Startseite Released from ZrO2/SiO2 coating resveratrol inhibits senescence and oxidative stress of human adipose-derived stem cells (ASC)
Artikel Open Access

Released from ZrO2/SiO2 coating resveratrol inhibits senescence and oxidative stress of human adipose-derived stem cells (ASC)

Resveratrol-doped biomaterial rejuvenates ASC
  • K. Kornicka , R. Walczak , A. Mucha und K. Marycz EMAIL logo
Veröffentlicht/Copyright: 23. Mai 2018
Artikel downloaden (PDF)
Open Chemistry
Aus der Zeitschrift Open Chemistry Band 16 Heft 1

Abstract

The rapid aging of the population results in increased number of metabolic and degenerative disorders, especially in the elderly.Thus, a novel approach in the fields of orthopedic and reconstructive surgery for bone regeneration is strongly desirable. A new perspective in the therapy of bone fractures is tissue engineering which combines living cells with biomaterials to develop modern substitutes that can restore tissue functions. Metallic biomaterials, including stainless steel and pure titanium, have been extensively used for the fabrication of surgical implants over decades. Chemical modification of material surface for example incorporation of chemotactic factors may significantly improve the therapeutic effect. In this paper we describe titanium substrate modifications with ZrO2/SiO2 coating functionalized with resveratrol using a sol – gel, dip-coating technique. Moreover, we established the effects of fabricated scaffolds on adipose stem cells isolated from elderly patients. Using fluorescence imaging, polymerase chain reaction (PCR)and cytotoxicity tests, we established that 0.5 Res_ZrO2/SiO2 significantly reduced apoptosis and accumulation of oxidative stress factors in adipose derived stem cells (ASC). Thus exploitation of fabricated biomaterials in regenerative medicine as a strategy for rejuvenate ASC from elderly patients in vivo, seems fully justified.

Keywords: sol-gel; dip coating; resveratrol; biocompatibility; mesenchymal stem cells

1 Introduction

Due to the rapid aging of the population, diseases and traumas are causing increased numbers of tissue defects and other musculoskeletal disorders [1,2,3,4,5,6]. Regenerative medicine aims to reconstruct organs and tissues by triggering a regeneration response. The special need for bone replacement exists in the fields of orthopedic and reconstructive surgery, where elderly patients comprise a major group of patients [7,8,9]. Tissue engineering combines living cells with biomaterials to develop modern substitutes that can restore tissue functions [10]. Scaffolds provide a mechanical stability for the transplant and surface area for proliferation, differentiation and adhesion of cells, to support regeneration of damaged tissue [11]. Moreover, by chemical modifications like incorporation of cell adhesion molecules or chemotactic factors on the biomaterial surface, tissue development may be significantly improved [12]. Extensive research has been dedicated to developing biomaterials with various composition and physical properties, like mechanical strength and topology, to control and enhance the biological response of cells [13,14,15].

Metallic biomaterials including stainless steel, cobalt – chromium alloys, pure titanium and titanium alloys, such as titanium – aluminum – vanadium alloy and nitinol have been extensively used for the fabrication of surgical implants over decades [16]. Due to their strength, resistance, electrical conductivity and ease of fabrication, those scaffolds are widely used in orthopedics, guaranteeing long-term implant performance. Although, due to concerns over metal corrosion and biocompatibility, a relatively small number of metals are currently used in medical practice [17]. 316L austenitic stainless steel (ASTM F 138/139) has been widely used in the repair of fractures to replace tissues and stabilize structures, including bone. Although, relatively non-expensive, it possess great susceptibility to corrosion when it gets into contact with biological fluid. Compared to stainless steel, titanium alloys are characterized by excellent in vivo corrosion resistance, due to the stable passive oxide layer forming. Titanium (Ti) alloys havestrength comparable to 316L, although they are approximately 50% lighter in weight, which makes them an ideal tool in scaffold fabrication. Moreover, Ti implants are better tolerated by the immune system.

To prevent the initiation of corrosion, surface modifications such as the application of protective coatings has been performed in numerous studies. Because of non-expensive, uncomplicated and low temperature conditions required, the sol – gel technique is commonly used as a surface modification method. The coatings can be composed of organic, inorganic and polymer compounds, forming hybrid or multilayer films [18]. Sol - gel modification can provide appropriate implant – host tissue interaction. Biomaterials obtained from the same chemical compounds, but modified by a method other than sol-gel, exhibited lower bioactive properties in comparison [19]. The chemicals which create the sol layer are usually metal alkoxides. Further steps in coating manufacturing include hydrolysis and polycondensation reactions. During this process,–OH groups are formed, which allow the creation of new bonds and results in the final gel [20]. Sol-gel thin films are applied on substrates by dip – coating, spin – coating and spraying techniques [21]. Dip-coating is performed by the immersion of the substrate with constant speed and controlled time in the solution and allows a homogeneous coating of a definite thickness [22] to be obtained. The great advantage of sol – gel coating is the ability to modify the sol solution with certain materials and chemical compounds, thereby controlling the film properties. In recent years, modification of scaffold surfaces with hydroxyapatite has been proven to improve its osteoinductive properties [23,24]. Our previous studies have shown the beneficial impact of SiO2 films functionalized with vitamin E on the proliferative potential of human adipose – derived mesenchymal stem cells (AMSCs) [25]. One of benefits of vitamin E is the reduction of oxidative stress, which may elicit cell injury and death [26]. Another group of natural antioxidants are polyphenols [27]. One of them – resveratrol, found mostly in berries, nuts and grapes was widely described as an anti-inflammatory, antioxidative and anti-aging agent [28,29,30].

Currently, adipose-derived mesenchymal stem cells (ASC), become a major source of cells in tissue engineering and cell based therapies. Those cells can be easily isolated from abundant and accessible pools of adipose tissue with non-invasive and cost-effective procedures. Numerous advantages including differentiation into multiple lineages, secretion of various cytokines and immunomodulatory effects make ASC a promising tool for regeneration of tissues and organs damaged by injuries or diseases. However, it must be considered that ASC undergoes senescence both, in vivo and in vitro [31,32,33]. Biological aging of the organism is a complex, not yet fully understood process, associated with functional decline, impaired homeostasis and reduced capacity of tissues to regenerate. Those unfavorable changes exert effects on tissue-resident stem cells including decline in their number and flawed functionality [34]. Numerous studies have addressed questions relating to stem cell rejuvenation, senescence and their protection from injuries [35,36,37,38]. Our own studies have shown that aging negatively affects ASC properties, leading to increased apoptosis, decreased proliferation and reduced differentiation potential [31]. The main reason of ASC deterioration is excessive accumulation of reactive oxygen species and mitochondria impairment [39,40,41]. Thus, when considering application of ASC from older patients with biomaterials for the tissue engineering, application of chemicals able to diminish reactive oxygen species (ROS) levels in cells seems to be fully justifiable. Our previous research indicated on protective characteristics of sol-gel derived silica coating doped with vitamin E on ASC physiological condition. Fabricated scaffold alleviated apoptosis and ROS accumulation and increased cell proliferation. Thus enrichment of biomaterials with antioxidants results in multiple beneficial effects and may become a novel strategy in implant manufacturing for tissue engineering in geriatrics.

Following our previous data, in the present study we decided to fabricate a scaffold enriched with well and widely studied antioxidant-resveratrol (RES) for aged ASC culturing. RES has been shown to exhibit anti-aging, antioxidant, antiangiogenic anticancer, cardio-protective and antioxidative effects. Moreover, recent studies have indicated its effective application in treating diabetes, neurodegenerative and metabolic disorders [42,43].

In this paper we describe titanium substrate modification with ZrO2/SiO2 coating functionalized with RES using sol – gel, dip-coating technique. We have investigated the relation between different surface properties with viability and proliferation of human ASCs of elderly patients. In addition, we have shown fabricated scaffold reduced accumulation of ROS in investigated cells.

2 Materials and methods

All reagents used were purchased from Sigma Aldrich, unless indicated otherwise.

2.1 Substrates

Titanium discs (Ø = 13mm) were used as a coating substrate. Before sol-gel synthesis, metallic substrates were cleaned with detergent, alcohol and distilled water by ultrasonic cleaning.

2.2 Synthesis of sol-gel

For the ZrO2/SiO2 sol preparation, the following compounds were used: zirconium (IV) isopropoxide (ZrOP, Sigma Aldrich, USA) as the zirconia precursor, tetraethyl orthosilicate (TEOS, Sigma Aldrich, USA) as thesilica precursor, n-propanol (PrOH, Sigma Aldrich, USA) as a solvent and hydrochloric acid (HCl, POCh S.A., Poland) as an acid catalyst. Two different concentrations of resveratrol (C14H12O3, Alfa Aesar, Germany) were used as a volume modification of sol. The resulting sol was obtained by magnetic stirring at a speed of 500 r/min for 2,5 hours at room temperature. Before the deposition onto the titanium discs, the sol was allowed to age for 4 hours.

2.3 Dip – coating method

The sol-gel thin layers were deposited on the titanium substrates by dip-coater (WPTL6 – 0.01, MTI Corporation, USA) with controlled dipping speed (v = 34.26 mm/min). The immersion time adopted were as follows; first layer: 60 s, second layer: 30 s and third layer: 15 s. The first and second deposited layers were clear ZrO2/SiO2 sol-gels, while the third layers were different for each group of samples: clear ZrO2/SiO2 film, ZrO2/SiO2 functionalized by 0.1 μmol/mL resveratrol film and ZrO2/SiO2 functionalized by 0.5 μmol/mL resveratrol film. Between each layer deposition, samples were dried in room temperature for 24 hours. The resulting sol-gel films were obtained by stabilization for 12 hours at 250°C in air atmosphere. The samples for the in vitro test were closed in sterilization pouches (Safeseal® Duet, Medicom, Canada) and sterilized by thermal sterilization for 23 minutes at 121°C.

2.4 Surface morphology and topography

The surface morphology of sol-gel layers obtained was carried out by scanning electron microscopy (SEM, EVO LS15, Zeiss, Germany). Before the examination each sample was coated with a thin layer of gold by vacuum sputter (ScanCoat Six, Edward, Poland). Topographical analysis was performed by atomic force microscope (Dimension FastScan™)AFM, Bruker, USA) with PeakForce QNM mode. All measurements were performed by SCM PIT probe (f: 75 KHz, k: 2.8 N/m, length: 225 μm) and SCANASYT AIR probe (f: 750 kHz, k: 0.4 N/m, length: 115 μm).

2.5 Surface wettability properties

The wettability of the surfaces was evaluated by measuring the contact angle and surface free energy (SFE). The contact angle measurement was carried out by goniometer (OCA 35, DataPhysics Instruments GmbH, Germany) using distilled water, glycerin and diiodomethane. Each liquid was placed on the surface three times in three different places of each sample. The volume of each drop was 5 µL. The van Oss-Good method was used to calculate the surface free energy.

2.6 Isolation of human-adipose derived mesenchymal stem cells (huASC) and cell culture

Human adipose-derived mesenchymal stem cells were isolated under sterile conditions following the previously described protocol by Grzesiak et al. [21]. The fragment of human adipose tissue was placed in Hank’s balanced salt solution (HBSS, Sigma – Aldrich, Poland), supplemented with 1% antibiotics (P/S/A; penicillin/streptomycin/amphotericin B) and washed. Tissue samples were cut into small pieces and digested with 1 mg/ml collagenase type I for 40 minutes at 37°C. A cell pellet was suspended in the culture medium and plated onto culture flasks. The culture medium consisted of Dulbecco’s Modified Eagle’s Medium (DMEM, Sigma – Aldrich, Poland) with nutrient F-12 Ham, 10% of Fetal Bovine Serum (FBS) and 1% solution of P/S/A. The medium was changed every two days. Passage was performed after the cells reached 80% confluence using trypsin solution (TrypLE, Life Technologies, Denmark) in accordance with the manufacturer’s protocol.

2.7 Immunophenotyping and multipotency assay

To characterize huASC, analysis of the cell surface antigens were performed. The following antigens were investigated: CD29, CD34, CD44, CD45, CD73, CD90 and CD105.. To perform flow cytometry analysis, cells were incubated with the appropriate antibodies (at 4°C for 15 minutes) conjugated with phycoerythrin (PE), fluorescein isothiocyanate (FITC), allophycocyanin (AP) and peridinin-chlorophyll-protein (PerPC). At least ten thousand cells were scored and analyzed using Becton Dickinson FACs Calibur flow cytometer.

For chondrogenic, osteogenic, and adipogenic differentiation, huASCs were cultured in commercially available media (StemPro®, Life Technologies, Denmark) onto 24-well plates at concentration of 30 × 103 cells per well. The media was changed every three days. Chondrogenic and osteogenic stimulation was conducted for 16 days, whereas adipogenic differentiation lasted 14 days. Cells in control medium (10% FBS, 1% P/S/A, Dulbecco’s Modified Eagle’s Medium (DMEM) with nutrient F-12 Ham served as control to establish the effectiveness of differentiation. Prior to staining, cells were fixed with 4% paraformaldehyde (PFA).To visualize chondrogenic differentiation, specimens were stained with 0.1% solution of SafraninO (specific for proteoglycans). Osteogenic differentiation was proved by staining for extracellular mineralized matrix with Alizarin Red. Lipid droplets formed during adipogenesis were stained with Oil Red O. Photographs were acquired using a PowerShot Camera (Cannon, Germany) and an inverted fluorescence microscope (AxioObserverA1, Carl Zeiss, Jena, Germany).

2.8 Proliferation rate

The proliferation rate of cells was established using resazurin-based assay (Alamar blue) in accordance to manufacturer’s instructions. Prior the experiment, cells were seeded in 24-well plate onto the synthesized materials at a concentration of 2 × 104 per well. Tests were performed after 24, 48 and 120 hours of culture. To perform the assay, the culture medium was replaced with a medium containing 10% resazurin dye, following 2 hours incubation at 37°C. Next, absorbance levels of the supernatants were determined using spectrometer (BMG Labtech, Germany) at wavelengths 600 nm for resazurin and 690 nm as a background absorbance. The number of cells was established based on the growth curve generated during the experiment. In order to prepare the standard curve, cells were seeded at the density of 1×104, 3×104 and 5×104 and absorbance levels were assigned to certain cell number. A linear trend line equation allowed for the estimation of cell numbers at various time intervals throughout the experiment. PDT calculation online software was used to calculate the population doubling time (PDT) [22]. The proliferation factor (PF) of cells reflects the metabolic activity of cells cultured on resveratrol-doped biomaterials in relation to pure ZrO2/SiO2 scaffold with an arbitrary value equaled 1.

Staining for Ki67 was performed using anti-Ki67 antibodies (dilution 1:500, anti-Ki67 antibody produced in rabbit, Abcam). Additionally, ratio of Ki67 positive cells to all nuclei stained with DAPI was estimated based on representative images. All the procedures were performed following manufacturers’ protocols.

2.9 Visualization of cells morphology

Prior fluorescence stainings samples were washed with HBSS and fixed with 4% PFA. Then cells were permeabilized for 15 minutes with 0,1% Triton X-100 at room temperature and washed again. with. Atto-520-labeled phalloidin (1:1000 in HBSS) was used to visualize actin filaments. The cells nuclei were counterstained for5 minutes at room temperature in the dark with diamidino-2-phenylindole (DAPI, 1:1000 in HBSS). Using the ImageJ software, the area covered by cells was calculated. Mitochondria were stained using Mito Red dye, while visualization of the endoplasmic reticulum was carried out using ER Tracker (Life Technologies) (1:500 in culture medium, 30 min, 37°C).All the procedures were performed in accordance with the manufacturer’s protocol.

2.10 Oxidative stress factors and senescence analysis

Oxidative stress factors levels were assessed after 24, 48 and 120 hours of culture. Nitric oxide concentration was established using Griess Reagent Kit (BioVision, USA). Superoxide dismutase (SOD) was assessed using a SOD Assay Kit (Life Technologies). Reactive forms of oxygen (ROS) was measured with H2DCF-DA assay (Life Technologies). The number of alive and dead cells was evaluated using the Cell stain Double Staining Kit. Viable cells were stained green with Calcein A.M. while the dead cells were stained orange with propidium iodide. Senescence-associated β-galactosidase accumulation was visualized using Senescence Cells Histochemical Staining Kit. All the procedures were performed in accordance with the manufacturer’s protocol.

2.11 Real-Time Reverse Transcription Polymerase Chain Reaction (qRT-PCR): gene expression analysis

After the fifth day of the experiment cells were collected with trypsin and homogenized using TriReagent. Total RNA was isolated using the phenol-chloroform method as previously described by Chomczynski and Sacchi [23]. Isolated RNAs were suspended in DEPC-treated water and analysed using a nanospectrometer (WPA Biowave II). The reverse transcriptase Tetro cDNA Synthesis Kit (Bioline, United Kingdom) was used for the synthesis of complementary DNA (cDNA). For each reaction 150 ng of total RNA was used. Enzymatic digestion of Total RNA and cDNA synthesis were performed in accordance with the manufacturers’ protocols using a T100 Thermal Cycler (Bio-Rad). The qRT-PCR reactions were performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad, USA) as described elsewhere [44]. The reaction mixture contained 2 μL of cDNA in a total volume of 20 μL and was conducted using SensiFast SYBR & Fluorescein Kit (Bioline, United Kingdom). Primer concentration in each reaction equaled 500 nM. All primer sequences used in individual reactions are shown in Table 1. Relative gene expression analysis (Qn) was calculated in relation to the GAPDH housekeeping gene. Following genes were analyzed: p21, p53, Bax, Bcl-2, c-Myc, cyclin D1, MNF1, Fis1, Sirt1, FOXO1, TERT, IL1-β, TNFα, IL6, IL13 and IL4. Ethical approval: The conducted research is not related to either human or animals use.

Table 1

Sequence of primers used in qRT-PCR.

GenePrimerSequence5’-3’Accesion no.
Cyclin-D1F:GATGCCAACCTCCTCAACGANM_053056.2
R:GGAAGCGGTCCAGGTAGTTC
c-MycF:CTTCTCTCCGTCCTCGGATTCTNM_002467.4
R:GAAGGTGATCCAGACTCTGACCTT
p21F:GGCAGACCAGCATGACAGATTTCNM_001291549.1
R:CGGATTAGGGCTTCCTCTTGG
p53F:AGTCACAGCACATGACGGAGGNM_001126118.1
R:GGAGTCTTCCAGTGTGATGATGG
BAXF:ACCAAGAAGCTGAGCGAGTGTCXM_011527191.1
R:ACAAAGATGGTCACGGTCTGCC
Bcl-2F:ATCGCCCTGTGGATGACTGAGNM_000633.2
R:CAGCCAGGAGAAATCAAACAGAGG
Mnf1F:GTTGCCGGGTGATAGTTGGAXM_005247596.2
R:TGCCACCTTCATGTGTCTCC
Fis1F:TGGTGCGGAGCAAGTACAATNM_016068.2
R:TGCCCACGAGTCCATCTTTC
SIRT1F:ACAGGTTGCGGGAATCCAAANM_001314049.1
R:GTTCATCAGCTGGGCACCTA
FOXO1F:CTCTGGCCCCTTTCACCATAXM_011535010.1
R:GCTTTCTTCTTGGCAGCTCG
TERTF:CGGAAGAGTGTCTGGAGCAAXM_011514106.1
R:GGATGAAGCGGAGTCTGGA
IL1-βF:AAACAGATGAAGTGCTCCTTCCAGGXM_006712496.1
R:TGGAGAACACCACTTGTTGCTCCA
TNFαF:AGTGACAAGCCTGTAGCCCANM_000594.3
R:GTCTGGTAGGAGACGGCGAT
IL6F:GAACTCCTTCTCCACAAGCGCCTTNM_000600.4
R:CAAAAGACCAGTGATGATTTTCACCAGG
IL13F:GCAATGGCAGCATGGTATGGNM_002188.2
R:AAGGAATTTTACCCCTCCCTAACC
IL4F:ACATTGTCACTGCAAATCGACACCNM_000589.3
R:TGTCTGTTACGGTCAACTCGGTGC

3 Results

3.1 Surface morphology, topography and wettability

SEM – EDX analysis revealed that ZrO2/SiO2 coatings on titanium substrates prepared by dip – coating method are transparent and homogeneous (Figure 1a). Element mapping confirmed presence of both, zirconium and silicon (Figure 1b - 1d). Moreover, dispersion of Zr and Si was homogenous, which indicates that this technique of producing sol – gel thin films is suitable for biomaterials manufacturing. AFM analysis showed that surface topography differs between the investigated materials (Figure 2). The results indicated that with increasing concentration of resveratrol roughness of the surface reduces, differences were observed in nanometers. Not without significance is initial roughness of titanium substrate, which directly affects the roughness of final biomaterials.

Figure 1 SEM images of the zirconium/silica coating (a) and EDX maps of the zirconium and silicon atoms distributions (b), silicon atoms distribution (c), zirconium atoms distribution (d).
Figure 1

SEM images of the zirconium/silica coating (a) and EDX maps of the zirconium and silicon atoms distributions (b), silicon atoms distribution (c), zirconium atoms distribution (d).

Figure 2 The images of surface topography in Atomic Force Microscope of titanium substrate (a), zirconia/silica coating (b), zirconia/silica coating modified by 0.1 µl/mL resveratrol (c) and by 0.5 µl/mL resveratrol.
Figure 2

The images of surface topography in Atomic Force Microscope of titanium substrate (a), zirconia/silica coating (b), zirconia/silica coating modified by 0.1 µl/mL resveratrol (c) and by 0.5 µl/mL resveratrol.

3.2 Surface wettability properties

The results of water contact angle (Table 2) showed that titanium exhibits hydrophobic properties (98 ± 3°). Based on the analysis of contact angle it can also be stated that the properties of each sol – gel layers are hydrophilic (ZrO2/SiO2: 37 ± 1°, 0,1res_ZrO2/SiO2: 30 ± 1°, 0,5res_ZrO2/SiO2: 31 ± 2°), which is confirmed by SFE results (ZrO2/SiO2: 94 ± 5 mJ/m2, 0,1res_ZrO2/SiO2: 98 ± 3 mJ/m2, 0,5res_ZrO2/SiO2: 98 ± 4 mJ/m2). The acid – base part of the SFE is higher than the dispersive part, which demonstrates the possibility of forming hydrogen bonds and shows less influence of long – range interactions on the hydrophilic properties of the tested coatings.

Table 2

Wettability properties of substrate and synthesized coatings.

θ[°]SFE[mJ/mA2]γAB[ mJ/mA2]γd[ mJ/mA2]
Titanium98 ± 335 ± 433 ± 32 ± 1
ZrO2/SiO237 ± 194 ± 537 ± 157 ± 4
0.1res_ZrO2/SiO230 ± 198 ± 336 ± 162 ± 2
0.5res_ZrO2/SiO231 ± 298 ± 439 ± 159 ± 3

3.3 Immunophenotyping, differentiation and morphology of the investigated human AMSCs cultured on different biomaterials

Using the flow cytometry the expression of the following markers was confirmed: CD34, CD73, CD90 and CD105. Simultaneously, cells lacked the expression of CD45 surface antigen (Figure 3a). In addition multi-lineage differentiation of huASC was confirmed (Figure 3b). Using Alizarin Red, Safranin and Oil Red O, differentiation into osteogenic, chondrogenic and adipogenic lineage respectively, was confirmed.

Figure 3 Multipotency assay of ASC. Adipogenesis was confirmed by the presence of intracellular lipid droplets using Oil Red O staining . Chondrogenic differentiation were visualized by staining proteoglycans with safranin O and Alizarin Red staining was performed to confirm osteogenesis by the presence extracellular mineralized matrix (a). Flow cytometry dot plots showing surface antigens expression by ASC (b). ASCs were characterized by the expression of CD 44, CD 73, CD 90, CD 105 while lacked the expression of CD 34 and CD 45surface marker. Magnification: x100. Scale bar 200 μm.
Figure 3

Multipotency assay of ASC. Adipogenesis was confirmed by the presence of intracellular lipid droplets using Oil Red O staining . Chondrogenic differentiation were visualized by staining proteoglycans with safranin O and Alizarin Red staining was performed to confirm osteogenesis by the presence extracellular mineralized matrix (a). Flow cytometry dot plots showing surface antigens expression by ASC (b). ASCs were characterized by the expression of CD 44, CD 73, CD 90, CD 105 while lacked the expression of CD 34 and CD 45surface marker. Magnification: x100. Scale bar 200 μm.

3.4 HuASC growth kinetics on tested biomaterials

During the 5-day experiment, the cell proliferation rate on tested biomaterials with or without resveratrol was assessed. On the initial day of the experiment the 3 × 104cells/well were seeded onto scaffolds. According to the growth curve (Figure 4a) after 24 hours, the highest number of cells was observed on 0.5 Res_ZrO2/SiO2 material. Scaffold without resveratrol (ZrO2/SiO2) significantly reduced cell growth, which indicates the positive effects of resveratrol on cell proliferation. After 48 hours a decrease in cell number was noted in each group. Both groups with resveratrol showed a similar cell number, with a slight advantage of the 0.5 Res_ZrO2/SiO2 compared to 0.1 Res_ ZrO2/SiO2. After 120 hours, increase in cell proliferation was observed, except 0.1 Res_ZrO2/SiO2 The greatest number of cells was observed in the group with 0.5 μmol/mL resveratrol. Moreover, population doubling time analysis was performed (PDT, Figure 4b). The shortest PDT was observed in cells cultured on 0.5 Res_ZrO2/SiO2 (p <0.001) in comparison to control group (ZrO2/SiO2). These results stand in good agreement with proliferation factor (Figure 4c). In each time point, PF in 0.5 Res_ZrO2/SiO2 group was higher than 1, which indicates an increased proliferation rate. 0.1 Res_ZrO2/SiO2 also demonstrated increased proliferation during the whole experiment, although the level was lower than in 0.5 Res_ZrO2/SiO2 Based on the selected images the area covered by cells was calculated (Figure 4d). Using qRT-PCR we also evaluated the mRNA levels of cell cycle genes cyclin D1 (Figure 4e) and c-Myc (Figure 4f). Both proteins showed higher expression in cells cultured on biomaterials doped with resveratrol-Cyclin D1 for 0.5 Res_ZrO2/SiO2 (p<0.005) and 0.1 Res_ZrO2/SiO2 (p<0.01). c-Myc for 0.5 Res_ZrO2/SiO2 and 0.1 Res_ZrO2/SiO2 (p<0.05). Immunofluorescent staining with anti-Ki67 antibodies confirmed up-regulation of proliferation in 0.1 Res_ZrO2/SiO2 and 0.5 Res_ZrO2/SiO2 (Figure 4g-h).

Figure 4 Growth kinetics of ASCs cultured on different sol/gel coatings. Growth curve of ASCs calculated during 5 days (a). Population Doubling Time (b) and Proliferation factor for each coating (c). Area covered by cells calculated from photographs obtained during the experiment (d). The expression levels of Cyclin D1 (e) and c-Myc (f) involved in cell cycle regulation. Ki67-DAPI staining of cultures (g) staining quantification (h). White arrows indicate the signal from the Ki67. Magnification: x100. Results expressed as mean ± SD *pvalue<0.05,. **pvalue<0.01, ***pvalue<0.001.
Figure 4

Growth kinetics of ASCs cultured on different sol/gel coatings. Growth curve of ASCs calculated during 5 days (a). Population Doubling Time (b) and Proliferation factor for each coating (c). Area covered by cells calculated from photographs obtained during the experiment (d). The expression levels of Cyclin D1 (e) and c-Myc (f) involved in cell cycle regulation. Ki67-DAPI staining of cultures (g) staining quantification (h). White arrows indicate the signal from the Ki67. Magnification: x100. Results expressed as mean ± SD *pvalue<0.05,. **pvalue<0.01, ***pvalue<0.001.

3.5 Oxidative stress factor and senescence analysis

The morphology of the cells in the culture was visualized using phalloidin and DAPI stainings (Figure 5a). In the ZrO2/SiO2 group, robust number of enlarged nuclei was observed. Moreover, the “fried egg” shape, polygonal cells were noted. The common characteristic of cells cultured onto each of the investigated materials was centrally placed nuclei. Analysis of the Calcein-AM and propidium iodine stainings (Figure 5a,b) revealed that resveratrol doped biomaterials inhibited apoptosis in huASC. An increased number of dead cells were observed in ZrO2/SiO2 group The highest number of viable cells was observed in 0.5 μmol /mL resveratrol scaffold. BAX/Bcl-2 (Figure 5c) and p21/p53 (Figure 5d) ratio was downregulated in 0.5 Res_ZrO2/SiO2, although with no statistical significance. Staining for mitochondria and ER revealed the highest fluorescent intensity in 0.5 Res_ZrO2/SiO2 which may indicate an increased metabolic activity of those organelles (Figure 6a). In addition, 0.5 Res_ZrO2/SiO2 exhibited significantly decreased expression of genes involved in mitochondrial stress like Mnf1 and Fis1 (Figure 6b-c). There were no differences in the expression of CHOP (Figure 6d) and PERK (Figure 6e) between resveratrol doped scaffolds although mRNA of those genes were upregulated in pure ZrO2/SiO2 material.

Figure 5 Morphology of ASCs evaluated with DAPI and Phalloidin (a) - two columns from the left. Additionally Calcein-AM staining indicates live cells while propidium iodide staining signalizes dead cells (a) - two columns from the right. Arrows indicate dead cells upon penetration of propidium iodide. Quantification of Clalcein-AM-Propidium iodide staining established with ImageJ software (b). The mRNA ratio of BAX/Bcl-2 (c) and p21/p53 (d) were evaluated in relation to mRNA level of housekeeping gen GAPDH. Magnification: x100. Results expressed as mean ± SD. **pvalue<0.01. Scale bar 250 μm.
Figure 5

Morphology of ASCs evaluated with DAPI and Phalloidin (a) - two columns from the left. Additionally Calcein-AM staining indicates live cells while propidium iodide staining signalizes dead cells (a) - two columns from the right. Arrows indicate dead cells upon penetration of propidium iodide. Quantification of Clalcein-AM-Propidium iodide staining established with ImageJ software (b). The mRNA ratio of BAX/Bcl-2 (c) and p21/p53 (d) were evaluated in relation to mRNA level of housekeeping gen GAPDH. Magnification: x100. Results expressed as mean ± SD. **pvalue<0.01. Scale bar 250 μm.

Figure 6 Morphology of mitochondria and endoplasmic reticulum of ASCs estimated with DAPI/MitoRed and DAPI/ER staining (a). Arrows indicate mitochondria of cells cultured on different sol/gel coatings. Expression levels of the Mnf1 (c) and Fis1 (d) genes in order to assess the balance between fission and fusion which regulates the mitochondrial dynamics. Moreover, CHOP (d) and PERK (e) mRNA levels were estimated in order to examine the condition of endoplasmic reticulum. Magnification: x100. Scale bar 250 µm. Results expressed as mean ± SD *pvalue<0.05,. **pvalue<0.01, ***pvalue<0.001.
Figure 6

Morphology of mitochondria and endoplasmic reticulum of ASCs estimated with DAPI/MitoRed and DAPI/ER staining (a). Arrows indicate mitochondria of cells cultured on different sol/gel coatings. Expression levels of the Mnf1 (c) and Fis1 (d) genes in order to assess the balance between fission and fusion which regulates the mitochondrial dynamics. Moreover, CHOP (d) and PERK (e) mRNA levels were estimated in order to examine the condition of endoplasmic reticulum. Magnification: x100. Scale bar 250 µm. Results expressed as mean ± SD *pvalue<0.05,. **pvalue<0.01, ***pvalue<0.001.

The amount of reactive oxygen species (Figure 7a), was significantly decreased in scaffolds doped with resveratrol in comparison to pure titanium disc. Cells propagated onto materials with resveratrol displayed similar ROS levels after 24 hours (p < 0.05) and 120 hours (p <0.001). The lowest amount of ROS (p <0.001) was observed in 0.5 Res_ZrO2/SiO2 after 48 hours of culture. The amount of nitric oxide was decreased in huASC cultured on resveratrol doped scaffolds only after 120 hours of culture (Figure 7b). Additionally the level of superoxide dismutase was examined (Figure 7c). During the experiment, the highest expression of SOD was observed in 0.5 Res_ZrO2/SiO2.

Figure 7 Analysis of the oxidative stress factors in ASCs: the levels of reactive oxygen species (a), amount of nitirc oxide (b) and activity of superoxide dismutase (c). Results expressed as mean ± SD *pvalue<0.05,. **pvalue<0.01, ***pvalue<0.001
Figure 7

Analysis of the oxidative stress factors in ASCs: the levels of reactive oxygen species (a), amount of nitirc oxide (b) and activity of superoxide dismutase (c). Results expressed as mean ± SD *pvalue<0.05,. **pvalue<0.01, ***pvalue<0.001

The accumulation of senescence associated beta-galactosidase was diminished in huASC cultured on resveratrol doped scaffolds (Figure 8a,b). Obtained data indicates that cells cultured on 0.5 Res_ZrO2/SiO2 accumulated the lowest amount of beta-galactosidase in comparison to other groups (Figure 8a,b). Analysis of SIRT 1 (Figure 8c) and the FOXO 1 (Figure 8d) gene expression was performed using real time PCR. The highest expression of both, SIRT1 and FOXO1 was observed in 0.1 Res_ZrO2/SiO2 On the other hand, TERT (Figure 8e) mRNA was up regulated in 0.5 Res_ZrO2/SiO2.

Figure 8 Quantification of beta-galactosidase staining performed at wavelength of 450 nm (a) and pictures took under brightfield microscope showing the accumulation of blue dye (b). Expression levels of the SIRT 1 (c), FOXO 1 (d) and TERT genes (e) in order to assess aging of cells. Magnification: x100. Results expressed as mean ± SD *pvalue<0.05,. **pvalue<0.01, ***pvalue<0.001. Scale bar 200 μm
Figure 8

Quantification of beta-galactosidase staining performed at wavelength of 450 nm (a) and pictures took under brightfield microscope showing the accumulation of blue dye (b). Expression levels of the SIRT 1 (c), FOXO 1 (d) and TERT genes (e) in order to assess aging of cells. Magnification: x100. Results expressed as mean ± SD *pvalue<0.05,. **pvalue<0.01, ***pvalue<0.001. Scale bar 200 μm

Furthermore, we analyzed the expression of pro and anti-inflammatory cytokines. No differences were observed in the expression of IL-1β (Figure 9a), while IL-6 was significantly downregulated in both resveratrol groups (Figure 9b). Additionally, no statistical significance was observed in the expression of TGF-β (Figure 9c). Moreover, 0,5res_ZrO2/SiO2 showed increase transcript level of antiinflammatory cytokines IL-13 (Figure 9d). On the other hand, increased expression of IL-4 (Figure 9d) was noted in huASC cultured on 0.1res_ZrO2/SiO2 in comparison to other groups.

Figure 9 Expression level of the ILl-β (a), IL6 (b) and TNF-α (c) genes in order to assess the level of proinflammatory cytokines. Moreover, expression level of the IL13 (a) and IL4 (c) genes was performed to assess the level of anti-inflammatory cytokines. Results expressed as mean ± SD *pvalue<0.05,. ***pvalue<0.001.
Figure 9

Expression level of the ILl-β (a), IL6 (b) and TNF-α (c) genes in order to assess the level of proinflammatory cytokines. Moreover, expression level of the IL13 (a) and IL4 (c) genes was performed to assess the level of anti-inflammatory cytokines. Results expressed as mean ± SD *pvalue<0.05,. ***pvalue<0.001.

4 Discussion

Metallic materials are still the most common scaffolds used in orthopaedics and dental medicine. Improvement of material bioactive properties may be achieved via processing such as surface modification to enhance cell response and simultaneously increase materials biocompatibility. Thus, the creation of novel, smart scaffolds becomes a major challenge in the fields of cell biology, chemistry and materials science. The modern biomaterials for regenerative medicine must take advantage of different chemical substances, which are able to influence cytophysiological properties and direct the fate of cells. Bioactive substances may be deposited onto biomaterial surfaces and released in the controlled manner for better tissue rebuilding and regeneration Recent studies, including our own, have shown that the sol-gel method is a relatively easy and non-expensive way for deposition of substances onto the surface of metallic scaffolds. In the present study, we have shown that a ZrO2/SiO2 coating might be used as a carrier for resveratrol (RES). SEM photographs indicated that sol-gel layers are smooth without any cracks with uniform zirconium and silica distribution. The wettability of the material surface is mainly affected by the surface chemical functionality and topology. Wettability exerts significant effects on stem cells behaviour including proliferation rate. Study performed by Shin et al. revealed the highest number of adhered bone-marrow stem cells on a surface with intermediate wettability (57°-65°), while for the highest contact angle (97°) the cell number was decreased [45]. In Ruardy et al. [46], it was shown that the spread area of human fibroblasts increased with wettability. Similarly, Altankov et al. [47] demonstrated increased cell proliferation with increasing material surface wettability. In our study, ZrO2/SiO2 coating significantly increased the wettability of pure titanium alloy and further functionalization of ZrO2/SiO2 coating with resveratrol increased wettability even more. That fact may partially explain increased proliferation of cells cultured onto RES-doped scaffolds.

Moreover, it is now a well established fact, that rougher biomaterial surfaces, increases cell attachment and proliferation, likely due to availability of the medium and serum ingredients through the grooves underneath adhered cells [48]. Our data from AFM, indicates an increased roughness of RES doped scaffolds as the surface of these biomaterials is formed of grooves and ridges. It is even more important as collagen synthesis, extracellular matrix, cytokines, growth factors secretion are enhanced by rough surface [49,50]. Moreover, in vitro studies indicated a positive correlation between surface roughness and cell proliferation [51]. Those findings stand in good agreement with our data as we observed increased cellular growth onto RES-doped scaffold, thus corroborating the data of Anselme et al. [52] and Keller et al. [53] who suggested that a high degree of microroughness increases initial cell response of adhesion and proliferation.

Due to their unique characteristics, including selfrenewal and multipotency, mesenchymal stem cells have become a major tool in regenerative medicine and biomaterial science [7,8,54]. However, during aging MSC lose their stemness and ability to differentiate [31,32,40], which in consequence limits their therapeutic application. Aging is a complex, yet not fully understood process, although it is believed to be driven by genetic, epigenetic and environmental factors. During aging, the amount of reactive oxygen species (ROS) in cells increases, altering their cytophysiological characteristics and deteriorating mitochondrial functions. Simultaneously with ROS accumulation, the antioxidative defence of the organism diminishes, resulting in prevalent cellular damage, apoptosis and inflammation. Since in regenerative medicine, autologous transplant are still the most common, we decided to fabricate a novel scaffold for geriatrics, which aims to decrease oxidative stress of aged stem cells and in consequence increased tissue regeneration in vivo. For this purpose we isolated ASC from aged patients and cultured them onto scaffolds doped with RES, a substance proved for its antioxidative, anti-inflammatory, anti-aging and osteogenic properties [55,56,57,58].

The study performed by Lei et al. [59], revealed that RES protected bone marrow MSC derived chondrocytes cultured on chitosan-gelatin scaffolds from the inhibitory effect of interleukin-Mi1beta. Thus application of RES as a bioactive substance onto scaffolds for bone regeneration seems to be fully justified, because of pro-inflammatory microenvironment of damage tissue site. Further, more RES was proven to enhance osteogenesis of human MSC by upregulating RUNX2 gene expression via the SIRT1/FOXO3A axis [60]. Those findings correlate with our data, as we observed increased expression of both SIRT1 and FOXO genes in cells cultured on scaffolds doped with RES.

In the present study, we have found that cells cultured onto RES-doped materials displayed increased proliferation rate, enhanced expression of cell cycle progression related genes (cyclin D1, c-Myc), increased accumulation of Ki67 and expression of TERT. Our data correlates with Yoon et al. [61] who established that sustained treatment with resveratrol at early passages maintained the self-renewal potential and multipotency of MSCs up to passage 10. Moreover, cells cultured on RES scaffolds presented diminished apoptosis and senescence, these phenomenon was also observed by Peltz et al. [62], who observed that, resveratrol promotes cell selfrenewal by inhibiting cellular senescence and suppresses adipogenic differentiation during short-term exposure.

Extracellular vesicles (EVs) are circular fragments of membrane which play a pivotal role in cell to cell communication. These vesicles are enriched with growth factors, anti-apoptotic and anti-inflammatory factors, all crucial for the tissue regeneration [63]. Interestingly, the paracrine effects of mesenchymal stem cells weakened during aging. Although the study conducted by Lei et al. [64] reported that resveratrol has a protective effect on senescence ofASCs and can preserve the paracrine effect of the ASCs on promoting insulin secretion of INS-1 cells via Pim-1. Moreover, cells formed dense, multi-layered aggregates and cytoskeletal projections connecting neighbouring cells.

The endoplasmic reticulum (ER) is an elaborate membrane network, synthetizing and folding secreted and membrane bound proteins. Properly folded proteins are then directed to Golgi Apparatus while misfolded ones are targeted to degradation. Unfolded protein response (UPR) pathway prevents the accumulation of dysfunctional proteins and if necessary triggers apoptosis. Although, the mechanism underlying ER-induced apoptosis are not fully understood, the body of evidence suggests that both, ER and mitochondria cooperates together to induce cell death. Activation of UPR is mediated through PERK an ER-associated transmembrane serine/threonine protein kinase and its downstream transcriptional target CHOP. In our study we have observed that RES significantly decreased the expression of both, CHOP and PERK in ASC thus protected the ASCs against ER stress-related apoptosis.

It is well known fact that during aging ROS and NO accumulates in tissues and cells including ASC, causing mitochondrial damage. For instance, Smallwood et al [65] have found an age-related increase in NO synthesis in mouse MSC-derived macrophages after lipopolysaccharide treatment. Our own studies have also shown increased accumulation of oxidative stress by ASC isolated from elderly donors [31]. Moreover, our yet unpublished data indicates that age strongly influences ASC mitochondrial dynamic and metabolic status. Thus we decided to investigate whether RES-doped scaffold affect mitochondrial fission and fusion. Both of these processes play a crucial role in maintaining healthy mitochondria during metabolic or environmental stress. Fusion helps overcome stress by exchanging mitochondrial contents as a form of compensation while fission is needed to create new organelles and also act as an quality control mechanism allowing for damage mitochondria removal [66]. Interestingly, RES-doped scaffolds increased the expression of both, MNF-1 and FIS-1 in ASC but only in 0.1 RES ZrO2/SiO2 coating. In scaffold doped with 0.5 μM RES both of these genes were downregulated in comparison to pure ZrO2/SiO2 surface. This indicates that RES acts in very sensitive, dose and time dependent way on mitochondrial dynamics.

In the current research, we also investigated the amount of ROS, NO and activity of SOD in ASC cultured on ZrO2/SiO2 coated biomaterials. The data obtained clearly indicates that RES treated scaffolds significantly ameliorate the accumulation of ROS and improve the antioxidative properties of ASC. Eliminating oxidative stress may contribute to ASC rejuvenation and in consequence to their better therapeutic utility.

In addition to their differentiation potential, MSC exerts immunomodulatory properties to regulate immune response in the state of disease. For instance, MSC suppress T-cell proliferation, cytokine secretion and cytotoxicity, regulate Tregs functions and increase B-cell viability. The inflammatory environment was proven to affect immunomodulatory gene expression in MSCs or promote the cell–cell contact, resulting in increased immunosuppressive response. Thus MSC are able to modulate their effects to protect the body from disease in different situations [67]. On the other hand, RES inhibits immune cell proliferation, cell-mediated cytotoxicity, and cytokine production, at least in part through the inhibition of NF-kappaB activation [67]. Since cytokines play a pivotal role in the development of immune responses, we also investigated the effect of RES doped scaffolds on the production of IL-1 β, IL-6, TNF α, IL-13 and IL-4 by ASC. Cells cultured on RES-doped scaffold were characterized by increased expression of IL-6 and increased expression of anti-inflammatory IL-13 and IL-4. Thus combining ASC and RES results in a robust expression of anti-inflammatory cytokines which is especially important if application of scaffold for in vivo tissue regeneration is considered.

5 Conclusion

In the present study, we have investigated the influence of novel, RES doped scaffold on proliferation, apoptosis and oxidative stress of ASC isolated from elderly patients. Cells cultures on RES-biomaterials were characterized by increased proliferation, decreased apoptosis and ROS accumulation. Moreover, they secreted robust amount of anti-inflammatory cytokines. Thus exploitation of fabricated scaffold in regenerative medicine as a strategy for rejuvenate ASC from elderly patients in vivo, seems to fully justified.

  1. Conflict of interest: Authors declare there is no conflict of interest.

Acknowledgement

The research was supported by Wroclaw Research Centre EIT+under the project ‘Biotechnologies and advanced medical technologies’– BioMed (POIG.01.01.02-02-003/08) financed from the European Regional Development Fund (Operational Programmed Innovative Economy, 1.1.2.). Publication supported by Wrocław Centre of Biotechnology, programme the Leading National Research Centre (KNOW) for years 2014-2018. Material part of study including preparation of scaffold was supported by National Science Centre, Poland grant no.2015/19/B/ST5/01330. Research was supported by the project number B010/0011/17 at Wroclaw University of Environmental and Life Sciences.

References

[1] Bjorksten J., Tenhu H., The crosslinking theory of aging – Added evidence, Exp. Geronto., 1990, 25, 91–95.10.1016/0531-5565(90)90039-5Suche in Google Scholar

[2] Davidovic M., Sevo G., Svorcan P., Milosevic D. P., Despotovic N., Erceg P., Old age as a privilege of the “selfish ones.”, Aging Dis., 2010, 1, 139–146.Suche in Google Scholar

[3] Gheno R., Cepparo J. M., Rosca C. E., Cotten A., Musculoskeletal Disorders in the Elderly, J. Clin. Imaging Sci., 2012, 2.10.4103/2156-7514.99151Suche in Google Scholar PubMed PubMed Central

[4] Shrestha L. B., Population aging in developing countries, Health Aff. (Millwood), 2000, 19, 204–212.10.1377/hlthaff.19.3.204Suche in Google Scholar PubMed

[5] Cislo-Pakuluk A., Marycz K., A Promising Tool in Retina Regeneration: Current Perspectives and Challenges When Using Mesenchymal Progenitor Stem Cells in Veterinary and Human Ophthalmological Applications, Stem Cell Rev., 2017, 13, 598–602.10.1007/s12015-017-9750-4Suche in Google Scholar PubMed PubMed Central

[6] Marycz K., Michalak I., Kornicka K., Advanced nutritional and stem cells approaches to prevent equine metabolic syndrome, Res. Vet. Sci., 2018, 118, 115–125.10.1016/j.rvsc.2018.01.015Suche in Google Scholar PubMed

[7] Lindroos B., Suuronen R., Miettinen S., The potential of adipose stem cells in regenerative medicine, Stem Cell Rev., 2011, 7, 269–291.10.1007/s12015-010-9193-7Suche in Google Scholar PubMed

[8] Atala A., Regenerative medicine strategies, J. Pediatr. Surg., 2012, 47, 17–28.10.1016/j.jpedsurg.2011.10.013Suche in Google Scholar PubMed

[9] Mao A S., Mooney D J., Regenerative medicine: Current therapies and future directions, Proc. Natl. Acad. Sci. U. S. A., 2015, 112, 14452–14459.10.1073/pnas.1508520112Suche in Google Scholar PubMed PubMed Central

[10] Howard D., Buttery L. D., Shakesheff, K. M., Roberts S. J., Tissue engineering: strategies, stem cells and scaffolds, J. Anat.,2008, 213, 66–72.10.1111/j.1469-7580.2008.00878.xSuche in Google Scholar PubMed PubMed Central

[11] Chan B. P., Leong K. W., Scaffolding in tissue engineering: general approaches and tissue-specific considerations, Eur. Spine J., 2008, 17, 467–479.10.1007/s00586-008-0745-3Suche in Google Scholar PubMed PubMed Central

[12] Kornicka K., Nawrocka D., Lis-Bartos A., Marędziak M., Marycz K., Polyurethane–polylactide-based material doped with resveratrol decreases senescence and oxidative stress of adipose-derived mesenchymal stromal stem cell (ASCs), RSC Adv., 2017, 7, 24070–24084.10.1039/C7RA02334KSuche in Google Scholar

[13] Marycz K., Krzak J., Urbanski W., Pezowicz C., Marycz K., Krzak J., In Vitro and In Vivo Evaluation of Sol-Gel Derived TiO2 Coatings Based on a Variety of Precursors and Synthesis Conditions, J. Nanomater., 2014, 2014.10.1155/2014/350579Suche in Google Scholar

[14] Marycz K., Sobierajska P., Smieszek A., Maredziak M., Wiglusz K. Wiglusz R. J., Li(+) activated nanohydroxyapatite doped with Eu(3+) ions enhances proliferative activity and viability of human stem progenitor cells of adipose tissue and olfactory ensheathing cells. Further perspective of nHAP:Li(+), Eu(3+) application in theranostics, Mater. Sci. Eng. C Mater. Biol. Appl., 2017, 78, 151–162.10.1016/j.msec.2017.04.041Suche in Google Scholar

[15] Marycz K., Maredziak M., Grzesiak J., Lis A., Śmieszek A, Biphasic Polyurethane/Polylactide Sponges Doped with Nano-Hydroxyapatite (nHAp) Combined with Human Adipose-Derived Mesenchymal Stromal Stem Cells for Regenerative Medicine Applications, Polymers, 2016, 8, 339.10.3390/polym8100339Suche in Google Scholar

[16] Niinomi M., Metallic biomaterials, J. Artif. Organs Off. J. Jpn. Soc. Artif. Organs., 2008, 11, 105–110.10.1007/s10047-008-0422-7Suche in Google Scholar

[17] Pourbaix M., Electrochemical corrosion of metallic biomaterials. Biomaterials, 1984, 5, 122–134.10.1016/0142-9612(84)90046-2Suche in Google Scholar

[18] Kazek-Kęsik A., Krok-Borkowicz M., Dercz G., Donesz-Sikorska A., Pamuła E., Simka W., Multilayer coatings formed on titanium alloy surfaces by plasma electrolytic oxidation-electrophoretic deposition methods. Electrochimica Acta, 2016, 204, 294–306.10.1016/j.electacta.2016.02.193Suche in Google Scholar

[19] Catauro M., Papale F., Bollino F., Coatings of titanium substrates with xCaO.(1 – x)SiO2 sol–gel materials: characterization, bioactivity and biocompatibility evaluation. Mater. Sci. Eng. C., 2016, 58, 846–851.10.1016/j.msec.2015.09.033Suche in Google Scholar PubMed

[20] Catauro M., Papale F., Bollino F., Characterization and biological properties of TiO2/PCL hybrid layers prepared via sol–gel dip coating for surface modification of titanium implants, J. Non-Cryst. Solids, 2015, 415, 9–15.10.1016/j.jnoncrysol.2014.12.008Suche in Google Scholar

[21] Wang X., Shi F., Gao X., Fan C., Huang W., Feng X, A sol–gel dip/spin coating method to prepare titanium oxide films, Thin Solid Films, 2013, 548, 34–39.10.1016/j.tsf.2013.08.056Suche in Google Scholar

[22] Faustini M., Louis B., Albouy P. A., Kuemmel M., Grosso D., Preparation of Sol–Gel Films by Dip-Coating in Extreme Conditions, J. Phys. Chem. C., 2010, 114, 7637–7645.10.1021/jp9114755Suche in Google Scholar

[23] Harle J., Kim H.-W., Mordan N., Knowles J. C., Salih V., Initial responses of human osteoblasts to sol-gel modified titanium with hydroxyapatite and titania composition, Acta Biomater., 2006, 2, 547–556.10.1016/j.actbio.2006.05.005Suche in Google Scholar PubMed

[24] Sidane D., Chicot D., Yala S., Ziani S., Khireddine H., lost A., Decoopman X., Study of the mechanical behavior and corrosion resistance of hydroxyapatite sol–gel thin coatings on 316 L stainless steel pre-coated with titania film, Thin Solid Films, 2015, 593, 71–80.10.1016/j.tsf.2015.09.037Suche in Google Scholar

[25] Kornicka K., Babiarczuk B., Krzak J., Marycz K., The effect of a sol–gel derived silica coating doped with vitamin E on oxidative stress and senescence of human adipose-derived mesenchymal stem cells (AMSCs), RSC Adv., 2016, 6, 29524–29537.10.1039/C6RA00029KSuche in Google Scholar

[26] Rizvi S., Raza S. T., Ahmed F., Ahmad A., Abbas S., Mahdi F., The Role of Vitamin E in Human Health and Some Diseases, Sultan Qaboos Univ. Med. J., 2014, 14.Suche in Google Scholar

[27] Choi D.-Y., Lee Y.-J., Hong J. T., Lee H.-J., Antioxidant properties of natural polyphenols and their therapeutic potentials for Alzheimer’s disease, Brain Res. Bull., 2012, 87, 144–153.10.1016/j.brainresbull.2011.11.014Suche in Google Scholar PubMed

[28] Morselli E., Maiuri M. C., Markaki M., Megalou E., Pasparaki A., Palikaras K., Criollo A., Galluzzi L., Malik S. A., Vitale I., Michaud M., Madeo F., Tavernarakis N., Kroemer G., Caloric restriction and resveratrol promote longevity through the Sirtuin-1-dependent induction of autophagy, Cell Death Dis., 2010, 1, e10.10.1038/cddis.2009.8Suche in Google Scholar PubMed PubMed Central

[29] Baur J. A., Pearson K. J., Price N. L., Jamieson H. A., Lerin C., Kalra A., et al, Resveratrol improves health and survival of mice on a high-calorie diet, Nature, 2006, 444, 337–342.10.1038/nature05354Suche in Google Scholar PubMed PubMed Central

[30] Beher D., Wu J., Cumine, S., Kim K. W., Lu S.-C., Atangan L., Wang M, Resveratrol is not a direct activator of SIRT1 enzyme activity, Chem. Biol. Drug Des., 2009, 74, 619–624.10.1111/j.1747-0285.2009.00901.xSuche in Google Scholar PubMed

[31] Kornicka K., Marycz K., Tomaszewski K. A., Marędziak M., Śmieszek A, The Effect of Age on Osteogenic and Adipogenic Differentiation Potential of Human Adipose Derived Stromal Stem Cells (hASCs) and the Impact of Stress Factors in the Course of the Differentiation Process, Oxid. Med. Cell. Longev., 2015, 2015, 309169.10.1155/2015/309169Suche in Google Scholar PubMed PubMed Central

[32] Marędziak M., Marycz K., Tomaszewski K. A., Kornicka K., Henry B. M., The Influence of Aging on the Regenerative Potential of Human Adipose Derived Mesenchymal Stem Cells, Stem Cells Int., 2016, 2016, 2152435.10.1155/2016/2152435Suche in Google Scholar PubMed PubMed Central

[33] Kornicka K., Marycz K., Maredziak M., Tomaszewski K. A., Nicpoń J., The effects of the DNA methyltranfserases inhibitor 5-Azacitidine on ageing, oxidative stress and DNA methylation of adipose derived stem cells, J. Cell. Mol. Med., 2017, 21, 387–401.10.1111/jcmm.12972Suche in Google Scholar PubMed PubMed Central

[34] Sharpless N. E., DePinho R. A., How stem cells age and why this makes us grow old, Nat. Rev. Mol. Cell Biol., 2007, 8, 703–713.10.1038/nrm2241Suche in Google Scholar PubMed

[35] Marycz K., Kornicka, Basins K., Czyrek A., Equine Metabolic Syndrome Affects Viability, Senescence, and Stress Factors of Equine Adipose-Derived Mesenchymal Stromal Stem Cells: New Insight into EqASCs Isolated from EMS Horses in the Context of Their Aging, Oxid. Med. Cell. Longev., 2016, 2016, 1–17.10.1155/2016/4710326Suche in Google Scholar PubMed PubMed Central

[36] Marycz K., Kornicka K., Grzesiak J., Śmieszek A., Szłapka J., Macroautophagy and Selective Mitophagy Ameliorate Chondrogenic Differentiation Potential in Adipose Stem Cells of Equine Metabolic Syndrome: New Findings in the Field of Progenitor Cells Differentiation, Oxid Med Cell Longev., 2016;2016:3718468.10.1155/2016/3718468Suche in Google Scholar PubMed PubMed Central

[37] Marycz K., Kornicka K., Marędziak M., Golonka P., Nicpoń J., Equine metabolic syndrome impairs adipose stem cells osteogenic differentiation by predominance of autophagy over selective mitophagy, J. Cell. Mol. Med., 2016, 20, 2384–2404.10.1111/jcmm.12932Suche in Google Scholar PubMed PubMed Central

[38] Nawrocka D., Kornicka K., Śmieszek A., Marycz K., Spirulina platensis Improves Mitochondrial Function Impaired by Elevated Oxidative Stress in Adipose-Derived Mesenchymal Stromal Cells (ASCs) and Intestinal Epithelial Cells (IECs), and Enhances Insulin Sensitivity in Equine Metabolic Syndrome (EMS) Horses, Mar. Drugs, 2017, 15.10.3390/md15080237Suche in Google Scholar PubMed PubMed Central

[39] Brandl A., Meyer M., Bechmann V., Nerlich M., Angele P., Oxidative stress induces senescence in human mesenchymal stem cells, Exp. Cell Res., 2011, 317, 1541–1547.10.1016/j.yexcr.2011.02.015Suche in Google Scholar PubMed

[40] Stolzing A., Jones E., McGonagle D., Scutt A., Age-related changes in human bone marrow-derived mesenchymal stem cells: consequences for cell therapies, Mech. Ageing Dev., 2008, 129, 163–173.10.1016/j.mad.2007.12.002Suche in Google Scholar PubMed

[41] Burova E., Borodkina A., Shatrova A., Nikolsky N., Sublethal oxidative stress induces the premature senescence of human mesenchymal stem cells derived from endometrium, Oxid. Med. Cell. Longev., 2013, 2013, 474931.10.1155/2013/474931Suche in Google Scholar PubMed PubMed Central

[42] de la Lastra C., Villegas I., Resveratrol as an anti-inflammatory and anti-aging agent: mechanisms and clinical implications, Mol. Nutr. Food Res., 2005, 49, 405–430.10.1002/mnfr.200500022Suche in Google Scholar PubMed

[43] Pasinetti G. M., Wang J., Marambaud P., Ferruzzi M., Gregor P., Knable L. A., Ho L., Neuroprotective and metabolic effects of resveratrol: therapeutic implications for Huntington’s disease and other neurodegenerative disorders, Exp. Neurol., 2011, 232, 1–6.10.1016/j.expneurol.2011.08.014Suche in Google Scholar

[44] Marycz K., Kornicka K., Szlapka-Kosarzewska J., Weiss C., Excessive Endoplasmic Reticulum Stress Correlates with Impaired Mitochondrial Dynamics, Mitophagy and Apoptosis, in Liver and Adipose Tissue, but Not in Muscles in EMS Horses, Int. J. Mol. Sci., 2018, 19, 165.10.3390/ijms19010165Suche in Google Scholar

[45] Shin Y. N., Kim B. S., Ahn H. H., Lee J. H., Kim K. S., Lee, J. Y., Kim M. S., Khang G., Lee H. B., Adhesion comparison of human bone marrow stem cells on a gradient wettable surface prepared by corona treatment, Appl. Surf. Sci., 2008, 255, 293–296.10.1016/j.apsusc.2008.06.173Suche in Google Scholar

[46] Ruardy T. G., Schakenraad J. M., van der Mei H. C., Busscher H. J., Adhesion and spreading of human skin fibroblasts on physicochemically characterized gradient surfaces, J. Biomed. Mater. Res., 1995, 29, 1415–1423.10.1002/jbm.820291113Suche in Google Scholar

[47] Altankov G., Grinnell F., Groth T., Studies on the biocompatibility of materials: fibroblast reorganization of substratum-bound fibronectin on surfaces varying in wettability, J. Biomed. Mater. Res. 1996, 30, 385–391.10.1002/(SICI)1097-4636(199603)30:3<385::AID-JBM13>3.0.CO;2-JSuche in Google Scholar

[48] Deligianni D. D., Katsala N. D., Koutsoukos P. G., Missirlis Y. F., Effect of surface roughness of hydroxyapatite on human bone marrow cell adhesion, proliferation, differentiation and detachment strength, Biomaterials, 2001, 22, 87–96.10.1016/S0142-9612(00)00174-5Suche in Google Scholar

[49] Martin J. Y., Schwartz Z., Hummert T. W., Schraub D. M., Simpson J., Lankford J., Dean D. D., Cochran D. L., Boyan B. D, Effect of titanium surface roughness on proliferation, differentiation, and protein synthesis of human osteoblast-like cells (MG63), J. Biomed. Mater. Res., 1995, 29, 389–401.10.1002/jbm.820290314Suche in Google Scholar

[50] Groessner-Schreiber B., Tuan R. S., Enhanced extracellular matrix production and mineralization by osteoblasts cultured on titanium surfaces in vitro, J. Cell Sci., 1992, 101 ( Pt 1), 209–217.10.1242/jcs.101.1.209Suche in Google Scholar

[51] Mustafa K., Wennerberg A., Wroblewski J., Hultenby K., Lopez B. S., Arvidson, K., Determining optimal surface roughness of TiO(2) blasted titanium implant material for attachment, proliferation and differentiation of cells derived from human mandibular alveolar bone, Clin. Oral Implants Res., 2001, 12, 515–525.10.1034/j.1600-0501.2001.120513.xSuche in Google Scholar

[52] Anselme K., Osteoblast adhesion on biomaterials, Biomaterials, 2000, 21, 667–681.10.1016/S0142-9612(99)00242-2Suche in Google Scholar

[53] Keller J. C., Schneider G. B., Stanford C. M., Kellogg B., Effects of implant microtopography on osteoblast cell attachment, Implant Dent., 2003, 12, 175–181.10.1097/01.ID.0000058309.77613.87Suche in Google Scholar PubMed

[54] da Silva Meirelles L., Chagastelles P. C., Nardi N. B., Mesenchymal stem cells reside in virtually all post-natal organs and tissues, J. Cell Sci., 2006, 119, 2204–2213.10.1242/jcs.02932Suche in Google Scholar PubMed

[55] Aguirre L., Fernández-Quintela A., Arias N., Portillo M. P., Resveratrol: anti-obesity mechanisms of action, Mol. Basel Switz., 2014, 19, 18632–18655.10.3390/molecules191118632Suche in Google Scholar PubMed PubMed Central

[56] Brasnyó P., Molnár G. A., Mohás M., Markó L., Laczy B., Cseh, J., et al., Resveratrol improves insulin sensitivity, reduces oxidative stress and activates the Akt pathway in type 2 diabetic patients, Br. J. Nutr., 2011, 106, 383–389.10.1017/S0007114511000316Suche in Google Scholar PubMed

[57] Dai Z., Li Y., Quarles L. D., Song T., Pan W., Zhou H., Xiao Z., Resveratrol enhances proliferation and osteoblastic differentiation in human mesenchymal stem cells via ER-dependent ERK1/2 activation, Phytomedicine Int. J. Phytother. Phytopharm., 2007, 14, 806–814.10.1016/j.phymed.2007.04.003Suche in Google Scholar PubMed

[58] Dosier C. R., Erdman C. P., Park J. H., Schwartz Z., Boyan B. D., Guldberg R. E., Resveratrol effect on osteogenic differentiation of rat and human adipose derived stem cells in a 3-D culture environment, J. Mech. Behav. Biomed. Mater., 2012, 11, 112–122.10.1016/j.jmbbm.2011.08.014Suche in Google Scholar PubMed PubMed Central

[59] Lei M., Liu S., Liu Y.-L., Resveratrol protects bone marrow mesenchymal stem cell derived chondrocytes cultured on chitosan-gelatin scaffolds from the inhibitory effect of interleukin-1beta, Acta Pharmacol. Sin., 2008, 29, 1350–1356.10.1111/j.1745-7254.2008.00880.xSuche in Google Scholar PubMed

[60] Tseng P.-C., Hou S.-M., Chen R.-J., Peng H.-W., Hsieh C.-F., Kuo M.-L., Yen M.-L., Resveratrol promotes osteogenesis of human mesenchymal stem cells by upregulating RUNX2 gene expression via the SIRT1/FOXO3A axis, J. Bone Miner. Res. Off. J. Am. Soc. Bone Miner. Res., 2011, 26, 2552–2563.10.1002/jbmr.460Suche in Google Scholar PubMed

[61] Yoon D. S., Choi Y., Choi S. M., Park K.H., Lee, J., W. Different effects of resveratrol on early and late passage mesenchymal stem cells through β-catenin regulation, Biochem. Biophys. Res. Commun., 2015, 467, 1026–1032.10.1016/j.bbrc.2015.10.017Suche in Google Scholar PubMed

[62] Peltz L., Gomez J., Marquez M., Alencastro F., Atashpanjeh N., Quang T., Bach T., Zhao Y., Resveratrol Exerts Dosage and Duration Dependent Effect on Human Mesenchymal Stem Cell Development, PLoS ONE, 2012, 7.10.1371/journal.pone.0037162Suche in Google Scholar PubMed PubMed Central

[63] Abreu S. C., Weiss D. J., Rocco P. R. M., Extracellular vesicles derived from mesenchymal stromal cells: a therapeutic option in respiratory diseases?, Stem Cell Res. Ther., 2016, 7.10.1186/s13287-016-0317-0Suche in Google Scholar PubMed PubMed Central

[64] Lei L.-T., Chen J.-B., Zhao, Y.-L., Yang S.-P., He L., Resveratrol attenuates senescence of adipose-derived mesenchymal stem cells and restores their paracrine effects on promoting insulin secretion of INS-1 cells through Pim-1, Eur. Rev. Med. Pharmacol. Sci., 2016, 20, 1203–1213.Suche in Google Scholar

[65] Smallwood H. S., López-Ferrer D., Squier T. C., Aging enhances the production of reactive oxygen species and bactericidal activity in peritoneal macrophages by upregulating classical activation pathways, Biochemistry (Mosc.), 2011, 50, 9911–9922.10.1021/bi2011866Suche in Google Scholar PubMed PubMed Central

[66] Youle R. J., Bliek A. M., Mitochondrial Fission, Fusion, and Stress, Science, 2012, 337, 1062–1065.10.1126/science.1219855Suche in Google Scholar PubMed PubMed Central

[67] Gao F., Chiu S. M., Motan D. A. L., Zhang Z., Chen L., Ji H.-L., Tse H.-F., Fu Q.-L., Lian Q., Mesenchymal stem cells and immunomodulation: current status and future prospects, Cell Death Dis., 2016, 7.10.1038/cddis.2015.327Suche in Google Scholar PubMed PubMed Central

Received: 2018-01-22
Accepted: 2018-02-22
Published Online: 2018-05-23

© 2018 K. Kornicka et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Artikel in diesem Heft

  1. Regular Articles
  2. The effect of CuO modification for a TiO2 nanotube confined CeO2 catalyst on the catalytic combustion of butane
  3. The preparation and antibacterial activity of cellulose/ZnO composite: a review
  4. Linde Type A and nano magnetite/NaA zeolites: cytotoxicity and doxorubicin loading efficiency
  5. Performance and thermal decomposition analysis of foaming agent NPL-10 for use in heavy oil recovery by steam injection
  6. Spectroscopic (FT-IR, FT-Raman, UV, 1H and 13C NMR) insights, electronic profiling and DFT computations on ({(E)-[3-(1H-imidazol-1-yl)-1-phenylpropylidene] amino}oxy)(4-nitrophenyl)methanone, an imidazole-bearing anti-Candida agent
  7. A Simplistic Preliminary Assessment of Ginstling-Brounstein Model for Solid Spherical Particles in the Context of a Diffusion-Controlled Synthesis
  8. M-Polynomials And Topological Indices Of Zigzag And Rhombic Benzenoid Systems
  9. Photochemical Transformation of some 3-benzyloxy-2-(benzo[b]thiophen-2-yl)-4Hchromen-4-ones: A Remote Substituent Effect
  10. Dynamic Changes of Secondary Metabolites and Antioxidant Activity of Ligustrum lucidum During Fruit Growth
  11. Studies on the flammability of polypropylene/ammonium polyphosphate and montmorillonite by using the cone calorimeter test
  12. DSC, FT-IR, NIR, NIR-PCA and NIR-ANOVA for determination of chemical stability of diuretic drugs: impact of excipients
  13. Antioxidant and Hepatoprotective Effects of Methanolic Extracts of Zilla spinosa and Hammada elegans Against Carbon Tetrachlorideinduced Hepatotoxicity in Rats
  14. Prunus cerasifera Ehrh. fabricated ZnO nano falcates and its photocatalytic and dose dependent in vitro bio-activity
  15. Organic biocides hosted in layered double hydroxides: enhancing antimicrobial activity
  16. Experimental study on the regulation of the cholinergic pathway in renal macrophages by microRNA-132 to alleviate inflammatory response
  17. Synthesis, characterization, in-vitro antimicrobial properties, molecular docking and DFT studies of 3-{(E)-[(4,6-dimethylpyrimidin-2-yl)imino]methyl} naphthalen-2-ol and Heteroleptic Mn(II), Co(II), Ni(II) and Zn(II) complexes
  18. M-Polynomials and Topological Indices of Dominating David Derived Networks
  19. Human Health Risk Assessment of Trace Metals in Surface Water Due to Leachate from the Municipal Dumpsite by Pollution Index: A Case Study from Ndawuse River, Abuja, Nigeria
  20. Analysis of Bowel Diseases from Blood Serum by Autofluorescence and Atomic Force Microscopy Techniques
  21. Hydrographic parameters and distribution of dissolved Cu, Ni, Zn and nutrients near Jeddah desalination plant
  22. Relationships between diatoms and environmental variables in industrial water biotopes of Trzuskawica S.A. (Poland)
  23. Optimum Conversion of Major Ginsenoside Rb1 to Minor Ginsenoside Rg3(S) by Pulsed Electric Field-Assisted Acid Hydrolysis Treatment
  24. Antioxidant, Anti-microbial Properties and Chemical Composition of Cumin Essential Oils Extracted by Three Methods
  25. Regulatory mechanism of ulinastatin on autophagy of macrophages and renal tubular epithelial cells
  26. Investigation of the sustained-release mechanism of hydroxypropyl methyl cellulose skeleton type Acipimox tablets
  27. Bio-accumulation of Polycyclic Aromatic Hydrocarbons in the Grey Mangrove (Avicennia marina) along Arabian Gulf, Saudi Coast
  28. Dynamic Change of Secondary Metabolites and spectrum-effect relationship of Malus halliana Koehne flowers during blooming
  29. Lipids constituents from Gardenia aqualla Stapf & Hutch
  30. Effect of using microwaves for catalysts preparation on the catalytic acetalization of glycerol with furfural to obtain fuel additives
  31. Effect of Humic Acid on the Degradation of Methylene Blue by Peroxymonosulfate
  32. Serum containing drugs of Gua Lou Xie Bai decoction (GLXB-D) can inhibit TGF-β1-Induced Epithelial to Mesenchymal Transition (EMT) in A549 Cells
  33. Antiulcer Activity of Different Extracts of Anvillea garcinii and Isolation of Two New Secondary Metabolites
  34. Analysis of Metabolites in Cabernet Sauvignon and Shiraz Dry Red Wines from Shanxi by 1H NMR Spectroscopy Combined with Pattern Recognition Analysis
  35. Can water temperature impact litter decomposition under pollution of copper and zinc mixture
  36. Released from ZrO2/SiO2 coating resveratrol inhibits senescence and oxidative stress of human adipose-derived stem cells (ASC)
  37. Validated thin-layer chromatographic method for alternative and simultaneous determination of two anti-gout agents in their fixed dose combinations
  38. Fast removal of pollutants from vehicle emissions during cold-start stage
  39. Review Article
  40. Catalytic activities of heterogeneous catalysts obtained by copolymerization of metal-containing 2-(acetoacetoxy)ethyl methacrylate
  41. Antibiotic Residue in the Aquatic Environment: Status in Africa
  42. Regular Articles
  43. Mercury fractionation in gypsum using temperature desorption and mass spectrometric detection
  44. Phytosynthetic Ag doped ZnO nanoparticles: Semiconducting green remediators
  45. Epithelial–Mesenchymal Transition Induced by SMAD4 Activation in Invasive Growth Hormone-Secreting Adenomas
  46. Physicochemical properties of stabilized sewage sludge admixtures by modified steel slag
  47. In Vitro Cytotoxic and Antiproliferative Activity of Cydonia oblonga flower petals, leaf and fruit pellet ethanolic extracts. Docking simulation of the active flavonoids on anti-apoptotic protein Bcl-2
  48. Synthesis and Characterization of Pd exchanged MMT Clay for Mizoroki-Heck Reaction
  49. A new selective, and sensitive method for the determination of lixivaptan, a vasopressin 2 (V2)-receptor antagonist, in mouse plasma and its application in a pharmacokinetic study
  50. Anti-EGFL7 antibodies inhibit rat prolactinoma MMQ cells proliferation and PRL secretion
  51. Density functional theory calculations, vibration spectral analysis and molecular docking of the antimicrobial agent 6-(1,3-benzodioxol-5-ylmethyl)-5-ethyl-2-{[2-(morpholin-4-yl)ethyl] sulfanyl}pyrimidin-4(3H)-one
  52. Effect of Nano Zeolite on the Transformation of Cadmium Speciation and Its Uptake by Tobacco in Cadmium-contaminated Soil
  53. Effects and Mechanisms of Jinniu Capsule on Methamphetamine-Induced Conditioned Place Preference in Rats
  54. Calculating the Degree-based Topological Indices of Dendrimers
  55. Efficient optimization and mineralization of UV absorbers: A comparative investigation with Fenton and UV/H2O2
  56. Metabolites of Tryptophane and Phenylalanine as Markers of Small Bowel Ischemia-Reperfusion Injury
  57. Adsorption and determination of polycyclic aromatic hydrocarbons in water through the aggregation of graphene oxide
  58. The role of NR2C2 in the prolactinomas
  59. Chromium removal from industrial wastewater using Phyllostachys pubescens biomass loaded Cu-S nanospheres
  60. Hydrotalcite Anchored Ruthenium Catalyst for CO2 Hydrogenation Reaction
  61. Preparation of Calcium Fluoride using Phosphogypsum by Orthogonal Experiment
  62. The mechanism of antibacterial activity of corylifolinin against three clinical bacteria from Psoralen corylifolia L
  63. 2-formyl-3,6-bis(hydroxymethyl)phenyl benzoate in Electrochemical Dry Cell
  64. Electro-photocatalytic degradation of amoxicillin using calcium titanate
  65. Effect of Malus halliana Koehne Polysaccharides on Functional Constipation
  66. Structural Properties and Nonlinear Optical Responses of Halogenated Compounds: A DFT Investigation on Molecular Modelling
  67. DMFDMA catalyzed synthesis of 2-((Dimethylamino)methylene)-3,4-dihydro-9-arylacridin-1(2H)-ones and their derivatives: in-vitro antifungal, antibacterial and antioxidant evaluations
  68. Production of Methanol as a Fuel Energy from CO2 Present in Polluted Seawater - A Photocatalytic Outlook
  69. Study of different extraction methods on finger print and fatty acid of raw beef fat using fourier transform infrared and gas chromatography-mass spectrometry
  70. Determination of trace fluoroquinolones in water solutions and in medicinal preparations by conventional and synchronous fluorescence spectrometry
  71. Extraction and determination of flavonoids in Carthamus tinctorius
  72. Therapeutic Application of Zinc and Vanadium Complexes against Diabetes Mellitus a Coronary Disease: A review
  73. Study of calcined eggshell as potential catalyst for biodiesel formation using used cooking oil
  74. Manganese oxalates - structure-based Insights
  75. Topological Indices of H-Naphtalenic Nanosheet
  76. Long-Term Dissolution of Glass Fibers in Water Described by Dissolving Cylinder Zero-Order Kinetic Model: Mass Loss and Radius Reduction
  77. Topological study of the para-line graphs of certain pentacene via topological indices
  78. A brief insight into the prediction of water vapor transmissibility in highly impermeable hybrid nanocomposites based on bromobutyl/epichlorohydrin rubber blends
  79. Comparative sulfite assay by voltammetry using Pt electrodes, photometry and titrimetry: Application to cider, vinegar and sugar analysis
  80. MicroRNA delivery mediated by PEGylated polyethylenimine for prostate cancer therapy
  81. Reversible Fluorescent Turn-on Sensors for Fe3+ based on a Receptor Composed of Tri-oxygen Atoms of Amide Groups in Water
  82. Sonocatalytic degradation of methyl orange in aqueous solution using Fe-doped TiO2 nanoparticles under mechanical agitation
  83. Hydrotalcite Anchored Ruthenium Catalyst for CO2 Hydrogenation Reaction
  84. Production and Analysis of Recycled Ammonium Perrhenate from CMSX-4 superalloys
  85. Topical Issue on Agriculture
  86. New phosphorus biofertilizers from renewable raw materials in the aspect of cadmium and lead contents in soil and plants
  87. Survey of content of cadmium, calcium, chromium, copper, iron, lead, magnesium, manganese, mercury, sodium and zinc in chamomile and green tea leaves by electrothermal or flame atomizer atomic absorption spectrometry
  88. Biogas digestate – benefits and risks for soil fertility and crop quality – an evaluation of grain maize response
  89. A numerical analysis of heat transfer in a cross-current heat exchanger with controlled and newly designed air flows
  90. Freshwater green macroalgae as a biosorbent of Cr(III) ions
  91. The main influencing factors of soil mechanical characteristics of the gravity erosion environment in the dry-hot valley of Jinsha river
  92. Free amino acids in Viola tricolor in relation to different habitat conditions
  93. The influence of filler amount on selected properties of new experimental resin dental composite
  94. Effect of poultry wastewater irrigation on nitrogen, phosphorus and carbon contents in farmland soil
  95. Response of spring wheat to NPK and S fertilization. The content and uptake of macronutrients and the value of ionic ratios
  96. The Effect of Macroalgal Extracts and Near Infrared Radiation on Germination of Soybean Seedlings: Preliminary Research Results
  97. Content of Zn, Cd and Pb in purple moor-grass in soils heavily contaminated with heavy metals around a zinc and lead ore tailing landfill
  98. Topical Issue on Research for Natural Bioactive Products
  99. Synthesis of (±)-3,4-dimethoxybenzyl-4-methyloctanoate as a novel internal standard for capsinoid determination by HPLC-ESI-MS/MS(QTOF)
  100. Repellent activity of monoterpenoid esters with neurotransmitter amino acids against yellow fever mosquito, Aedes aegypti
  101. Effect of Flammulina velutipes (golden needle mushroom, eno-kitake) polysaccharides on constipation
  102. Bioassay-directed fractionation of a blood coagulation factor Xa inhibitor, betulinic acid from Lycopus lucidus
  103. Antifungal and repellent activities of the essential oils from three aromatic herbs from western Himalaya
  104. Chemical composition and microbiological evaluation of essential oil from Hyssopus officinalis L. with white and pink flowers
  105. Bioassay-guided isolation and identification of Aedes aegypti larvicidal and biting deterrent compounds from Veratrum lobelianum
  106. α-Terpineol, a natural monoterpene: A review of its biological properties
  107. Utility of essential oils for development of host-based lures for Xyleborus glabratus (Coleoptera: Curculionidae: Scolytinae), vector of laurel wilt
  108. Phenolic composition and antioxidant potential of different organs of Kazakh Crataegus almaatensis Pojark: A comparison with the European Crataegus oxyacantha L. flowers
  109. Isolation of eudesmane type sesquiterpene ketone from Prangos heyniae H.Duman & M.F.Watson essential oil and mosquitocidal activity of the essential oils
  110. Comparative analysis of the polyphenols profiles and the antioxidant and cytotoxicity properties of various blue honeysuckle varieties
  111. Special Issue on ICCESEN 2017
  112. Modelling world energy security data from multinomial distribution by generalized linear model under different cumulative link functions
  113. Pine Cone and Boron Compounds Effect as Reinforcement on Mechanical and Flammability Properties of Polyester Composites
  114. Artificial Neural Network Modelling for Prediction of SNR Effected by Probe Properties on Ultrasonic Inspection of Austenitic Stainless Steel Weldments
  115. Calculation and 3D analyses of ERR in the band crack front contained in a rectangular plate made of multilayered material
  116. Improvement of fuel properties of biodiesel with bioadditive ethyl levulinate
  117. Properties of AlSi9Cu3 metal matrix micro and nano composites produced via stir casting
  118. Investigation of Antibacterial Properties of Ag Doped TiO2 Nanofibers Prepared by Electrospinning Process
  119. Modeling of Total Phenolic contents in Various Tea samples by Experimental Design Methods
  120. Nickel doping effect on the structural and optical properties of indium sulfide thin films by SILAR
  121. The effect mechanism of Ginnalin A as a homeopathic agent on various cancer cell lines
  122. Excitation functions of proton induced reactions of some radioisotopes used in medicine
  123. Oxide ionic conductivity and microstructures of Pr and Sm co-doped CeO2-based systems
  124. Rapid Synthesis of Metallic Reinforced in Situ Intermetallic Composites in Ti-Al-Nb System via Resistive Sintering
  125. Oxidation Behavior of NiCr/YSZ Thermal Barrier Coatings (TBCs)
  126. Clustering Analysis of Normal Strength Concretes Produced with Different Aggregate Types
  127. Magnetic Nano-Sized Solid Acid Catalyst Bearing Sulfonic Acid Groups for Biodiesel Synthesis
  128. The biological activities of Arabis alpina L. subsp. brevifolia (DC.) Cullen against food pathogens
  129. Humidity properties of Schiff base polymers
  130. Free Vibration Analysis of Fiber Metal Laminated Straight Beam
  131. Comparative study of in vitro antioxidant, acetylcholinesterase and butyrylcholinesterase activity of alfalfa (Medicago sativa L.) collected during different growth stages
  132. Isothermal Oxidation Behavior of Gadolinium Zirconate (Gd2Zr2O7) Thermal Barrier Coatings (TBCs) produced by Electron Beam Physical Vapor Deposition (EB-PVD) technique
  133. Optimization of Adsorption Parameters for Ultra-Fine Calcite Using a Box-Behnken Experimental Design
  134. The Microstructural Investigation of Vermiculite-Infiltrated Electron Beam Physical Vapor Deposition Thermal Barrier Coatings
  135. Modelling Porosity Permeability of Ceramic Tiles using Fuzzy Taguchi Method
  136. Experimental and theoretical study of a novel naphthoquinone Schiff base
  137. Physicochemical properties of heat treated sille stone for ceramic industry
  138. Sand Dune Characterization for Preparing Metallurgical Grade Silicon
  139. Catalytic Applications of Large Pore Sulfonic Acid-Functionalized SBA-15 Mesoporous Silica for Esterification
  140. One-photon Absorption Characterizations, Dipole Polarizabilities and Second Hyperpolarizabilities of Chlorophyll a and Crocin
  141. The Optical and Crystallite Characterization of Bilayer TiO2 Films Coated on Different ITO layers
  142. Topical Issue on Bond Activation
  143. Metal-mediated reactions towards the synthesis of a novel deaminolysed bisurea, dicarbamolyamine
  144. The structure of ortho-(trifluoromethyl)phenol in comparison to its homologues – A combined experimental and theoretical study
  145. Heterogeneous catalysis with encapsulated haem and other synthetic porphyrins: Harnessing the power of porphyrins for oxidation reactions
  146. Recent Advances on Mechanistic Studies on C–H Activation Catalyzed by Base Metals
  147. Reactions of the organoplatinum complex [Pt(cod) (neoSi)Cl] (neoSi = trimethylsilylmethyl) with the non-coordinating anions SbF6– and BPh4–
  148. Erratum
  149. Investigation on Two Compounds of O, O’-dithiophosphate Derivatives as Corrosion Inhibitors for Q235 Steel in Hydrochloric Acid Solution
https://doi.org/10.1515/chem-2018-0039
Schlagwörter für diesen Artikel
sol-gel; dip coating; resveratrol; biocompatibility; mesenchymal stem cells
Creative Commons
BY-NC-ND 4.0

Artikel in diesem Heft

  1. Regular Articles
  2. The effect of CuO modification for a TiO2 nanotube confined CeO2 catalyst on the catalytic combustion of butane
  3. The preparation and antibacterial activity of cellulose/ZnO composite: a review
  4. Linde Type A and nano magnetite/NaA zeolites: cytotoxicity and doxorubicin loading efficiency
  5. Performance and thermal decomposition analysis of foaming agent NPL-10 for use in heavy oil recovery by steam injection
  6. Spectroscopic (FT-IR, FT-Raman, UV, 1H and 13C NMR) insights, electronic profiling and DFT computations on ({(E)-[3-(1H-imidazol-1-yl)-1-phenylpropylidene] amino}oxy)(4-nitrophenyl)methanone, an imidazole-bearing anti-Candida agent
  7. A Simplistic Preliminary Assessment of Ginstling-Brounstein Model for Solid Spherical Particles in the Context of a Diffusion-Controlled Synthesis
  8. M-Polynomials And Topological Indices Of Zigzag And Rhombic Benzenoid Systems
  9. Photochemical Transformation of some 3-benzyloxy-2-(benzo[b]thiophen-2-yl)-4Hchromen-4-ones: A Remote Substituent Effect
  10. Dynamic Changes of Secondary Metabolites and Antioxidant Activity of Ligustrum lucidum During Fruit Growth
  11. Studies on the flammability of polypropylene/ammonium polyphosphate and montmorillonite by using the cone calorimeter test
  12. DSC, FT-IR, NIR, NIR-PCA and NIR-ANOVA for determination of chemical stability of diuretic drugs: impact of excipients
  13. Antioxidant and Hepatoprotective Effects of Methanolic Extracts of Zilla spinosa and Hammada elegans Against Carbon Tetrachlorideinduced Hepatotoxicity in Rats
  14. Prunus cerasifera Ehrh. fabricated ZnO nano falcates and its photocatalytic and dose dependent in vitro bio-activity
  15. Organic biocides hosted in layered double hydroxides: enhancing antimicrobial activity
  16. Experimental study on the regulation of the cholinergic pathway in renal macrophages by microRNA-132 to alleviate inflammatory response
  17. Synthesis, characterization, in-vitro antimicrobial properties, molecular docking and DFT studies of 3-{(E)-[(4,6-dimethylpyrimidin-2-yl)imino]methyl} naphthalen-2-ol and Heteroleptic Mn(II), Co(II), Ni(II) and Zn(II) complexes
  18. M-Polynomials and Topological Indices of Dominating David Derived Networks
  19. Human Health Risk Assessment of Trace Metals in Surface Water Due to Leachate from the Municipal Dumpsite by Pollution Index: A Case Study from Ndawuse River, Abuja, Nigeria
  20. Analysis of Bowel Diseases from Blood Serum by Autofluorescence and Atomic Force Microscopy Techniques
  21. Hydrographic parameters and distribution of dissolved Cu, Ni, Zn and nutrients near Jeddah desalination plant
  22. Relationships between diatoms and environmental variables in industrial water biotopes of Trzuskawica S.A. (Poland)
  23. Optimum Conversion of Major Ginsenoside Rb1 to Minor Ginsenoside Rg3(S) by Pulsed Electric Field-Assisted Acid Hydrolysis Treatment
  24. Antioxidant, Anti-microbial Properties and Chemical Composition of Cumin Essential Oils Extracted by Three Methods
  25. Regulatory mechanism of ulinastatin on autophagy of macrophages and renal tubular epithelial cells
  26. Investigation of the sustained-release mechanism of hydroxypropyl methyl cellulose skeleton type Acipimox tablets
  27. Bio-accumulation of Polycyclic Aromatic Hydrocarbons in the Grey Mangrove (Avicennia marina) along Arabian Gulf, Saudi Coast
  28. Dynamic Change of Secondary Metabolites and spectrum-effect relationship of Malus halliana Koehne flowers during blooming
  29. Lipids constituents from Gardenia aqualla Stapf & Hutch
  30. Effect of using microwaves for catalysts preparation on the catalytic acetalization of glycerol with furfural to obtain fuel additives
  31. Effect of Humic Acid on the Degradation of Methylene Blue by Peroxymonosulfate
  32. Serum containing drugs of Gua Lou Xie Bai decoction (GLXB-D) can inhibit TGF-β1-Induced Epithelial to Mesenchymal Transition (EMT) in A549 Cells
  33. Antiulcer Activity of Different Extracts of Anvillea garcinii and Isolation of Two New Secondary Metabolites
  34. Analysis of Metabolites in Cabernet Sauvignon and Shiraz Dry Red Wines from Shanxi by 1H NMR Spectroscopy Combined with Pattern Recognition Analysis
  35. Can water temperature impact litter decomposition under pollution of copper and zinc mixture
  36. Released from ZrO2/SiO2 coating resveratrol inhibits senescence and oxidative stress of human adipose-derived stem cells (ASC)
  37. Validated thin-layer chromatographic method for alternative and simultaneous determination of two anti-gout agents in their fixed dose combinations
  38. Fast removal of pollutants from vehicle emissions during cold-start stage
  39. Review Article
  40. Catalytic activities of heterogeneous catalysts obtained by copolymerization of metal-containing 2-(acetoacetoxy)ethyl methacrylate
  41. Antibiotic Residue in the Aquatic Environment: Status in Africa
  42. Regular Articles
  43. Mercury fractionation in gypsum using temperature desorption and mass spectrometric detection
  44. Phytosynthetic Ag doped ZnO nanoparticles: Semiconducting green remediators
  45. Epithelial–Mesenchymal Transition Induced by SMAD4 Activation in Invasive Growth Hormone-Secreting Adenomas
  46. Physicochemical properties of stabilized sewage sludge admixtures by modified steel slag
  47. In Vitro Cytotoxic and Antiproliferative Activity of Cydonia oblonga flower petals, leaf and fruit pellet ethanolic extracts. Docking simulation of the active flavonoids on anti-apoptotic protein Bcl-2
  48. Synthesis and Characterization of Pd exchanged MMT Clay for Mizoroki-Heck Reaction
  49. A new selective, and sensitive method for the determination of lixivaptan, a vasopressin 2 (V2)-receptor antagonist, in mouse plasma and its application in a pharmacokinetic study
  50. Anti-EGFL7 antibodies inhibit rat prolactinoma MMQ cells proliferation and PRL secretion
  51. Density functional theory calculations, vibration spectral analysis and molecular docking of the antimicrobial agent 6-(1,3-benzodioxol-5-ylmethyl)-5-ethyl-2-{[2-(morpholin-4-yl)ethyl] sulfanyl}pyrimidin-4(3H)-one
  52. Effect of Nano Zeolite on the Transformation of Cadmium Speciation and Its Uptake by Tobacco in Cadmium-contaminated Soil
  53. Effects and Mechanisms of Jinniu Capsule on Methamphetamine-Induced Conditioned Place Preference in Rats
  54. Calculating the Degree-based Topological Indices of Dendrimers
  55. Efficient optimization and mineralization of UV absorbers: A comparative investigation with Fenton and UV/H2O2
  56. Metabolites of Tryptophane and Phenylalanine as Markers of Small Bowel Ischemia-Reperfusion Injury
  57. Adsorption and determination of polycyclic aromatic hydrocarbons in water through the aggregation of graphene oxide
  58. The role of NR2C2 in the prolactinomas
  59. Chromium removal from industrial wastewater using Phyllostachys pubescens biomass loaded Cu-S nanospheres
  60. Hydrotalcite Anchored Ruthenium Catalyst for CO2 Hydrogenation Reaction
  61. Preparation of Calcium Fluoride using Phosphogypsum by Orthogonal Experiment
  62. The mechanism of antibacterial activity of corylifolinin against three clinical bacteria from Psoralen corylifolia L
  63. 2-formyl-3,6-bis(hydroxymethyl)phenyl benzoate in Electrochemical Dry Cell
  64. Electro-photocatalytic degradation of amoxicillin using calcium titanate
  65. Effect of Malus halliana Koehne Polysaccharides on Functional Constipation
  66. Structural Properties and Nonlinear Optical Responses of Halogenated Compounds: A DFT Investigation on Molecular Modelling
  67. DMFDMA catalyzed synthesis of 2-((Dimethylamino)methylene)-3,4-dihydro-9-arylacridin-1(2H)-ones and their derivatives: in-vitro antifungal, antibacterial and antioxidant evaluations
  68. Production of Methanol as a Fuel Energy from CO2 Present in Polluted Seawater - A Photocatalytic Outlook
  69. Study of different extraction methods on finger print and fatty acid of raw beef fat using fourier transform infrared and gas chromatography-mass spectrometry
  70. Determination of trace fluoroquinolones in water solutions and in medicinal preparations by conventional and synchronous fluorescence spectrometry
  71. Extraction and determination of flavonoids in Carthamus tinctorius
  72. Therapeutic Application of Zinc and Vanadium Complexes against Diabetes Mellitus a Coronary Disease: A review
  73. Study of calcined eggshell as potential catalyst for biodiesel formation using used cooking oil
  74. Manganese oxalates - structure-based Insights
  75. Topological Indices of H-Naphtalenic Nanosheet
  76. Long-Term Dissolution of Glass Fibers in Water Described by Dissolving Cylinder Zero-Order Kinetic Model: Mass Loss and Radius Reduction
  77. Topological study of the para-line graphs of certain pentacene via topological indices
  78. A brief insight into the prediction of water vapor transmissibility in highly impermeable hybrid nanocomposites based on bromobutyl/epichlorohydrin rubber blends
  79. Comparative sulfite assay by voltammetry using Pt electrodes, photometry and titrimetry: Application to cider, vinegar and sugar analysis
  80. MicroRNA delivery mediated by PEGylated polyethylenimine for prostate cancer therapy
  81. Reversible Fluorescent Turn-on Sensors for Fe3+ based on a Receptor Composed of Tri-oxygen Atoms of Amide Groups in Water
  82. Sonocatalytic degradation of methyl orange in aqueous solution using Fe-doped TiO2 nanoparticles under mechanical agitation
  83. Hydrotalcite Anchored Ruthenium Catalyst for CO2 Hydrogenation Reaction
  84. Production and Analysis of Recycled Ammonium Perrhenate from CMSX-4 superalloys
  85. Topical Issue on Agriculture
  86. New phosphorus biofertilizers from renewable raw materials in the aspect of cadmium and lead contents in soil and plants
  87. Survey of content of cadmium, calcium, chromium, copper, iron, lead, magnesium, manganese, mercury, sodium and zinc in chamomile and green tea leaves by electrothermal or flame atomizer atomic absorption spectrometry
  88. Biogas digestate – benefits and risks for soil fertility and crop quality – an evaluation of grain maize response
  89. A numerical analysis of heat transfer in a cross-current heat exchanger with controlled and newly designed air flows
  90. Freshwater green macroalgae as a biosorbent of Cr(III) ions
  91. The main influencing factors of soil mechanical characteristics of the gravity erosion environment in the dry-hot valley of Jinsha river
  92. Free amino acids in Viola tricolor in relation to different habitat conditions
  93. The influence of filler amount on selected properties of new experimental resin dental composite
  94. Effect of poultry wastewater irrigation on nitrogen, phosphorus and carbon contents in farmland soil
  95. Response of spring wheat to NPK and S fertilization. The content and uptake of macronutrients and the value of ionic ratios
  96. The Effect of Macroalgal Extracts and Near Infrared Radiation on Germination of Soybean Seedlings: Preliminary Research Results
  97. Content of Zn, Cd and Pb in purple moor-grass in soils heavily contaminated with heavy metals around a zinc and lead ore tailing landfill
  98. Topical Issue on Research for Natural Bioactive Products
  99. Synthesis of (±)-3,4-dimethoxybenzyl-4-methyloctanoate as a novel internal standard for capsinoid determination by HPLC-ESI-MS/MS(QTOF)
  100. Repellent activity of monoterpenoid esters with neurotransmitter amino acids against yellow fever mosquito, Aedes aegypti
  101. Effect of Flammulina velutipes (golden needle mushroom, eno-kitake) polysaccharides on constipation
  102. Bioassay-directed fractionation of a blood coagulation factor Xa inhibitor, betulinic acid from Lycopus lucidus
  103. Antifungal and repellent activities of the essential oils from three aromatic herbs from western Himalaya
  104. Chemical composition and microbiological evaluation of essential oil from Hyssopus officinalis L. with white and pink flowers
  105. Bioassay-guided isolation and identification of Aedes aegypti larvicidal and biting deterrent compounds from Veratrum lobelianum
  106. α-Terpineol, a natural monoterpene: A review of its biological properties
  107. Utility of essential oils for development of host-based lures for Xyleborus glabratus (Coleoptera: Curculionidae: Scolytinae), vector of laurel wilt
  108. Phenolic composition and antioxidant potential of different organs of Kazakh Crataegus almaatensis Pojark: A comparison with the European Crataegus oxyacantha L. flowers
  109. Isolation of eudesmane type sesquiterpene ketone from Prangos heyniae H.Duman & M.F.Watson essential oil and mosquitocidal activity of the essential oils
  110. Comparative analysis of the polyphenols profiles and the antioxidant and cytotoxicity properties of various blue honeysuckle varieties
  111. Special Issue on ICCESEN 2017
  112. Modelling world energy security data from multinomial distribution by generalized linear model under different cumulative link functions
  113. Pine Cone and Boron Compounds Effect as Reinforcement on Mechanical and Flammability Properties of Polyester Composites
  114. Artificial Neural Network Modelling for Prediction of SNR Effected by Probe Properties on Ultrasonic Inspection of Austenitic Stainless Steel Weldments
  115. Calculation and 3D analyses of ERR in the band crack front contained in a rectangular plate made of multilayered material
  116. Improvement of fuel properties of biodiesel with bioadditive ethyl levulinate
  117. Properties of AlSi9Cu3 metal matrix micro and nano composites produced via stir casting
  118. Investigation of Antibacterial Properties of Ag Doped TiO2 Nanofibers Prepared by Electrospinning Process
  119. Modeling of Total Phenolic contents in Various Tea samples by Experimental Design Methods
  120. Nickel doping effect on the structural and optical properties of indium sulfide thin films by SILAR
  121. The effect mechanism of Ginnalin A as a homeopathic agent on various cancer cell lines
  122. Excitation functions of proton induced reactions of some radioisotopes used in medicine
  123. Oxide ionic conductivity and microstructures of Pr and Sm co-doped CeO2-based systems
  124. Rapid Synthesis of Metallic Reinforced in Situ Intermetallic Composites in Ti-Al-Nb System via Resistive Sintering
  125. Oxidation Behavior of NiCr/YSZ Thermal Barrier Coatings (TBCs)
  126. Clustering Analysis of Normal Strength Concretes Produced with Different Aggregate Types
  127. Magnetic Nano-Sized Solid Acid Catalyst Bearing Sulfonic Acid Groups for Biodiesel Synthesis
  128. The biological activities of Arabis alpina L. subsp. brevifolia (DC.) Cullen against food pathogens
  129. Humidity properties of Schiff base polymers
  130. Free Vibration Analysis of Fiber Metal Laminated Straight Beam
  131. Comparative study of in vitro antioxidant, acetylcholinesterase and butyrylcholinesterase activity of alfalfa (Medicago sativa L.) collected during different growth stages
  132. Isothermal Oxidation Behavior of Gadolinium Zirconate (Gd2Zr2O7) Thermal Barrier Coatings (TBCs) produced by Electron Beam Physical Vapor Deposition (EB-PVD) technique
  133. Optimization of Adsorption Parameters for Ultra-Fine Calcite Using a Box-Behnken Experimental Design
  134. The Microstructural Investigation of Vermiculite-Infiltrated Electron Beam Physical Vapor Deposition Thermal Barrier Coatings
  135. Modelling Porosity Permeability of Ceramic Tiles using Fuzzy Taguchi Method
  136. Experimental and theoretical study of a novel naphthoquinone Schiff base
  137. Physicochemical properties of heat treated sille stone for ceramic industry
  138. Sand Dune Characterization for Preparing Metallurgical Grade Silicon
  139. Catalytic Applications of Large Pore Sulfonic Acid-Functionalized SBA-15 Mesoporous Silica for Esterification
  140. One-photon Absorption Characterizations, Dipole Polarizabilities and Second Hyperpolarizabilities of Chlorophyll a and Crocin
  141. The Optical and Crystallite Characterization of Bilayer TiO2 Films Coated on Different ITO layers
  142. Topical Issue on Bond Activation
  143. Metal-mediated reactions towards the synthesis of a novel deaminolysed bisurea, dicarbamolyamine
  144. The structure of ortho-(trifluoromethyl)phenol in comparison to its homologues – A combined experimental and theoretical study
  145. Heterogeneous catalysis with encapsulated haem and other synthetic porphyrins: Harnessing the power of porphyrins for oxidation reactions
  146. Recent Advances on Mechanistic Studies on C–H Activation Catalyzed by Base Metals
  147. Reactions of the organoplatinum complex [Pt(cod) (neoSi)Cl] (neoSi = trimethylsilylmethyl) with the non-coordinating anions SbF6– and BPh4–
  148. Erratum
  149. Investigation on Two Compounds of O, O’-dithiophosphate Derivatives as Corrosion Inhibitors for Q235 Steel in Hydrochloric Acid Solution
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 8.9.2025 von https://www.degruyterbrill.com/document/doi/10.1515/chem-2018-0039/html
Button zum nach oben scrollen