding of the target to the adsorption site. In contrast, high-frequency oscillation generated by ultrasonication and vortexing had the potential to somewhat damage the surface modifiers of MNPs, affecting the integrity of the aptamer. In addition, we examined the effects of incubation temperature and rotation speed, with the highest recovery rate (90%) observed at a temperature of 25°C and a rotation speed of 200 rpm.

3.3.2 Extraction time

The MSPE method relied on achieving adsorption equilibrium between Fe3O4@SiO2-Apt MNPs and phorate. Extending the extraction time was beneficial for ensuring full contact between the aptamer and the target, thus ensuring high extraction efficiency. We studied the binding rate of phorate captured by Fe3O4@SiO2-Apt MNPs within the 2–20 min range. As shown in Figure 8(b), as the extraction time increased, the recovery rate displayed an upward trend and essentially stabilized at 10 min, indicating that adsorption had reached equilibrium. In the early stage of the adsorption process, a large number of active sites were provided by the stem-ring structure of Apt on the material’s surface, resulting in a rapid adsorption rate and a significant increase in adsorption in a short time. As the adsorption process continued, the target molecules on the material’s surface increased, enhancing intermolecular repulsive forces and leading to occupied adsorption sites, thus slowing down the adsorption rate until it stabilized. Therefore, we selected 10 min as the optimal extraction time.

Figure 8 Effects of extraction conditions on the recovery rate for phorate: (a) rotation speed, (b) extraction time, (c) pH of solution, (d) NaCl concentration, and (e) the amount of sorbent.
Figure 8

Effects of extraction conditions on the recovery rate for phorate: (a) rotation speed, (b) extraction time, (c) pH of solution, (d) NaCl concentration, and (e) the amount of sorbent.

3.3.3 pH of the solution

The pH values of the solution affected the surface charge of the sorbent and the folding configuration of the aptamer, consequently influencing the extraction efficiency of phorate by the sorbent. In addition, phorate was susceptible to hydrolysis in strongly acidic or alkaline environments, making extraction unfeasible. Considering these factors, we experimentally studied extraction efficiency within the pH range of 5–8, adjusting the pH using 0.1 mol·L−1 HCl or NaOH solution. The recovery rates at different pH values are presented in Figure 8(c). The results indicated that extraction under neutral conditions was superior to extraction under acidic and alkaline conditions. The reason is that the isoelectric point of the nucleic acid aptamer is less than 7, and under neutral conditions, it is negatively charged, resulting in a certain electrostatic repulsion and the ability to maintain the stem-ring structure stably, providing active sites for better binding with phorate. Therefore, we selected pH 7.0 as the optimal experimental condition.

3.3.4 Ionic strength

A certain concentration of Na+ in the solution enhanced the stability of the aptamer’s structure. Furthermore, an increase in ionic strength reduced the solubility of the target substance, thereby improving extraction efficiency. We investigated extraction efficiency within the concentration range of 0–10% (w/v) by adding NaCl to the reaction solution. The results are illustrated in Figure 8(d). With the increasing NaCl concentration, there was a corresponding increase in the recovery rate. At a 4% (w/v) concentration, the recovery rate reached 94%. Moreover, a further increase in NaCl concentration resulted in a decreased recovery rate due to increased solution viscosity, which in turn led to reduced molecular mass transfer rates, thereby impeding the binding between the phorate and the aptamer. Considering the influence of Na+ on the electronegativity of the aptamer, an excess of Na+ ions would neutralize the negative charge on the aptamer molecule and weaken the electrostatic repulsion between Apt, potentially facilitating polymerization, which could affect stability. Consequently, we opted for 4% (w/v) NaCl as the optimal ionic strength for subsequent experiments.

3.3.5 Amount of sorbent

The quantity of sorbent directly exerts influence upon the number of available aptamer binding sites, a pivotal factor in enhancing extraction efficiency. We explored sorbent quantities ranging from 10 to 80 mg. As illustrated in Figure 8(e), the recovery rate reached its zenith and remained relatively stable when the sorbent amount reached 50 mg. Therefore, we opted for 50 mg as the optimal sorbent quantity for subsequent experiments.

3.4 Optimization of elution conditions

During the experiment, altering the water-organic environment could reversibly change the three-dimensional oligonucleotide structure of the aptamer on the sorbent’s surface. This modification affected the interaction between the aptamer and phorate, enabling phorate elution. To enhance target elution, we optimized pertinent elution conditions, including the choice of elution solvent, elution solvent volume, and elution time.

3.4.1 Selection of elution solvent

We scrutinized the elution characteristics of six solvents with varying polarities: acetonitrile, methanol, ethanol, acetone, ethyl acetate, and dichloromethane. As portrayed in Figure 9(a), ethyl acetate and dichloromethane exhibited superior elution efficiency. This outcome aligns with the relatively low polarity of phorate. Following the principle of like-dissolves-like, phorate exhibited greater solubility in ethyl acetate and dichloromethane due to their lower polarity. Taking into consideration the toxicity, volatility, and reusability of these two solvents, we chose ethyl acetate as the elution solvent for subsequent experiments.

Figure 9 Effects of elution conditions on the recovery rate for phorate: (a) elution solvents, (b) volume of the elution solvent, and (c) elution time.
Figure 9

Effects of elution conditions on the recovery rate for phorate: (a) elution solvents, (b) volume of the elution solvent, and (c) elution time.

3.4.2 Volume of the elution solvent

Sufficient elution solvent ensures the extraction of more target substances, enhancing extraction efficiency. Simultaneously, selecting the smallest elution solvent volume enhances the method’s EF. The recovery rate of phorate was assessed using ethyl acetate as the elution solvent within the range of 0.2–2 mL, and the results are depicted in Figure 9(b). With an increase in elution solvent volume, the recovery rate gradually rose. When the volume reached 1.2 mL, the rate of increase in recovery became less pronounced. Thus, considering the minimum solvent volume feasible, we ultimately selected 1.2 mL as the elution solvent volume.

3.4.3 Elution time

We experimentally probed the impact of elution time on extraction efficiency. The experimental outcomes are illustrated in Figure 9(c). As elution time increased, the recovery rate gradually reached equilibrium after 5 min. Extending the elution time to 10 min did not lead to a noticeable change in the recovery rate. In light of these results, 5 min was chosen as the optimal elution time.

3.5 Adsorption isotherms and kinetic experiments

To investigate the adsorption process of Fe3O4@SiO2-Apt MNPs on phorate, we employed a pseudo-first-order kinetic model and a pseudo-second-order kinetic model to analyze the experimental data, as expressed in equations:

(1) ln ( Q e − Q t ) = ln Q e − k 1 · t

(2) t Q t = 1 k 2 · Q e 2 + t Q e

where t represents the adsorption time, and Q e and Q t are the adsorption amounts of phorate at equilibrium and any time, respectively. k 1 and k 2 denote the equilibrium rate constant of the pseudo-first-order and pseudo-second-order kinetic models, respectively.

The calculated parameters of the relevant dynamic models are presented in Table 2. As observed in Table 2, R 2 and Q e values obtained by fitting the pseudo-first-order kinetic model are 0.9945 and 22.28 ng·mL−1, respectively, whereas those obtained by fitting the pseudo-second-order kinetic model are 0.9994 and 19.53 ng·mL−1. These results indicate that R 2 obtained by fitting Eq. 2 is higher than that obtained by fitting Eq. 1, and the theoretical equilibrium adsorption capacity derived from the pseudo-second-order kinetic equation is closer to the experimental value (19.07 ng·mg−1). This suggests that the adsorption process of Fe3O4@SiO2-Apt MNPs to phorate aligns more closely with the pseudo-second-order kinetic model (Kinetic adsorption curve and pseudo-second-order model fitting curve are shown in Figure 10). This indicates that the adsorption rate of phorate is controlled by a chemical mechanism, possibly due to hydrogen bonding or van der Waals interactions between the active sites generated by the stem-ring structure of the aptamer and the phorate molecule.

Table 2

Kinetic parameters for phorate adsorption on Fe3O4@SiO2-Apt MNPs

Model Parameters R 2
Pseudo-first order k 1 = –0.3535 min−1 0.9945
Q e = 22.28 ng·mg−1
Pseudo-second order k 2 = 0.02168 min−1 0.9994
Q e = 19.53 ng·mg−1

To further investigate the adsorption process of Fe3O4@SiO2-Apt MNPs on phorate, we utilized the Langmuir and Freundlich isothermal models to evaluate the adsorption performance of Fe3O4@SiO2-Apt MNPs.

(3) C e Q e = 1 Q max · k L + C e Q max

(4) ln Q e = ln k F − 1 n ln C e

Here, C e represents the concentration of phorate under adsorption equilibrium, Q e is the adsorption capacity per unit mass of the adsorbent at equilibrium, Q max is the maximum adsorption capacity per unit mass of the adsorbent, K L is the Langmuir affinity constant, and K F and n are the Freundlich adsorption equation constants.

The parameters and correlation coefficients for the isotherm models obtained from experimental data are summarized in Table 3. The Langmuir adsorption isothermal model is found to be more suitable than the Freundlich model for the phorate molecule, indicating that the adsorption process is monolayer adsorption. The Q max value calculated by the Langmuir adsorption isothermal model was 78.54 ng·mg−1, which closely matched the experimental value (77.25 ng·mg−1). The adsorption isothermal curve and the Langmuir models fitting curve are shown in Figure 11.

Table 3

Parameters of the Langmuir and Freundlich isotherm models for phorate adsorption in Fe3O4@SiO2-Apt MNPs

Adsorption isotherm model Parameters
Lagmuir Q max = 78.54 ng·mg−1
k L = 0.0472 mL·mg−1
R 2 = 0.9978
Freundlich k F = 15.0581 mL·mg−1
n = 3.98
R 2 = 0.8776

3.6 Method evaluation

Under the optimal extraction conditions, various performance parameters of the method, including the linear range, detection limit, quantitation limit, stability, and others, were experimentally assessed using GC-MS. The results revealed a linear correlation between phorate concentration and chromatographic peak area within the concentration range of 2–700 ng·mL−1, with a linear correlation coefficient (R 2) of 0.9991. The method’s detection limit (S/N = 3) was determined to be 0.46 ng·mL−1, and the quantitation limit (S/N = 10) was found to be 1.91 ng·mL−1. Method stability was evaluated through intra-day and inter-day precision. Five parallel experiments were conducted within a single day and over five consecutive days, yielding intra-day and inter-day relative standard deviations (RSDs) of 3.4% and 4.1%, respectively.

3.7 Extraction capacity

The sorbent’s specificity was assessed through experimental examination. Five dithiophosphate organophosphate pesticides (terbufos, malathion, dimethoate, ethion, and phosmet) with structures similar to phorate, along with seven common OPPs exhibiting different structures, including phosphate esters (DDVP, moncrotophos), sulfur (ketone)-substituted phosphate esters (phoxim, demeton, parathion, diazinon), and phosphamide esters (methamidophos), were chosen as interfering reagents. These compounds were combined with phorate and introduced into the experimental sample, each at a concentration of 200 ng·mL−1. Subsequent to the extraction method, the results are illustrated in Figure 12(a). The recovery of phorate significantly surpassed that of other reagents, indicating the sorbent’s strong selectivity for phorate. The nonspecific adsorption of Fe3O4 MNPs, Fe3O4@SiO2 MNPs, Fe3O4@SiO2-NH2 MNPs, and Fe3O4@SiO2-COOH MNPs was investigated, and the results are displayed in Figure 12(b). The recovery rates of phorate by these four MNPs were considerably lower than that of Fe3O4@SiO2-Apt MNPs, indicating minimal nonspecific adsorption by the former.

Figure 10 Kinetic adsorption analysis of Fe3O4@SiO2-Apt MNPs using phorate as analyte: (a) kinetic adsorption curve and (b) pseudo-second-order model fitting to the experimental values with its linear regression.
Figure 10

Kinetic adsorption analysis of Fe3O4@SiO2-Apt MNPs using phorate as analyte: (a) kinetic adsorption curve and (b) pseudo-second-order model fitting to the experimental values with its linear regression.

Figure 11 Study of the isothermal adsorption of Fe3O4@SiO2-Apt MNPs using phorate as analyte: (a) adsorption isothermal curve and (b) the Langmuir models fitting the experimental values, with the corresponding linear regressions.
Figure 11

Study of the isothermal adsorption of Fe3O4@SiO2-Apt MNPs using phorate as analyte: (a) adsorption isothermal curve and (b) the Langmuir models fitting the experimental values, with the corresponding linear regressions.

Figure 12 (a) Specificity tests of Fe3O4@SiO2-Apt MNPs and (b) comparison of the extraction efficiency for phorate by the different sorbents.
Figure 12

(a) Specificity tests of Fe3O4@SiO2-Apt MNPs and (b) comparison of the extraction efficiency for phorate by the different sorbents.

The sorbent’s enrichment capacity was assessed by comparing phorate recovery in different sample volumes. The maximum enrichment volume was determined to be 500 mL, resulting in an EF of 416. In addition, the reusability of the sorbent was investigated, showing that the phorate’s recovery rate remained above 80% after 15 successive uses of the sorbent.

3.8 Analysis of real samples

To assess the performance of the adsorption materials in extracting phorate from real plasma samples, the plasma samples underwent pretreatment according to the procedure outlined in Section 2.4. Subsequently, they were subjected to extraction and enrichment following the experimental protocol described in Section 2.5 and analyzed using GC-MS. The results indicated the absence of phorate in the samples. Following this, standard phorate solutions with concentrations of 20, 200, and 600 ng·mL−1 were introduced into the plasma sample. The extraction and detection were carried out following the experimental method, and the recoveries of the spiked standards were calculated (n = 3). The experimental results are summarized in Table 4, showing spiked recoveries ranging from 86.1% to 101.7%, with RSDs between 5.2% and 7.7%. These findings affirm the suitability of the method for extracting and detecting phorate in plasma samples. The sources of errors in this study primarily stem from systematic errors. There are numerous manual operations involved in the process of material synthesis and phorate extraction and detection, which can introduce errors. In addition, incomplete or side reactions may occur during the material synthesis process. Therefore, in future research, it is advisable to develop automated methods, increase the number of parallel experiments, and conduct blank and control experiments to minimize the impact of systematic errors on the research.

Table 4

Detection of phorate in plasma samples

Plasma sample Spiked (ng·mL−1) Found (ng·mL−1) Recovery (%) RSD (n = 3) (%)
Sample 1 20 17.9 89.5 6.8
200 203.4 101.7 6.2
600 589.7 98.3 5.2
Sample 2 20 17.2 86.1 7.7
200 201.6 100.8 5.9
600 571.7 95.3 7.3

3.9 Comparison study

The method established in this work was compared with other magnetic solid-phase methods for phorate extraction reported in the literature. The extraction performance and detection parameters are shown in Table 5. As seen from the table, in comparison to other methods, this study exhibits a higher specific recognition ability for phorate and lower cross-reactivity, making it suitable for targeted adsorption detection of phorate in the environment and targeted detection and treatment of individuals poisoned by phorate. In terms of the samples to be detected, this study, using the good hydrophilicity and biocompatibility of the aptamer, explored the extraction of phorate from complex plasma matrices for the first time, demonstrating good extraction performance and expanding the application range of MSPE methods. Another notable feature of this method is its reusability. Among the studies that provided this information, this material demonstrated the highest number of reuses, effectively reducing the cost of synthesis and usage. This method is similar to other methods reported in the literature in terms of adsorption time, detection limit, and linear range and can be used to analyze and detect phorate at trace levels. The comparison results demonstrate that the method has good selectivity, strong anti-interference ability, simple operation, high sensitivity, and environmental friendliness, making it suitable for specific detection of phorate in plasma samples and replacing existing methods for phorate extraction and detection in water environments.

Table 5

Comparison of the proposed method with other magnetic methods for determination of phorate

Method Sorbent Sample LOD (ng·mL−1) Linear range (ng·mL−1) Extraction time (min) Specificity Reusability Ref.
MSPE-LC/MS/MS MVP-DB Honey 0.1 2–250 20 No 10 [47]
MSPE-GC/FPD MNPCs Fruits 1.5 ng·g−1 3–6,000 ng·g− 80 No — [25]
R-DSPE- GC/MS/MS Fe3O4@CFR@GO Chilli  ng·g−1 0.5–100 — No 5 [48]
MSPE-GC/MS/MS Fe3O4@SiO2-C18 Water 0.5 0.5–100 11 No — [49]
MSPE-GC/MS/MS 3D-rGOPFH Vegetables 5–100 ng·g− 26 No 10 [50]
MSPE-LC/MS/MS Fe3O4-PSA Grains 0.32 2–250 7 No — [51]
MSPE-GC/ECD Fe-ACF/CNF Water 4.08 20–500 16 No 4 [52]
MSPE-LC/MS/MS Fe3O4-SiO2 Earthworm 1 2–200 23 No — [53]
SPME-GC/MS MIL-53(Al)/Fe2O3 Water 0.8 3–800 35 No — [54]
MSPE- GC/MS Fe3O4@SiO2-Apt Plasma 0.46 2–700 10 Yes 15 This work

MVP-DB: magnetic polymer (N-vinyl pyrrolidone-divinyl benzene). MNPCs: magnetic nanoporous carbons. R-DSPE: reversed dispersive solid-phase extraction. CFR: catechol formaldehyde resin. GO: graphene oxide. 3D-rGOPFH: three-dimensional microporous reduced graphene oxide/polypyrrole nanotube/magnetite hydrogel. PSA: 3-(N,N-diethylamino)propyltrimethoxysilane. ACF/CNF: iron nanoparticles dispersed hierarchical carbon fiber forest.

4 Conclusion

In this study, Fe3O4@SiO2-Apt MNPs were synthesized using a self-assembly method, combining Apt and MNPs, and characterized using SEM, FTIR, CLSM, and other techniques. The characterization results have confirmed the successful attainment of the desired outcomes at each step of the preparation process. This substantiates that the synthesized Fe3O4@SiO2-Apt MNPs displayed favorable characteristics in terms of morphology, dispersion, stability, and magnetic responsiveness. By using this material as the sorbent, we established a magnetic dispersive solid-phase extraction method to effectively enrich and extract phorate from plasma samples. Subsequently, phorate was detected using GC-MS. Under the optimal extraction and elution conditions, the method’s detection limit (S/N = 3) was 0.46 ng·mL−1, accompanied by good repeatability. The analytical method proved to be reliable for the trace detection of phorate in samples. Comprehensive experimental results highlighted the method’s advantages, including straightforward operation, short extraction time (10 min), strong specificity, high extraction efficiency (EF = 416), and excellent reusability (≥15 times). This method can be effectively applied for the extraction and detection of phorate in actual plasma samples, yielding acceptable recovery rates. Based on the method of combining aptamer and MSPE proposed in this study, it is expected to achieve selective extraction and detection of other kinds of target substances in biological samples by changing the type of Apt or utilizing the synergistic working approach of multiple Apt, which has a wide application prospect.

  1. Funding information: This work was financially supported by the Opening Project of Key Laboratory of Evidence Science (China University of Political Science and Law), Ministry of Education (2019KFKT01), the National Natural Science Foundation of China (81871523), Scientific Research Foundation of Hebei North University(3050102003), and the Fundamental Research Funds for the Central Universities.

  2. Author contributions: Ting Wang: writing – original draft, writing – review and editing, and investigation; Junpeng Tan: writing – original draft and data curation; Shenghui Xu: investigation and formal analysis; Yong Li: formal analysis and supervision; Hongxia Hao: writing – review and editing, project administration, and supervision.

  3. Conflict of interest: The authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Dar MA, Baba ZA, Kaushik G. A review on phorate persistence, toxicity and remediation by bacterial communities. Pedosphere. 2022;32(1):171–83. 10.1016/S1002-0160(21)60043-7.Search in Google Scholar

[2] Figueroa-Villar JD, Petronilho EC, Kuca K, Franca TCC. Review about structure and evaluation of reactivators of acetylcholinesterase inhibited with neurotoxic organophosphorus compounds. Curr Med Chem. 2021;28(7):1422–42. 10.2174/0929867327666200425213215.Search in Google Scholar PubMed

[3] Zhao M, Chen LH, Zhang ZG, Li C. New progress in the mechanism and treatment of organic phosphorus pesticide poisoning. Chin J Pract Intern Med. 2014;34(11):1064–8. 10.7504/nk2014100205.Search in Google Scholar

[4] Zhu J, Wang J, Ding Y, Liu B, Xiao W. A systems-level approach for investigating organophosphorus pesticide toxicity. Ecotoxicol Env Saf. 2018;149:26–35. 10.1016/j.ecoenv.2017.10.066.Search in Google Scholar PubMed

[5] Derbalah A, Chidya R, Jadoon W, Sakugawa H. Temporal trends in organophosphorus pesticides use and concentrations in river water in Japan, and risk assessment. J Environ Sci. 2019;79:135–52. 10.1016/j.jes.2018.11.019.Search in Google Scholar PubMed

[6] Khademi SMS, Salemi A, Jochmann M, Joksimoski S, Telgheder U. Development and comparison of direct immersion solid phase micro extraction Arrow-GC-MS for the determination of selected pesticides in water. Microchem J. 2021;164:106006. 10.1016/j.microc.2021.106006.Search in Google Scholar

[7] Iqbal S, Iqbal MM, Javed M, Bahadur A, Liu G. Modified QuEChERS extraction method followed by simultaneous quantitation of nine multi-class pesticides in human blood and urine by using GC-MS. J Chromatogr B. 2020;1152:122227. 10.1016/j.jchromb.2020.122227.Search in Google Scholar PubMed

[8] Notardonato I, Salimei E, Russo MV, Avino P. Simultaneous determination of organophosphorus pesticides and phthalates in baby food samples by ultrasound-vortex-assisted liquid–liquid microextraction and GC-IT/MS. Anal Bioanal Chem. 2018;410(14):3285–96. 10.1007/s00216-018-0986-x.Search in Google Scholar PubMed

[9] Wu L, Song Y, Hu M, Zhang H, Yu A, Yu C, et al. Application of magnetic solvent bar liquid-phase microextraction for determination of organophosphorus pesticides in fruit juice samples by gas chromatography mass spectrometry. Food Chem. 2015;176:197–204. 10.1016/j.foodchem.2014.12.055.Search in Google Scholar PubMed

[10] Chisvert A, Cárdenas S, Lucena R. Dispersive micro-solid phase extraction. Trends Anal Chem. 2019;112:226–33. 10.1016/j.trac.2018.12.005.Search in Google Scholar

[11] Cruz FV, Maria F, Grosso PJ, Maria OJ, Fernandes DV, Cristina DM. Magnetic dispersive micro solid-phase extraction and gas chromatography determination of organophosphorus pesticides in strawberries. J Chromatogr A. 2018;1566:1–12. 10.1016/j.chroma.2018.06.045.Search in Google Scholar PubMed

[12] Montiel-León JM, Duy SV, Munoz G, Verner MA, Hendawi MY, Moya H, et al. Occurrence of pesticides in fruits and vegetables from organic and conventional agriculture by QuEChERS extraction liquid chromatography tandem mass spectrometry. Food Control. 2019;104:74–82. 10.1016/j.foodcont.2019.04.027.Search in Google Scholar

[13] Badawy SM. Optimization of reaction time for detection of organophosphorus pesticides by enzymatic inhibition assay and mathematical modeling of enzyme inhibition. J Environ Sci Health B. 2021;56(2):142–9. 10.1080/03601234.2020.1853455.Search in Google Scholar PubMed

[14] Du L, Wang X, Liu T, Li J, Wang H. Magnetic solid-phase extraction of organophosphorus pesticides from fruit juices using NiFe2O4@polydopamine@Mg/Al-layered double hydroxides nanocomposites as an adsorbent. Microchem J. 2019;150:104128. 10.1016/j.microc.2019.104128.Search in Google Scholar

[15] Chahkandi M, Amiri A, Arami SRS. Extraction and preconcentration of organophosphorus pesticides from water samples and fruit juices utilizing hydroxyapatite/Fe3O4 nanocomposite. Microchem J. 2019;144:261–9. 10.1016/j.microc.2018.09.018.Search in Google Scholar

[16] Kumar N, Narayanan N, Gupta S. Ultrasonication assisted extraction of chlorpyrifos from honey and brinjal using magnetic molecularly imprinted polymers followed by GLC-ECD analysis. React Funct Polym. 2019;135:103–12. 10.1016/j.reactfunctpolym.2018.12.012.Search in Google Scholar

[17] Wang J, Mou ZL, Duan HL, Ma SY, Zhang J, Zhang ZQ. A magnetic hyperbranched polyamide amine-based quick, easy, cheap, effective, rugged and safe method for the detection of organophosphorus pesticide residues. J Chromatogr A. 2019;1585:202–6. 10.1016/j.chroma.2018.11.071.Search in Google Scholar PubMed

[18] Wang P, Luo M, Liu D, Zhan J, Liu X, Wang F, et al. Application of a magnetic graphene nanocomposite for organophosphorus pesticide extraction in environmental water samples. J Chromatogr A. 2018;1535:9–16. 10.1016/j.chroma.2018.01.003.Search in Google Scholar PubMed

[19] Hamedi R, Aghaie ABG, Hadjmohammadi MR. Magnetic core micelles as a nanosorbent for the efficient removal and recovery of three organophosphorus pesticides from fruit juice and environmental water samples. J Sep Sci. 2018;41(9):2037–45. 10.1002/jssc.201701090.Search in Google Scholar PubMed

[20] Torabi E, Moghadasi M, Mirzaei M, Amiri A. Nanofiber-based sorbents: Current status and applications in extraction methods. J Chromatogr A. 2023;1689:463739–15. 10.1016/j.chroma.2022.463739.Search in Google Scholar PubMed

[21] Torabi E, Mirzaei M, Bazargan M, Amiri A. A critical review of covalent organic frameworks-based sorbents in extraction methods. Anal Chim Acta. 2022;1224:340207–27. 10.1016/j.aca.2022.340207.Search in Google Scholar PubMed

[22] Bazargan M, Ghaemi F, Amiri A, Mirzaei M. Metal–organic framework-based sorbents in analytical sample preparation. Coord Chem Rev. 2021;224:214107–31. 10.1016/j.ccr.2021.214107.Search in Google Scholar

[23] Tang Q, Wang X, Yu F, Qiao X, Xu Z. Simultaneous determination of ten organophosphate pesticide residues in fruits by gas chromatography coupled with magnetic separation. J Sep Sci. 2014;37(7):820–7. 10.1002/jssc.201301161.Search in Google Scholar PubMed

[24] Mahpishanian S, Sereshti H. Three-dimensional graphene aerogel-supported iron oxide nanoparticles as an efficient adsorbent for magnetic solid phase extraction of organophosphorus pesticide residues in fruit juices followed by gas chromatographic determination. J Chromatogr A. 2016;1443:43–53. 10.1016/j.chroma.2016.03.046.Search in Google Scholar PubMed

[25] Li D, He M, Chen B, Hu B. Metal organic frameworks-derived magnetic nanoporous carbon for preconcentration of organophosphorus pesticides from fruit samples followed by gas chromatography-flame photometric detection. J Chromatogr A. 2019;1583:19–27. 10.1016/j.chroma.2018.11.012.Search in Google Scholar PubMed

[26] Pichon V, Brothier F, Combès A. Aptamer-based-sorbents for sample treatment—a review. Anal Bioanal Chem. 2015;407(3):681–98. 10.1007/s00216-014-8129-5.Search in Google Scholar PubMed

[27] Jin C, Qiu L, Li J, Fu T, Zhang X, Tan W. Cancer biomarker discovery using DNA aptamers. Analyst. 2016;141(2):461–6. 10.1039/c5an01918d.Search in Google Scholar PubMed PubMed Central

[28] Sun C, Sun R, Chen Y, Tong Y, Zhu J, Bai H, et al. Utilization of aptamer-functionalized magnetic beads for highly accurate fluorescent detection of mercury (II) in environment and food. Sens Actuators B Chem. 2018;255:775–80. 10.1016/j.snb.2017.08.004.Search in Google Scholar

[29] Frohnmeyer E, Frisch F, Falke S, Betzel C, Fischer M. Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA. J Biotechnol. 2018;269:35–42. 10.1016/j.jbiotec.2018.01.012.Search in Google Scholar PubMed

[30] Saberi Z, Rezaei B, Khayamian T. A fluorescent aptasensor for analysis of adenosine triphosphate based on aptamer–magnetic nanoparticles and its single-stranded complementary DNA labeled carbon dots. Luminescence. 2018;33(4):640–6. 10.1002/bio.3457.Search in Google Scholar PubMed

[31] Presnell KV, Alper HS. Thermodynamic and first-principles biomolecular simulations applied to synthetic biology: promoter and aptamer designs. Mol Syst Des Eng. 2018;3(1):19–37. 10.1039/c7me00083a.Search in Google Scholar

[32] Huang R, Xi Z, He N. Applications of aptamers for chemistry analysis, medicine and food security. Sci China Chem. 2015;58(7):1122–30. 10.1007/s11426-015-5344-7.Search in Google Scholar

[33] Li Y, Zhao M, Wang H. Label-free peptide aptamer based impedimetric biosensor for highly sensitive detection of TNT with a ternary assembly layer. Anal Bioanal Chem. 2017;409(27):6371–7. 10.1007/s00216-017-0576-3.Search in Google Scholar PubMed

[34] Farzin L, Shamsipur M, Sheibani S. A review: Aptamer-based analytical strategies using the nanomaterials for environmental and human monitoring of toxic heavy metals. Talanta. 2017;174:619–27. 10.1016/j.talanta.2017.06.066.Search in Google Scholar PubMed

[35] Wang L, Liu X, Zhang Q, Zhang C, Liu Y, Kang T, et al. Selection of DNA aptamers that bind to four organophosphorus pesticides. Biotechnol Lett. 2012;34(5):869–74. 10.1007/s10529-012-0850-6.Search in Google Scholar PubMed

[36] Zhang C, Wang L, Tu Z, Sun X, He Q, Lei Z, et al. Organophosphorus pesticides detection using broad-specific single-stranded DNA based fluorescence polarization aptamer assay. Biosens Bioelectron. 2014;55:216–9. 10.1016/j.bios.2013.12.020.Search in Google Scholar PubMed

[37] Pang S, Labuza TP, He L. Development of a single aptamer-based surface enhanced raman scattering method for rapid detection of multiple pesticides. Analyst. 2014;139:1895–901. 10.1039/c3an02263c.Search in Google Scholar PubMed

[38] Bai W, Zhu C, Liu J, Yan M, Yang S, Chen A. Gold nanoparticle-based colorimetric aptasensor for rapid detection of six organophosphorous pesticides. Environ Toxicol Chem. 2015;34(10):2244–9. 10.1002/etc.3088.Search in Google Scholar PubMed

[39] Shen Z, Xu D, Wang G, Geng L, Xu R, Wang G, et al. Novel colorimetric aptasensor based on MOF-derived materials and its applications for organophosphorus pesticides determination. J Hazard Mater. 2022;440:129707. 10.1016/j.jhazmat.2022.129707.Search in Google Scholar PubMed

[40] Tang T, Deng J, Zhang M, Shi G, Zhou T. Quantum dot-DNA aptamer conjugates coupled with capillary electrophoresis: a universal strategy for ratiometric detection of organophosphorus pesticides. Talanta. 2016;146:55–61. 10.1016/j.talanta.2015.08.023.Search in Google Scholar PubMed

[41] Li X, Shi J, Chen C, Li W, Han L, Lan L, et al. One-step, visual and sensitive detection of phorate in blood based on a DNA–AgNC aptasensor. N J Chem. 2018;42(8):6293–8. 10.1039/c8nj00958a.Search in Google Scholar

[42] Dou X, Chu X, Kong W, Luo J, Yang M. A gold-based nanobeacon probe for fluorescence sensing of organophosphorus pesticides. Anal Chim Acta. 2015;891:291–7. 10.1016/j.aca.2015.08.012.Search in Google Scholar PubMed

[43] Li H, Huang X, Huang J, Bai M, Hu M, Guo Y, et al. Fluorescence assay for detecting four organophosphorus pesticides using fluorescently labeled aptamer. Sensors. 2022;22:5712. 10.3390/s22155712.Search in Google Scholar PubMed PubMed Central

[44] Deng H, Li X, Peng Q, Wang X, Chen J, Li Y. Monodispherse magnetic single-crystal ferrite microspheres. Angew Chem. 2005;44(18):2782–5. 10.1002/anie.200462551.Search in Google Scholar PubMed

[45] Yang Y, Su P, Zheng K, Wang T, Song J, Yang Y. A self-directed and reconstructible immobilization strategy: DNA directed immobilization of alkaline phosphatase for enzyme inhibition assays. RSC Adv. 2016;6:36849–56. 10.1039/c6ra01621a.Search in Google Scholar

[46] Zhang S, Zhang W, Dai J, Sun M, Zhao J, Ji L, et al. Carboxylated carbon nanotubes with high electrocatalytic activity for oxygen evolution in acidic conditions. InfoMat. 2022;4:e12273. 10.1002/inf2.12273.Search in Google Scholar

[47] Liu Z, Wang J, Wang Z, Xu H, Di S, Zhao H, et al. Development of magnetic solid phase extraction using magnetic amphiphilic polymer for sensitive analysis of multi-pesticides residue in honey. J Chromatogr A. 2022;1664:462789. 10.1016/j.chroma.2021.462789.Search in Google Scholar PubMed

[48] Khetagoudar MC, Jinendra U, Kumar AP, Bilehal D, Kollur SP. Multiresidue pesticide analysis in green chilli using GC–MS/MS using modified QuEChERS method with highly efficient Fe3O4@CFR@GO nanocomposite. Inorg Chem Commun. 2022;137:109195. 10.1016/j.inoche.2022.109195.Search in Google Scholar

[49] Srivastava N, Kumari S, Nair K, Alam S, Raza SK. Determination of organophosphorous pesticides in environmental water samples using surface-engineered C18 functionalized silica-coated core-shell magnetic nanoparticles–based extraction coupled with GC-MS/MS analysis. J AOAC Int. 2017;100(3):804–9. 10.5740/jaoacint.16-0312.Search in Google Scholar PubMed

[50] Wang S, Li X, Li M, Li X, Li X, Li S, et al. Self-assembled three-dimensional microporous rGO/PNT/Fe3O4 hydrogel sorbent for magnetic preconcentration of multi-residue insecticides. Appl Sci. 2020;10:5665. 10.3390/app10165665.Search in Google Scholar

[51] Liu Z, Qi P, Wang X, Wang Z, Xu X, Chen W, et al. Multi-pesticides residue analysis of grains using modified magnetic nanoparticle adsorbent for facile and efficient cleanup. Food Chem. 2017;230:423–31. 10.1016/j.foodchem.2017.03.082.Search in Google Scholar PubMed

[52] Singh M, Pandey A, Singh S, Singh SP. Iron nanoparticles decorated hierarchical carbon fiber forest for the magnetic solid-phase extraction of multi-pesticide residues from water samples. Chemosphere. 2021;282:131058. 10.1016/j.chemosphere.2021.131058.Search in Google Scholar PubMed

[53] Sun Y, Qi P, Cang T, Wang Z, Wang X, Yang X, et al. High-throughput multipesticides residue analysis in earthworms by the improvement of purification method: development and application of magnetic Fe3O4-SiO2 nanoparticles based dispersive solid-phase extraction. J Sep Sci. 2018;41:2419–31. 10.1002/jssc.201701296.Search in Google Scholar PubMed

[54] Moinfar S, Khodayari A, Sohrabnezhad S, Aghaei A, Jamil LA. MIL-53(Al)/Fe2O3 nanocomposite for solid-phase microextraction of organophosphorus pesticides followed by GC-MS analysis. Mikrochim Acta. 2020;187:647. 10.1007/s00604-020-04621-z.Search in Google Scholar PubMed

Received: 2023-04-12
Accepted: 2023-10-09
Published Online: 2023-11-01

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Value-added utilization of coal fly ash and recycled polyvinyl chloride in door or window sub-frame composites
  3. High removal efficiency of volatile phenol from coking wastewater using coal gasification slag via optimized adsorption and multi-grade batch process
  4. Evolution of surface morphology and properties of diamond films by hydrogen plasma etching
  5. Removal efficiency of dibenzofuran using CuZn-zeolitic imidazole frameworks as a catalyst and adsorbent
  6. Rapid and efficient microwave-assisted extraction of Caesalpinia sappan Linn. heartwood and subsequent synthesis of gold nanoparticles
  7. The catalytic characteristics of 2-methylnaphthalene acylation with AlCl3 immobilized on Hβ as Lewis acid catalyst
  8. Biodegradation of synthetic PVP biofilms using natural materials and nanoparticles
  9. Rutin-loaded selenium nanoparticles modulated the redox status, inflammatory, and apoptotic pathways associated with pentylenetetrazole-induced epilepsy in mice
  10. Optimization of apigenin nanoparticles prepared by planetary ball milling: In vitro and in vivo studies
  11. Synthesis and characterization of silver nanoparticles using Origanum onites leaves: Cytotoxic, apoptotic, and necrotic effects on Capan-1, L929, and Caco-2 cell lines
  12. Exergy analysis of a conceptual CO2 capture process with an amine-based DES
  13. Construction of fluorescence system of felodipine–tetracyanovinyl–2,2′-bipyridine complex
  14. Excellent photocatalytic degradation of rhodamine B over Bi2O3 supported on Zn-MOF nanocomposites under visible light
  15. Optimization-based control strategy for a large-scale polyhydroxyalkanoates production in a fed-batch bioreactor using a coupled PDE–ODE system
  16. Effectiveness of pH and amount of Artemia urumiana extract on physical, chemical, and biological attributes of UV-fabricated biogold nanoparticles
  17. Geranium leaf-mediated synthesis of silver nanoparticles and their transcriptomic effects on Candida albicans
  18. Synthesis, characterization, anticancer, anti-inflammatory activities, and docking studies of 3,5-disubstituted thiadiazine-2-thiones
  19. Synthesis and stability of phospholipid-encapsulated nano-selenium
  20. Putative anti-proliferative effect of Indian mustard (Brassica juncea) seed and its nano-formulation
  21. Enrichment of low-grade phosphorites by the selective leaching method
  22. Electrochemical analysis of the dissolution of gold in a copper–ethylenediamine–thiosulfate system
  23. Characterisation of carbonate lake sediments as a potential filler for polymer composites
  24. Evaluation of nano-selenium biofortification characteristics of alfalfa (Medicago sativa L.)
  25. Quality of oil extracted by cold press from Nigella sativa seeds incorporated with rosemary extracts and pretreated by microwaves
  26. Heteropolyacid-loaded MOF-derived mesoporous zirconia catalyst for chemical degradation of rhodamine B
  27. Recovery of critical metals from carbonatite-type mineral wastes: Geochemical modeling investigation of (bio)hydrometallurgical leaching of REEs
  28. Photocatalytic properties of ZnFe-mixed oxides synthesized via a simple route for water remediation
  29. Attenuation of di(2-ethylhexyl)phthalate-induced hepatic and renal toxicity by naringin nanoparticles in a rat model
  30. Novel in situ synthesis of quaternary core–shell metallic sulfide nanocomposites for degradation of organic dyes and hydrogen production
  31. Microfluidic steam-based synthesis of luminescent carbon quantum dots as sensing probes for nitrite detection
  32. Transformation of eggshell waste to egg white protein solution, calcium chloride dihydrate, and eggshell membrane powder
  33. Preparation of Zr-MOFs for the adsorption of doxycycline hydrochloride from wastewater
  34. Green nanoarchitectonics of the silver nanocrystal potential for treating malaria and their cytotoxic effects on the kidney Vero cell line
  35. Carbon emissions analysis of producing modified asphalt with natural asphalt
  36. An efficient and green synthesis of 2-phenylquinazolin-4(3H)-ones via t-BuONa-mediated oxidative condensation of 2-aminobenzamides and benzyl alcohols under solvent- and transition metal-free conditions
  37. Chitosan nanoparticles loaded with mesosulfuron methyl and mesosulfuron methyl + florasulam + MCPA isooctyl to manage weeds of wheat (Triticum aestivum L.)
  38. Synergism between lignite and high-sulfur petroleum coke in CO2 gasification
  39. Facile aqueous synthesis of ZnCuInS/ZnS–ZnS QDs with enhanced photoluminescence lifetime for selective detection of Cu(ii) ions
  40. Rapid synthesis of copper nanoparticles using Nepeta cataria leaves: An eco-friendly management of disease-causing vectors and bacterial pathogens
  41. Study on the photoelectrocatalytic activity of reduced TiO2 nanotube films for removal of methyl orange
  42. Development of a fuzzy logic model for the prediction of spark-ignition engine performance and emission for gasoline–ethanol blends
  43. Micro-impact-induced mechano-chemical synthesis of organic precursors from FeC/FeN and carbonates/nitrates in water and its extension to nucleobases
  44. Green synthesis of strontium-doped tin dioxide (SrSnO2) nanoparticles using the Mahonia bealei leaf extract and evaluation of their anticancer and antimicrobial activities
  45. A study on the larvicidal and adulticidal potential of Cladostepus spongiosus macroalgae and green-fabricated silver nanoparticles against mosquito vectors
  46. Catalysts based on nickel salt heteropolytungstates for selective oxidation of diphenyl sulfide
  47. Powerful antibacterial nanocomposites from Corallina officinalis-mediated nanometals and chitosan nanoparticles against fish-borne pathogens
  48. Removal behavior of Zn and alkalis from blast furnace dust in pre-reduction sinter process
  49. Environmentally friendly synthesis and computational studies of novel class of acridinedione integrated spirothiopyrrolizidines/indolizidines
  50. The mechanisms of inhibition and lubrication of clean fracturing flowback fluids in water-based drilling fluids
  51. Adsorption/desorption performance of cellulose membrane for Pb(ii)
  52. A one-pot, multicomponent tandem synthesis of fused polycyclic pyrrolo[3,2-c]quinolinone/pyrrolizino[2,3-c]quinolinone hybrid heterocycles via environmentally benign solid state melt reaction
  53. Green synthesis of silver nanoparticles using durian rind extract and optical characteristics of surface plasmon resonance-based optical sensor for the detection of hydrogen peroxide
  54. Electrochemical analysis of copper-EDTA-ammonia-gold thiosulfate dissolution system
  55. Characterization of bio-oil production by microwave pyrolysis from cashew nut shells and Cassia fistula pods
  56. Green synthesis methods and characterization of bacterial cellulose/silver nanoparticle composites
  57. Photocatalytic research performance of zinc oxide/graphite phase carbon nitride catalyst and its application in environment
  58. Effect of phytogenic iron nanoparticles on the bio-fortification of wheat varieties
  59. In vitro anti-cancer and antimicrobial effects of manganese oxide nanoparticles synthesized using the Glycyrrhiza uralensis leaf extract on breast cancer cell lines
  60. Preparation of Pd/Ce(F)-MCM-48 catalysts and their catalytic performance of n-heptane isomerization
  61. Green “one-pot” fluorescent bis-indolizine synthesis with whole-cell plant biocatalysis
  62. Silica-titania mesoporous silicas of MCM-41 type as effective catalysts and photocatalysts for selective oxidation of diphenyl sulfide by H2O2
  63. Biosynthesis of zinc oxide nanoparticles from molted feathers of Pavo cristatus and their antibiofilm and anticancer activities
  64. Clean preparation of rutile from Ti-containing mixed molten slag by CO2 oxidation
  65. Synthesis and characterization of Pluronic F-127-coated titanium dioxide nanoparticles synthesized from extracts of Atractylodes macrocephala leaf for antioxidant, antimicrobial, and anticancer properties
  66. Effect of pretreatment with alkali on the anaerobic digestion characteristics of kitchen waste and analysis of microbial diversity
  67. Ameliorated antimicrobial, antioxidant, and anticancer properties by Plectranthus vettiveroides root extract-mediated green synthesis of chitosan nanoparticles
  68. Microwave-accelerated pretreatment technique in green extraction of oil and bioactive compounds from camelina seeds: Effectiveness and characterization
  69. Studies on the extraction performance of phorate by aptamer-functionalized magnetic nanoparticles in plasma samples
  70. Investigation of structural properties and antibacterial activity of AgO nanoparticle extract from Solanum nigrum/Mentha leaf extracts by green synthesis method
  71. Green fabrication of chitosan from marine crustaceans and mushroom waste: Toward sustainable resource utilization
  72. Synthesis, characterization, and evaluation of nanoparticles of clodinofop propargyl and fenoxaprop-P-ethyl on weed control, growth, and yield of wheat (Triticum aestivum L.)
  73. The enhanced adsorption properties of phosphorus from aqueous solutions using lanthanum modified synthetic zeolites
  74. Separation of graphene oxides of different sizes by multi-layer dialysis and anti-friction and lubrication performance
  75. Visible-light-assisted base-catalyzed, one-pot synthesis of highly functionalized cinnolines
  76. The experimental study on the air oxidation of 5-hydroxymethylfurfural to 2,5-furandicarboxylic acid with Co–Mn–Br system
  77. Highly efficient removal of tetracycline and methyl violet 2B from aqueous solution using the bimetallic FeZn-ZIFs catalyst
  78. A thermo-tolerant cellulase enzyme produced by Bacillus amyloliquefaciens M7, an insight into synthesis, optimization, characterization, and bio-polishing activity
  79. Exploration of ketone derivatives of succinimide for their antidiabetic potential: In vitro and in vivo approaches
  80. Ultrasound-assisted green synthesis and in silico study of 6-(4-(butylamino)-6-(diethylamino)-1,3,5-triazin-2-yl)oxypyridazine derivatives
  81. A study of the anticancer potential of Pluronic F-127 encapsulated Fe2O3 nanoparticles derived from Berberis vulgaris extract
  82. Biogenic synthesis of silver nanoparticles using Consolida orientalis flowers: Identification, catalytic degradation, and biological effect
  83. Initial assessment of the presence of plastic waste in some coastal mangrove forests in Vietnam
  84. Adsorption synergy electrocatalytic degradation of phenol by active oxygen-containing species generated in Co-coal based cathode and graphite anode
  85. Antibacterial, antifungal, antioxidant, and cytotoxicity activities of the aqueous extract of Syzygium aromaticum-mediated synthesized novel silver nanoparticles
  86. Synthesis of a silica matrix with ZnO nanoparticles for the fabrication of a recyclable photodegradation system to eliminate methylene blue dye
  87. Natural polymer fillers instead of dye and pigments: Pumice and scoria in PDMS fluid and elastomer composites
  88. Study on the preparation of glycerylphosphorylcholine by transesterification under supported sodium methoxide
  89. Wireless network handheld terminal-based green ecological sustainable design evaluation system: Improved data communication and reduced packet loss rate
  90. The optimization of hydrogel strength from cassava starch using oxidized sucrose as a crosslinking agent
  91. Green synthesis of silver nanoparticles using Saccharum officinarum leaf extract for antiviral paint
  92. Study on the reliability of nano-silver-coated tin solder joints for flip chips
  93. Environmentally sustainable analytical quality by design aided RP-HPLC method for the estimation of brilliant blue in commercial food samples employing a green-ultrasound-assisted extraction technique
  94. Anticancer and antimicrobial potential of zinc/sodium alginate/polyethylene glycol/d-pinitol nanocomposites against osteosarcoma MG-63 cells
  95. Nanoporous carbon@CoFe2O4 nanocomposite as a green absorbent for the adsorptive removal of Hg(ii) from aqueous solutions
  96. Characterization of silver sulfide nanoparticles from actinobacterial strain (M10A62) and its toxicity against lepidopteran and dipterans insect species
  97. Phyto-fabrication and characterization of silver nanoparticles using Withania somnifera: Investigating antioxidant potential
  98. Effect of e-waste nanofillers on the mechanical, thermal, and wear properties of epoxy-blend sisal woven fiber-reinforced composites
  99. Magnesium nanohydroxide (2D brucite) as a host matrix for thymol and carvacrol: Synthesis, characterization, and inhibition of foodborne pathogens
  100. Synergistic inhibitive effect of a hybrid zinc oxide-benzalkonium chloride composite on the corrosion of carbon steel in a sulfuric acidic solution
  101. Review Articles
  102. Role and the importance of green approach in biosynthesis of nanopropolis and effectiveness of propolis in the treatment of COVID-19 pandemic
  103. Gum tragacanth-mediated synthesis of metal nanoparticles, characterization, and their applications as a bactericide, catalyst, antioxidant, and peroxidase mimic
  104. Green-processed nano-biocomposite (ZnO–TiO2): Potential candidates for biomedical applications
  105. Reaction mechanisms in microwave-assisted lignin depolymerisation in hydrogen-donating solvents
  106. Recent progress on non-noble metal catalysts for the deoxydehydration of biomass-derived oxygenates
  107. Rapid Communication
  108. Phosphorus removal by iron–carbon microelectrolysis: A new way to achieve phosphorus recovery
  109. Special Issue: Biomolecules-derived synthesis of nanomaterials for environmental and biological applications (Guest Editors: Arpita Roy and Fernanda Maria Policarpo Tonelli)
  110. Biomolecules-derived synthesis of nanomaterials for environmental and biological applications
  111. Nano-encapsulated tanshinone IIA in PLGA-PEG-COOH inhibits apoptosis and inflammation in cerebral ischemia/reperfusion injury
  112. Green fabrication of silver nanoparticles using Melia azedarach ripened fruit extract, their characterization, and biological properties
  113. Green-synthesized nanoparticles and their therapeutic applications: A review
  114. Antioxidant, antibacterial, and cytotoxicity potential of synthesized silver nanoparticles from the Cassia alata leaf aqueous extract
  115. Green synthesis of silver nanoparticles using Callisia fragrans leaf extract and its anticancer activity against MCF-7, HepG2, KB, LU-1, and MKN-7 cell lines
  116. Algae-based green AgNPs, AuNPs, and FeNPs as potential nanoremediators
  117. Green synthesis of Kickxia elatine-induced silver nanoparticles and their role as anti-acetylcholinesterase in the treatment of Alzheimer’s disease
  118. Phytocrystallization of silver nanoparticles using Cassia alata flower extract for effective control of fungal skin pathogens
  119. Antibacterial wound dressing with hydrogel from chitosan and polyvinyl alcohol from the red cabbage extract loaded with silver nanoparticles
  120. Leveraging of mycogenic copper oxide nanostructures for disease management of Alternaria blight of Brassica juncea
  121. Nanoscale molecular reactions in microbiological medicines in modern medical applications
  122. Synthesis and characterization of ZnO/β-cyclodextrin/nicotinic acid nanocomposite and its biological and environmental application
  123. Green synthesis of silver nanoparticles via Taxus wallichiana Zucc. plant-derived Taxol: Novel utilization as anticancer, antioxidation, anti-inflammation, and antiurolithic potential
  124. Recyclability and catalytic characteristics of copper oxide nanoparticles derived from bougainvillea plant flower extract for biomedical application
  125. Phytofabrication, characterization, and evaluation of novel bioinspired selenium–iron (Se–Fe) nanocomposites using Allium sativum extract for bio-potential applications
  126. Erratum
  127. Erratum to “Synthesis, characterization, and evaluation of nanoparticles of clodinofop propargyl and fenoxaprop-P-ethyl on weed control, growth, and yield of wheat (Triticum aestivum L.)”
https://doi.org/10.1515/gps-2023-0065
Keywords for this article
phorate; magnetic nanoparticle; aptamer; magnetic solid phase extraction
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Value-added utilization of coal fly ash and recycled polyvinyl chloride in door or window sub-frame composites
  3. High removal efficiency of volatile phenol from coking wastewater using coal gasification slag via optimized adsorption and multi-grade batch process
  4. Evolution of surface morphology and properties of diamond films by hydrogen plasma etching
  5. Removal efficiency of dibenzofuran using CuZn-zeolitic imidazole frameworks as a catalyst and adsorbent
  6. Rapid and efficient microwave-assisted extraction of Caesalpinia sappan Linn. heartwood and subsequent synthesis of gold nanoparticles
  7. The catalytic characteristics of 2-methylnaphthalene acylation with AlCl3 immobilized on Hβ as Lewis acid catalyst
  8. Biodegradation of synthetic PVP biofilms using natural materials and nanoparticles
  9. Rutin-loaded selenium nanoparticles modulated the redox status, inflammatory, and apoptotic pathways associated with pentylenetetrazole-induced epilepsy in mice
  10. Optimization of apigenin nanoparticles prepared by planetary ball milling: In vitro and in vivo studies
  11. Synthesis and characterization of silver nanoparticles using Origanum onites leaves: Cytotoxic, apoptotic, and necrotic effects on Capan-1, L929, and Caco-2 cell lines
  12. Exergy analysis of a conceptual CO2 capture process with an amine-based DES
  13. Construction of fluorescence system of felodipine–tetracyanovinyl–2,2′-bipyridine complex
  14. Excellent photocatalytic degradation of rhodamine B over Bi2O3 supported on Zn-MOF nanocomposites under visible light
  15. Optimization-based control strategy for a large-scale polyhydroxyalkanoates production in a fed-batch bioreactor using a coupled PDE–ODE system
  16. Effectiveness of pH and amount of Artemia urumiana extract on physical, chemical, and biological attributes of UV-fabricated biogold nanoparticles
  17. Geranium leaf-mediated synthesis of silver nanoparticles and their transcriptomic effects on Candida albicans
  18. Synthesis, characterization, anticancer, anti-inflammatory activities, and docking studies of 3,5-disubstituted thiadiazine-2-thiones
  19. Synthesis and stability of phospholipid-encapsulated nano-selenium
  20. Putative anti-proliferative effect of Indian mustard (Brassica juncea) seed and its nano-formulation
  21. Enrichment of low-grade phosphorites by the selective leaching method
  22. Electrochemical analysis of the dissolution of gold in a copper–ethylenediamine–thiosulfate system
  23. Characterisation of carbonate lake sediments as a potential filler for polymer composites
  24. Evaluation of nano-selenium biofortification characteristics of alfalfa (Medicago sativa L.)
  25. Quality of oil extracted by cold press from Nigella sativa seeds incorporated with rosemary extracts and pretreated by microwaves
  26. Heteropolyacid-loaded MOF-derived mesoporous zirconia catalyst for chemical degradation of rhodamine B
  27. Recovery of critical metals from carbonatite-type mineral wastes: Geochemical modeling investigation of (bio)hydrometallurgical leaching of REEs
  28. Photocatalytic properties of ZnFe-mixed oxides synthesized via a simple route for water remediation
  29. Attenuation of di(2-ethylhexyl)phthalate-induced hepatic and renal toxicity by naringin nanoparticles in a rat model
  30. Novel in situ synthesis of quaternary core–shell metallic sulfide nanocomposites for degradation of organic dyes and hydrogen production
  31. Microfluidic steam-based synthesis of luminescent carbon quantum dots as sensing probes for nitrite detection
  32. Transformation of eggshell waste to egg white protein solution, calcium chloride dihydrate, and eggshell membrane powder
  33. Preparation of Zr-MOFs for the adsorption of doxycycline hydrochloride from wastewater
  34. Green nanoarchitectonics of the silver nanocrystal potential for treating malaria and their cytotoxic effects on the kidney Vero cell line
  35. Carbon emissions analysis of producing modified asphalt with natural asphalt
  36. An efficient and green synthesis of 2-phenylquinazolin-4(3H)-ones via t-BuONa-mediated oxidative condensation of 2-aminobenzamides and benzyl alcohols under solvent- and transition metal-free conditions
  37. Chitosan nanoparticles loaded with mesosulfuron methyl and mesosulfuron methyl + florasulam + MCPA isooctyl to manage weeds of wheat (Triticum aestivum L.)
  38. Synergism between lignite and high-sulfur petroleum coke in CO2 gasification
  39. Facile aqueous synthesis of ZnCuInS/ZnS–ZnS QDs with enhanced photoluminescence lifetime for selective detection of Cu(ii) ions
  40. Rapid synthesis of copper nanoparticles using Nepeta cataria leaves: An eco-friendly management of disease-causing vectors and bacterial pathogens
  41. Study on the photoelectrocatalytic activity of reduced TiO2 nanotube films for removal of methyl orange
  42. Development of a fuzzy logic model for the prediction of spark-ignition engine performance and emission for gasoline–ethanol blends
  43. Micro-impact-induced mechano-chemical synthesis of organic precursors from FeC/FeN and carbonates/nitrates in water and its extension to nucleobases
  44. Green synthesis of strontium-doped tin dioxide (SrSnO2) nanoparticles using the Mahonia bealei leaf extract and evaluation of their anticancer and antimicrobial activities
  45. A study on the larvicidal and adulticidal potential of Cladostepus spongiosus macroalgae and green-fabricated silver nanoparticles against mosquito vectors
  46. Catalysts based on nickel salt heteropolytungstates for selective oxidation of diphenyl sulfide
  47. Powerful antibacterial nanocomposites from Corallina officinalis-mediated nanometals and chitosan nanoparticles against fish-borne pathogens
  48. Removal behavior of Zn and alkalis from blast furnace dust in pre-reduction sinter process
  49. Environmentally friendly synthesis and computational studies of novel class of acridinedione integrated spirothiopyrrolizidines/indolizidines
  50. The mechanisms of inhibition and lubrication of clean fracturing flowback fluids in water-based drilling fluids
  51. Adsorption/desorption performance of cellulose membrane for Pb(ii)
  52. A one-pot, multicomponent tandem synthesis of fused polycyclic pyrrolo[3,2-c]quinolinone/pyrrolizino[2,3-c]quinolinone hybrid heterocycles via environmentally benign solid state melt reaction
  53. Green synthesis of silver nanoparticles using durian rind extract and optical characteristics of surface plasmon resonance-based optical sensor for the detection of hydrogen peroxide
  54. Electrochemical analysis of copper-EDTA-ammonia-gold thiosulfate dissolution system
  55. Characterization of bio-oil production by microwave pyrolysis from cashew nut shells and Cassia fistula pods
  56. Green synthesis methods and characterization of bacterial cellulose/silver nanoparticle composites
  57. Photocatalytic research performance of zinc oxide/graphite phase carbon nitride catalyst and its application in environment
  58. Effect of phytogenic iron nanoparticles on the bio-fortification of wheat varieties
  59. In vitro anti-cancer and antimicrobial effects of manganese oxide nanoparticles synthesized using the Glycyrrhiza uralensis leaf extract on breast cancer cell lines
  60. Preparation of Pd/Ce(F)-MCM-48 catalysts and their catalytic performance of n-heptane isomerization
  61. Green “one-pot” fluorescent bis-indolizine synthesis with whole-cell plant biocatalysis
  62. Silica-titania mesoporous silicas of MCM-41 type as effective catalysts and photocatalysts for selective oxidation of diphenyl sulfide by H2O2
  63. Biosynthesis of zinc oxide nanoparticles from molted feathers of Pavo cristatus and their antibiofilm and anticancer activities
  64. Clean preparation of rutile from Ti-containing mixed molten slag by CO2 oxidation
  65. Synthesis and characterization of Pluronic F-127-coated titanium dioxide nanoparticles synthesized from extracts of Atractylodes macrocephala leaf for antioxidant, antimicrobial, and anticancer properties
  66. Effect of pretreatment with alkali on the anaerobic digestion characteristics of kitchen waste and analysis of microbial diversity
  67. Ameliorated antimicrobial, antioxidant, and anticancer properties by Plectranthus vettiveroides root extract-mediated green synthesis of chitosan nanoparticles
  68. Microwave-accelerated pretreatment technique in green extraction of oil and bioactive compounds from camelina seeds: Effectiveness and characterization
  69. Studies on the extraction performance of phorate by aptamer-functionalized magnetic nanoparticles in plasma samples
  70. Investigation of structural properties and antibacterial activity of AgO nanoparticle extract from Solanum nigrum/Mentha leaf extracts by green synthesis method
  71. Green fabrication of chitosan from marine crustaceans and mushroom waste: Toward sustainable resource utilization
  72. Synthesis, characterization, and evaluation of nanoparticles of clodinofop propargyl and fenoxaprop-P-ethyl on weed control, growth, and yield of wheat (Triticum aestivum L.)
  73. The enhanced adsorption properties of phosphorus from aqueous solutions using lanthanum modified synthetic zeolites
  74. Separation of graphene oxides of different sizes by multi-layer dialysis and anti-friction and lubrication performance
  75. Visible-light-assisted base-catalyzed, one-pot synthesis of highly functionalized cinnolines
  76. The experimental study on the air oxidation of 5-hydroxymethylfurfural to 2,5-furandicarboxylic acid with Co–Mn–Br system
  77. Highly efficient removal of tetracycline and methyl violet 2B from aqueous solution using the bimetallic FeZn-ZIFs catalyst
  78. A thermo-tolerant cellulase enzyme produced by Bacillus amyloliquefaciens M7, an insight into synthesis, optimization, characterization, and bio-polishing activity
  79. Exploration of ketone derivatives of succinimide for their antidiabetic potential: In vitro and in vivo approaches
  80. Ultrasound-assisted green synthesis and in silico study of 6-(4-(butylamino)-6-(diethylamino)-1,3,5-triazin-2-yl)oxypyridazine derivatives
  81. A study of the anticancer potential of Pluronic F-127 encapsulated Fe2O3 nanoparticles derived from Berberis vulgaris extract
  82. Biogenic synthesis of silver nanoparticles using Consolida orientalis flowers: Identification, catalytic degradation, and biological effect
  83. Initial assessment of the presence of plastic waste in some coastal mangrove forests in Vietnam
  84. Adsorption synergy electrocatalytic degradation of phenol by active oxygen-containing species generated in Co-coal based cathode and graphite anode
  85. Antibacterial, antifungal, antioxidant, and cytotoxicity activities of the aqueous extract of Syzygium aromaticum-mediated synthesized novel silver nanoparticles
  86. Synthesis of a silica matrix with ZnO nanoparticles for the fabrication of a recyclable photodegradation system to eliminate methylene blue dye
  87. Natural polymer fillers instead of dye and pigments: Pumice and scoria in PDMS fluid and elastomer composites
  88. Study on the preparation of glycerylphosphorylcholine by transesterification under supported sodium methoxide
  89. Wireless network handheld terminal-based green ecological sustainable design evaluation system: Improved data communication and reduced packet loss rate
  90. The optimization of hydrogel strength from cassava starch using oxidized sucrose as a crosslinking agent
  91. Green synthesis of silver nanoparticles using Saccharum officinarum leaf extract for antiviral paint
  92. Study on the reliability of nano-silver-coated tin solder joints for flip chips
  93. Environmentally sustainable analytical quality by design aided RP-HPLC method for the estimation of brilliant blue in commercial food samples employing a green-ultrasound-assisted extraction technique
  94. Anticancer and antimicrobial potential of zinc/sodium alginate/polyethylene glycol/d-pinitol nanocomposites against osteosarcoma MG-63 cells
  95. Nanoporous carbon@CoFe2O4 nanocomposite as a green absorbent for the adsorptive removal of Hg(ii) from aqueous solutions
  96. Characterization of silver sulfide nanoparticles from actinobacterial strain (M10A62) and its toxicity against lepidopteran and dipterans insect species
  97. Phyto-fabrication and characterization of silver nanoparticles using Withania somnifera: Investigating antioxidant potential
  98. Effect of e-waste nanofillers on the mechanical, thermal, and wear properties of epoxy-blend sisal woven fiber-reinforced composites
  99. Magnesium nanohydroxide (2D brucite) as a host matrix for thymol and carvacrol: Synthesis, characterization, and inhibition of foodborne pathogens
  100. Synergistic inhibitive effect of a hybrid zinc oxide-benzalkonium chloride composite on the corrosion of carbon steel in a sulfuric acidic solution
  101. Review Articles
  102. Role and the importance of green approach in biosynthesis of nanopropolis and effectiveness of propolis in the treatment of COVID-19 pandemic
  103. Gum tragacanth-mediated synthesis of metal nanoparticles, characterization, and their applications as a bactericide, catalyst, antioxidant, and peroxidase mimic
  104. Green-processed nano-biocomposite (ZnO–TiO2): Potential candidates for biomedical applications
  105. Reaction mechanisms in microwave-assisted lignin depolymerisation in hydrogen-donating solvents
  106. Recent progress on non-noble metal catalysts for the deoxydehydration of biomass-derived oxygenates
  107. Rapid Communication
  108. Phosphorus removal by iron–carbon microelectrolysis: A new way to achieve phosphorus recovery
  109. Special Issue: Biomolecules-derived synthesis of nanomaterials for environmental and biological applications (Guest Editors: Arpita Roy and Fernanda Maria Policarpo Tonelli)
  110. Biomolecules-derived synthesis of nanomaterials for environmental and biological applications
  111. Nano-encapsulated tanshinone IIA in PLGA-PEG-COOH inhibits apoptosis and inflammation in cerebral ischemia/reperfusion injury
  112. Green fabrication of silver nanoparticles using Melia azedarach ripened fruit extract, their characterization, and biological properties
  113. Green-synthesized nanoparticles and their therapeutic applications: A review
  114. Antioxidant, antibacterial, and cytotoxicity potential of synthesized silver nanoparticles from the Cassia alata leaf aqueous extract
  115. Green synthesis of silver nanoparticles using Callisia fragrans leaf extract and its anticancer activity against MCF-7, HepG2, KB, LU-1, and MKN-7 cell lines
  116. Algae-based green AgNPs, AuNPs, and FeNPs as potential nanoremediators
  117. Green synthesis of Kickxia elatine-induced silver nanoparticles and their role as anti-acetylcholinesterase in the treatment of Alzheimer’s disease
  118. Phytocrystallization of silver nanoparticles using Cassia alata flower extract for effective control of fungal skin pathogens
  119. Antibacterial wound dressing with hydrogel from chitosan and polyvinyl alcohol from the red cabbage extract loaded with silver nanoparticles
  120. Leveraging of mycogenic copper oxide nanostructures for disease management of Alternaria blight of Brassica juncea
  121. Nanoscale molecular reactions in microbiological medicines in modern medical applications
  122. Synthesis and characterization of ZnO/β-cyclodextrin/nicotinic acid nanocomposite and its biological and environmental application
  123. Green synthesis of silver nanoparticles via Taxus wallichiana Zucc. plant-derived Taxol: Novel utilization as anticancer, antioxidation, anti-inflammation, and antiurolithic potential
  124. Recyclability and catalytic characteristics of copper oxide nanoparticles derived from bougainvillea plant flower extract for biomedical application
  125. Phytofabrication, characterization, and evaluation of novel bioinspired selenium–iron (Se–Fe) nanocomposites using Allium sativum extract for bio-potential applications
  126. Erratum
  127. Erratum to “Synthesis, characterization, and evaluation of nanoparticles of clodinofop propargyl and fenoxaprop-P-ethyl on weed control, growth, and yield of wheat (Triticum aestivum L.)”
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 8.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/gps-2023-0065/html?lang=en
Scroll to top button