Startseite LncRNA ATXN8OS enhances tamoxifen resistance in breast cancer
Artikel Open Access

LncRNA ATXN8OS enhances tamoxifen resistance in breast cancer

  • Hongkai Zhang EMAIL logo , Jianni Zhang , Lining Dong und Rong Ma
Veröffentlicht/Copyright: 15. Dezember 2020
Artikel downloaden (PDF)
Open Medicine
Aus der Zeitschrift Open Medicine Band 16 Heft 1

Abstract

Background

Tamoxifen (TAMR) resistance remains a massive obstacle for breast cancer (BC) management. The precise parts of long non-coding RNA ataxin 8 opposite strand (ATXN8OS) in BC TAMR resistance have not been defined.

Methods

The levels of ATXN8OS, vasodilator-stimulated phosphoprotein (VASP), and miR-16-5p were assessed by quantitative real-time polymerase chain reaction or western blot. Colony formation and cell viability were analyzed by MTT and colony formation assays, respectively. Targeted interactions among miR-16-5p, ATXN8OS, and VASP were confirmed by dual-luciferase reporter assay. Animal studies were performed to observe the role of ATXN8OS in TAMR sensitivity in vivo.

Results

ATXN8OS expression was increased in BC tissues and cells. ATXN8OS depletion promoted BC cell sensitivity to TAMR. ATXN8OS sequestered miR-16-5p by directly binding to miR-16-5p. The promotional effect of ATXN8OS knockdown on BC cell TAMR sensitivity was mediated by miR-16-5p. VASP was a direct target of miR-16-5p, and miR-16-5p overexpression enhanced TAMR sensitivity by VASP. Moreover, ATXN8OS regulated VASP expression by acting as a miR-16-5p sponge. In addition, ATXN8OS knockdown augmented BC TAMR sensitivity in vivo.

Conclusion

ATXN8OS knockdown enhanced BC TAMR sensitivity partially through the miR-16-5p/VASP axis, highlighting a potential therapeutic target for improving the clinical benefits of TAMR treatment in BC patients.

Keywords: BC; ATXN8OS; miR-16-5p; VASP; TAMR resistance

1 Introduction

Breast cancer (BC) is the most prevalent malignancy and one of the leading causes of cancer-related death among women worldwide, with an estimated 20,88,849 newly diagnosed BC cases and 6,26,679 deaths in 2018 [1]. Tamoxifen (TAMR), an estrogen receptor (ER) antagonist, is the mainstay treatment of BC and is widely used for BC therapy [2]. Despite improved prognosis of BC patients, the development of TAMR resistance remains the major obstacle for BC management [3,4]. Therefore, a better understanding for the potential mechanisms of TAMR resistance is very important to develop new therapeutic targets and improve BC patient prognosis.

Long non-coding RNAs (lncRNAs), a diverse class of >200 nucleotides transcripts, are gaining the attention of researchers in many fields, including cancer [5]. Emerging evidence suggests that dysregulation of lncRNAs is involved in BC tumorigenesis, progression, and TAMR resistance [6,7]. For instance, Xue et al. manifested that lncRNA HOX antisense intergenic RNA (HOTAIR) was upregulated in TAMR-resistant BC tissues and its knockdown repressed cell survival and weakened TAMR-resistant cell growth [4]. Ma and colleagues reported that lncRNA DSCAM-AS1 enhanced TAMR resistance, cell propagation, and hampered apoptosis in BC cells [8]. Ataxin 8 opposite strand (ATXN8OS), an lncRNA with 1,236 bp in length located on chromosome 13q21, was reported to show an aberrant expression in brain diseases [9]. A recent document reported that highly expressed ATXN8OS might be associated with poor prognosis of cervical cancer using a nine-lncRNA signature [10]. Moreover, ATXN8OS was found to be overexpressed in BC tissues and cells, and its depletion repressed BC cell proliferation and invasion, highlighting its role as a tumor promoter in BC [11]. In this study, we focused on the functional role of ATXN8OS in TAMR resistance of BC and underlying mechanisms governing it.

MicroRNAs (miRNAs) are small, endogenous ∼22 nucleotides transcripts that direct gene expression by pairing to the 3′-untranslated region (3′-UTR) of target mRNAs, and thus function as important players in human cancer [12]. Previous researches had reported that miR-16-5p was downregulated in BC tissues, and it exerted a tumor-suppressive role in BC by inhibiting oncogene expression [13,14]. However, the function of miR-16-5p on TAMR resistance in BC remains unclear. Recent studies have reported that lncRNAs regulate TAMR resistance in BC through the networks of competing endogenous RNAs (ceRNAs) via acting as molecular sponges of specific miRNAs [15,16]. The database of starBase 3.0 online software predicted two putative targeted correlations between miR-16-5p and ATXN8OS or vasodilator-stimulated phosphoprotein (VASP), eliciting a potential network of ATXN8OS/miR-16-5p/VASP axis. In the present study, we aimed to explore the detailed role and underlying mechanisms of ATXN8OS on TAMR resistance in BC. By combining in vitro and in vivo experiments, our study suggested that the knockdown of ATXN8OS augmented TAMR sensitivity in BC cells possibly through miR-16-5p/VASP axis.

2 Materials and methods

2.1 Clinical samples and ethical statement

In this study, 44 tissue samples were collected, including 22 BC tissues and 22 adjacent normal breast tissues, from International Healthy Cells Rehabilitation Association, Shanghai Liangliang Biotechnology Co., Ltd. Fresh samples were stored at −80°C until RNA extraction. The protocol of this study was approved by the Ethics Committee of International Healthy Cells Rehabilitation Association, Shanghai Liangliang Biotechnology Co., Ltd, and written informed consent was obtained from all the participating subjects.

  1. Ethics approval and consent to participate: The present study was approved by the ethical review committee of International Healthy Cells Rehabilitation Association, Shanghai Liangliang Biotechnology Co., Ltd.

  2. Patient consent for publication: Not applicable.

2.2 Cell culture, treatment, and transfection

Human normal mammary epithelial cell line MCF-10A (ATCC®CRL-10317), and two BC cell lines MCF-7 (ATCC®HTB-22TM) and BT-549 (ATCC®HTB-122) were bought from the American Type Culture Collection (ATCC, Manassas, VA, USA). All the cells were maintained at 37°C, 5% CO2 in RPMI-1640 medium (ATCC), plus 10% fetal bovine serum (FBS, ATCC) and 1% penicillin/streptomycin (Gibco, Cergy Pontoise, France). For TAMR exposure, BC cells were treated with various concentrations (0.5, 1, 2, 4, 8, 16, 32, 64, and 128 µm) or 10 µm of TAMR (Gibco) for 48 h.

For the knockdown of ATXN8OS, cells were transfected with synthetic small interfering RNA (siRNA) against ATXN8OS (si-ATXN8OS, GenePharma, Shanghai, China), and nontarget siRNA (si-NC, GenePharma) was used as the negative control. For miR-16-5p overexpression or depletion, modified miR-16-5p mimic (GenePharma), inhibitor of miR-16-5p (anti-miR-16-5p, GenePharma), or corresponding negative control (miR-NC mimic or anti-miR-NC, GenePharma) was introduced into cells. VASP upregulation was carried out using VASP overexpression plasmid (the full sequence of VASP was cloned into pcDNA3.1, GenePharma), with nontarget pcDNA3.1 plasmid as the negative control (vector, GenePharma). The Lipofectamine 3000 reagent (Invitrogen, Cergy Pontoise, France) was used for each transfection following the protocols of manufacturers.

2.3 Determination of IC50 value for TAMR

A basic colorimetric 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was implemented to determine the IC50 value for TAMR. Cells (1.0 × 105 each well) seeded in 96-well plates were transfected with the indicated oligonucleotides or plasmids and then were exposed to various concentrations (0.5, 1, 2, 4, 8, 16, 32, 64, and 128 µm) of TAMR. After 48 h exposure, MTT solution (Sigma-Aldrich) was used at a final concentration of 0.5 mg/mL per well, followed by the incubation for 2 h at 37°C. Then, media was removed and dimethyl sulfoxide (DMSO, 200 µL each well) was added into plates to dissolve formazan crystals. The quantity of formazan was proportional to the number of viable cells, which could be measured using a microplate reader (Thermo Fisher Scientific, Braunschweig, Germany) at the wavelength of 490 nm.

2.4 Cell apoptosis assay

Flow cytometry was performed to evaluate cell apoptosis using the Annexin V-FITC/PI apoptosis kit (Thermo Fisher Scientific). Briefly, cells were transfected with the indicated oligonucleotides or plasmids and then were treated with 10 µm of TAMR (Gibco) for 48 h. After that, cells were stained with 5 µL of Annexin V-FITC and 10 µL of PI for 10 min in the dark. The flow cytometer (BD Biosciences, San Jose, CA, USA) was finally used for the assessment of cell apoptotic rate.

2.5 Western blot

Cells and tissues were homogenized in RIPA lysis buffer (Beyotime, Shanghai, China) containing protease inhibitor cocktail (Sigma-Aldrich). After centrifugation at 13,000 g for 20 min, the supernatant was collected and quantified using a BCA protein assay kit (Thermo Fisher Scientific). Total protein (50 µg) was subjected to electrophoresis on a 10% SDS polyacrylamide gel and then transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Molsheim, France). After being blocked in 5% non-fat powdered milk, the membranes were probed with primary antibodies at the indicated dilution, followed by the incubation with HRP-conjugated anti-mouse or anti-rabbit IgG secondary antibodies (Abcam, Cambridge, UK). Protein bands were detected using SuperSignal West Pico PLUS chemiluminescent substrate (Thermo Fisher Scientific) and analyzed by GeneTools software (Syngene, Cambridge, UK). The following antibodies were used: anti-Beclin1 (Abcam; dilution 1:1,000), anti-light chain 3 I (anti-LC3 I, Cell Signaling Technology, Danvers, MA, USA; dilution 1:1,000), anti-LC3 II (Cell Signaling Technology; dilution 1:1,000), anti-Bcl-2 (Abcam; dilution 1:1,000), anti-Bax (Abcam; dilution 1:1,000), and anti-VASP (Abcam; dilution 1:3,000). Expression of glyceraldehyde-3-phosphate dehydrogenase was used as a loading control.

2.6 Quantitative real-time polymerase chain reaction

Total RNA was prepared using SV total RNA isolation system (Promega, Madison, WI, USA) referring to the manufacturer’s protocols. The quantity and quality of RNA extracts were analyzed by the Agilent 2100 Bioanalyzer (Agilent Technologies, Waldbronn, Germany). Complementary DNA (cDNA) was synthesized using the Maxima H Minus First Strand cDNA synthesis kit (Thermo Fisher Scientific) with random hexamer primers for ATXN8OS and VASP mRNA and TaqMan MicroRNA reverse transcription kit (Applied Biosystems, Bleiswijk, The Netherlands) with target-specific stem-loop primers for miR-16-5p, referring to the instructions of manufacturers. The expression levels of ATXN8OS, VASP mRNA, and miR-16-5p were determined by quantitative real-time polymerase chain reaction (qRT-PCR) using SYBR® Premix Ex TaqTM reagent (Takara, Dalian, China), with β-actin or U6 snRNA as the internal control. Primers sequences (5′–3′) for qRT-PCR were as follows: ATXN8OS: CATTACTGTGTAGCAATAC (sense) and AATTCAAGCCATTAACCT (antisense); VASP: CTGGGAGAAGAACAGCACAACC (sense) and AGGTCCGAGTATCACTGGAGC (antisense); β-actin: GATGGAAATCGTCAGAGGCT (sense) and TGGCACTTAGTTGGAAATGC (antisense); miR-16-5p: CGCGCTAGCAGCACGTAAAT (sense) and GTGCAGGGTCCGAGGT (antisense); U6: GCTTCGGCAGCACATATACTAAAAT (sense) and CGCTTCACGAATTTGCGTGTCAT (antisense).

2.7 Bioinformatics and dual-luciferase reporter assay

Bioinformatic analyses for the directly interacted miRNAs of ATXN8OS and the molecular targets of miR-16-5p were performed using starBase 3.0 online software at http://starbase.sysu.edu.cn/. The partial sequences of ATXN8OS and VASP 3′-UTR harboring the wild-type target sequence for miR-16-5p were cloned into the pmirGLO vector (Promega), respectively, to construct ATXN8OS and VASP 3′-UTR wild-type luciferase reporter plasmids (ATXN8OS WT and VASP 3′-UTR WT). Site-directed mutants (ATXN8OS MUT and VASP 3′-UTR MUT) were generated using the GENEART Site-Directed Mutagenesis System (Thermo Fisher Scientific) following the producer’s guidance. The reporter constructs were cotransfected into MCF-7 and BT-549 cells together with miR-16-5p mimic or miR-NC mimic. The luciferase activities were measured after 48 h transfection using the dual-luciferase reporter assay system (Promega).

2.8 Lentiviral vector transduction

Lentiviral vectors containing short hairpin RNA (shRNA) against ATXN8OS (sh-ATXN8OS) or nontarget control shRNA (sh-NC) were obtained from Genechem (Shanghai, China). MCF-7 cells were transduced by sh-ATXN8OS or sh-NC with various multiplicities of infection in media containing 8 µg/mL of polybrene. Twenty-four hours after transduction, the cells with positive infection were selected using puromycin at a final concentration of 1 µg/mL.

2.9 Xenograft model assay

To implement in vivo assays, female 6-week-old BALB/c nude mice (Henan Research Center of Laboratory Animal, Zhengzhou, China) were used in the study, after obtaining approval from Animal Ethical Committee of International Healthy Cells Rehabilitation Association, Shanghai Liangliang Biotechnology Co., Ltd. About 5.0 × 106 MCF-7 cells stably transduced with sh-NC or sh-ATXN8OS were subcutaneously inoculated into the left flank of nude mice, followed by the administration of TAMR (50 mg/kg) every 5 days after 5 days of implantation (n = 9 each group). Tumor volume was measured with a caliper every 1 week and calculated with the formula: length (L) × width (W)2 = mm3. Thirty-five days after injection, all mice were killed to remove the tumor tissues. Animal experiments were carried out following the Guide for the Care and Use of Laboratory Animals of International Healthy Cells Rehabilitation Association, Shanghai Liangliang Biotechnology Co., Ltd.

2.10 Statistical analysis

Data analysis and statistical calculation were conducted by SPSS v.22 software (SPSS Inc., Chicago, IL, USA) using a Student’s t-test (two-tailed) and one-way analysis of variance (ANOVA), followed by post hoc analysis. All the results were expressed as mean ± standard error of the mean (SEM) and a p-value <0.05 was considered statistically significant.

3 Results

3.1 ATXN8OS was upregulated in BC tissues and cells

First, we determined the expression of ATXN8OS in BC tissues and cells. As shown by qRT-PCR, ATXN8OS expression was higher in BC tissues than that in normal breast tissues (Figure 1a). In parallel, in comparison to the normal control, ATXN8OS expression was significantly increased in BC cells (Figure 1b).

Figure 1. ATXN8OS was highly expressed in BC tissues and cells. ATXN8OS expression by qRT-PCR in 22 pairs of BC tissues and adjacent normal breast tissues (a) and MCF-10A, MCF-7, and BT-549 cells (b). *P < 0.05.
Figure 1.

ATXN8OS was highly expressed in BC tissues and cells. ATXN8OS expression by qRT-PCR in 22 pairs of BC tissues and adjacent normal breast tissues (a) and MCF-10A, MCF-7, and BT-549 cells (b). *P < 0.05.

3.2 ATXN8OS knockdown augmented TAMR sensitivity of BC cells

To explore the role of ATXN8OS in BC TAMR resistance, loss-of-function experiments were performed by si-ATXN8OS. Transient introduction of si-ATXN8OS, but not a scrambled control sequence, induced a prominent reduction in ATXN8OS expression (about 58% reduction in MCF-7 cells and 65% reduction in BT-549 cells; Figure 2a and b). MTT assay revealed that ATXN8OS knockdown resulted in decreased IC50 value for TAMR in the two BC cells (Figure 2c and d). The data of flow cytometry and western blot showed that ATXN8OS depletion led to a significant promotion in cell apoptosis (Figure 2e and f), a distinct reduction in Bcl-2 expression, and a clear enhancement in Bax level (Figure 2g and h) with or without TAMR treatment. Moreover, the knockdown of ATXN8OS triggered the striking repression in Beclin 1 expression and LC3 II/I ratio (Figure 2i and j) in the two BC cells when treatment with or without TAMR, suggesting the suppressive role of ATXN8OS knockdown in autophagy. More interestingly, simultaneous ATXN8OS silencing and TAMR treatment resulted in a more significant promotion in cell apoptosis (Figure 2e–h) and a more clear repression in cell autophagy (Figure 2i and j).

Figure 2 ATXN8OS depletion enhanced TAMR sensitivity in BC cells. (a and b) MCF-7 and BT-549 cells were transfected with si-NC or si-ATXN8OS, followed by the determination of ATXN8OS expression by qRT-PCR 48 h post-transfection. (c and d) MCF-7 and BT-549 cells were transfected with si-NC or si-ATXN8OS and then were exposed to various concentrations (0.5, 1, 2, 4, 8, 16, 32, 64, and 128 µm) of TAMR for 48 h, followed by the measurement of cell viability using MTT assay. MCF-7 and BT-549 cells were transfected with si-NC or si-ATXN8OS and then were treated with 10 µm of TAMR for 48 h, followed by the determination of cell apoptosis by flow cytometry (e and f), Bcl-2 and Bax levels by western blot (g and h), and the levels of Beclin 1, LC3 I, and LC3 II by western blot (i and j). *P < 0.05.
Figure 2

ATXN8OS depletion enhanced TAMR sensitivity in BC cells. (a and b) MCF-7 and BT-549 cells were transfected with si-NC or si-ATXN8OS, followed by the determination of ATXN8OS expression by qRT-PCR 48 h post-transfection. (c and d) MCF-7 and BT-549 cells were transfected with si-NC or si-ATXN8OS and then were exposed to various concentrations (0.5, 1, 2, 4, 8, 16, 32, 64, and 128 µm) of TAMR for 48 h, followed by the measurement of cell viability using MTT assay. MCF-7 and BT-549 cells were transfected with si-NC or si-ATXN8OS and then were treated with 10 µm of TAMR for 48 h, followed by the determination of cell apoptosis by flow cytometry (e and f), Bcl-2 and Bax levels by western blot (g and h), and the levels of Beclin 1, LC3 I, and LC3 II by western blot (i and j). *P < 0.05.

3.3 ATXN8OS acted as a molecular sponge of miR-16-5p to sequester miR-16-5p

To further explore the molecular mechanism by which ATXN8OS influenced BC TAMR resistance, we carried out a detailed analysis for the directly interacted miRNAs of ATXN8OS. Using starBase 3.0 software, 10 targeted miRNAs were predicted (Supplement Figure S1a). qRT-PCR data showed that miR-16-5p was the most significantly upregulated miRNA when ATXN8OS silencing in MCF7 and BT-549 cells (Supplement Figure S1b and c). Therefore, we selected miR-16-5p for further analyses. To confirm the targeted interaction between ATXN8OS and miR-16-5p, we cloned ATXN8OS segment harboring the putative miR-16-5p-binding sequence into a luciferase vector and mutated the target region (Figure 3a). With the wild-type reporter construct and miR-16-5p upregulation caused a significant reduction in luciferase activity (Figure 3b and c). When the miR-16-5p-binding site was mutated, little reduction in luciferase activity was observed in the presence of miR-16-5p mimic (Figure 3b and c). Our data also showed that miR-16-5p was prominently downregulated in BC tissues and cells, as compared to their counterparts (Figure 3d and e). After that, we observed whether ATXN8OS modulated miR-16-5p expression in the two BC cells. As expected, in contrast to negative group, transfection of si-ATXN8OS resulted in increased miR-16-5p expression (Figure 3f and g). Together, these results strongly pointed a role of ATXN8OS as a molecular sponge of miR-16-5p.

Figure 3 ATXN8OS sequestered miR-16-5p by sponging miR-16-5p. (a) Schematic of the putative miR-16-5p-binding site in ATXN8OS by starBase 3.0 software and mutated miR-16-5p-binding site. (b and c) The luciferase activity in MCF-7 and BT-549 cells cotransfected with ATXN8OS luciferase reporter construct harboring the wild-type target sequence for miR-16-5p (ATXN8OS WT) or its mutant in seed sequence (ATXN8OS MUT) and miR-16-5p mimic or miR-NC mimic. The expression of miR-16-5p by qRT-PCR in 22 pairs of BC tissues and adjacent normal breast tissues (d), and MCF-10A, MCF-7, and BT-549 cells (e). (f and g) The expression of miR-16-5p in MCF-7 and BT-549 cells transfected with si-NC or si-ATXN8OS. *P < 0.05.
Figure 3

ATXN8OS sequestered miR-16-5p by sponging miR-16-5p. (a) Schematic of the putative miR-16-5p-binding site in ATXN8OS by starBase 3.0 software and mutated miR-16-5p-binding site. (b and c) The luciferase activity in MCF-7 and BT-549 cells cotransfected with ATXN8OS luciferase reporter construct harboring the wild-type target sequence for miR-16-5p (ATXN8OS WT) or its mutant in seed sequence (ATXN8OS MUT) and miR-16-5p mimic or miR-NC mimic. The expression of miR-16-5p by qRT-PCR in 22 pairs of BC tissues and adjacent normal breast tissues (d), and MCF-10A, MCF-7, and BT-549 cells (e). (f and g) The expression of miR-16-5p in MCF-7 and BT-549 cells transfected with si-NC or si-ATXN8OS. *P < 0.05.

3.4 The promotional effect of ATXN8OS knockdown on TAMR sensitivity was abated by restored expression of miR-16-5p in BC cells

Then, we further investigated whether ATXN8OS exerted its regulatory effect on BC TAMR resistance by miR-16-5p. As shown by qRT-PCR, si-ATXN8OS-mediated miR-16-5p increase was significantly abolished by cotransfection of anti-miR-16-5p in the two BC cells (Figure 4a and b). Subsequent experiments’ results revealed that in comparison to the negative group, the reduced effect of ATXN8OS depletion on IC50 value was markedly reversed by miR-16-5p expression restoration (Figure 4c and d). Moreover, si-ATXN8OS-mediated pro-apoptosis (Figure 4e–h) and anti-autophagy (Figure 4i and j) effects under TAMR treatment were prominently abrogated by restored expression of miR-16-5p.

Figure 4 The knockdown of ATXN8OS enhanced TAMR sensitivity by upregulating miR-16-5p. MCF-7 and BT-549 cells were transfected with si-NC, si-ATXN8OS, si-ATXN8OS + anti-miR-NC, and si-ATXN8OS + anti-miR-16-5p before TAMR treatment with the indicated concentrations, followed by the measurement of miR-16-5p expression by qRT-PCR (a and b), the IC50 value for TAMR by MTT assay (c and d), cell apoptosis by flow cytometry (e and f), Bcl-2 and Bax levels by western blot (g and h), and the levels of Beclin 1, LC3 I and LC3 II by western blot (i and j). *P < 0.05.
Figure 4

The knockdown of ATXN8OS enhanced TAMR sensitivity by upregulating miR-16-5p. MCF-7 and BT-549 cells were transfected with si-NC, si-ATXN8OS, si-ATXN8OS + anti-miR-NC, and si-ATXN8OS + anti-miR-16-5p before TAMR treatment with the indicated concentrations, followed by the measurement of miR-16-5p expression by qRT-PCR (a and b), the IC50 value for TAMR by MTT assay (c and d), cell apoptosis by flow cytometry (e and f), Bcl-2 and Bax levels by western blot (g and h), and the levels of Beclin 1, LC3 I and LC3 II by western blot (i and j). *P < 0.05.

3.5 VASP was directly targeted and inhibited by miR-16-5p

To further understand the role of miR-16-5p in BC TAMR resistance, we used starBase 3.0 software to help identify its molecular targets in humans. Among the thousands of candidates, VEGFA, VASP, E2F3, and HDGF were of interest in the present study because their expression levels had been found to be upregulated in BC [17,18,19,20]. Western blot data validated the overexpression of the four targets in BC cells compared with MCF-10A cells (Supplement Figure 1d). Moreover, VASP expression the most significantly down-regulated in the miR-16-5p-overexpressing BC cells (Supplement Figure 1e). To verify the targeted relationship between VASP and miR-16-5p, we performed dual-luciferase reporter assay using VASP 3′-UTR reporter (Figure 5a). The cotransfection of VASP 3′-UTR wild-type reporter and miR-16-5p mimic into the two BC cells produced lower luciferase activity than in cells cotransfected with miR-NC mimic (Figure 5b and c). However, site-directed mutant of the target sequence strikingly abolished the effect of miR-16-5p on reporter gene expression under the same conditions (Figure 5b and c). Our data also revealed that the mRNA and protein levels of VASP were significantly upregulated in BC tissues (Figure 5d and e) and cells (Figure 5f and g) compared with their counterparts. Moreover, qRT-PCR and western blot analyses showed that in contrast to miR-NC mimic group, the mRNA and protein levels of VASP were remarkably reduced by miR-16-5p overexpression in both MCF-7 (Figure 5h and i) and BT-549 (Figure 5j and k) cells.

Figure 5 VASP was a direct target of miR-16-5p. (a) Schematic of sequence complementarity between miR-16-5p and VASP 3′-UTR and the mutant in complementary sequence. (b and c) The luciferase activity in MCF-7 and BT-549 cells cotransfected with VASP 3′-UTR wild-type reporter (VASP 3′-UTR WT) or site-directed mutant of the target sequence (VASP 3′-UTR MUT) and miR-NC mimic or miR-16-5p mimic. The mRNA and protein levels of VASP in 22 pairs of BC tissues and adjacent normal breast tissues (d and e), MCF-10A, MCF-7, and BT-549 cells (f and g), MCF-7 (h and i), and BT-549 (j and k) cells transfected with miR-NC mimic or miR-16-5p mimic. *P < 0.05.
Figure 5

VASP was a direct target of miR-16-5p. (a) Schematic of sequence complementarity between miR-16-5p and VASP 3′-UTR and the mutant in complementary sequence. (b and c) The luciferase activity in MCF-7 and BT-549 cells cotransfected with VASP 3′-UTR wild-type reporter (VASP 3′-UTR WT) or site-directed mutant of the target sequence (VASP 3′-UTR MUT) and miR-NC mimic or miR-16-5p mimic. The mRNA and protein levels of VASP in 22 pairs of BC tissues and adjacent normal breast tissues (d and e), MCF-10A, MCF-7, and BT-549 cells (f and g), MCF-7 (h and i), and BT-549 (j and k) cells transfected with miR-NC mimic or miR-16-5p mimic. *P < 0.05.

3.6 VASP mediated the promotional effect of miR-16-5p overexpression on TAMR sensitivity in BC cells

To provide further mechanistic insights into the link between miR-16-5p and VASP on BC TAMR resistance, MCF-7 and BT-549 cells were transfected with miR-16-5p mimic alone or together with VASP overexpression plasmid. Our data showed that VASP level was significantly reduced by miR-16-5p overexpression in the two BC cells using qRT-PCR and western blot assays (Figure 6a–d). Moreover, the decreased effect of miR-16-5p overexpression on VASP level was highly abated by cotransfection of VASP overexpression plasmid (Figure 6a–d). In contrast to miR-NC mimic group, miR-16-5p overexpression led to a significant reduction in IC50 value for TAMR (Figure 6e and f) and a distinct enhancement in cell apoptosis (Figure 6g–-j), as well as a clear suppression of cell autophagy (Figures 6k and l) under TMAR treatment. These data together established a promotional effect of miR-16-5p overexpression on TAMR sensitivity in the two BC cells. However, this effect was significantly reversed by VASP expression restoration in both MCF-7 and BT-549 cells (Figure 6e–l) under TAMR exposure.

Figure 6 The overexpression of miR-16-5p promoted TAMR sensitivity by VASP. MCF-7 and BT-549 cells were transfected with miR-NC mimic, miR-16-5p mimic, miR-16-5p mimic + vector, or miR-16-5p mimic + VASP (VASP overexpression plasmid) before TAMR treatment with the indicated concentrations, followed by the determination of VASP mRNA and protein levels (a–d), the IC50 value for TAMR by MTT assay (e and f), cell apoptosis by flow cytometry (g and h), Bcl-2 and Bax levels by western blot (i and j), and the levels of Beclin 1, LC3 I and LC3 II by western blot (k and l). *P < 0.05.
Figure 6

The overexpression of miR-16-5p promoted TAMR sensitivity by VASP. MCF-7 and BT-549 cells were transfected with miR-NC mimic, miR-16-5p mimic, miR-16-5p mimic + vector, or miR-16-5p mimic + VASP (VASP overexpression plasmid) before TAMR treatment with the indicated concentrations, followed by the determination of VASP mRNA and protein levels (a–d), the IC50 value for TAMR by MTT assay (e and f), cell apoptosis by flow cytometry (g and h), Bcl-2 and Bax levels by western blot (i and j), and the levels of Beclin 1, LC3 I and LC3 II by western blot (k and l). *P < 0.05.

3.7 ATXN8OS regulated VASP expression by miR-16-5p and VASP was a functional target of ATXN8OS in regulating BC cell autophagy

Next, we observed whether, if so, how ATXN8OS modulated VASP expression. As expected, introduction of si-ATXN8OS, but not a si-NC control, triggered a significant inhibition in VASP expression at both mRNA and protein levels in MCF-7 (Figure 7a and b) and BT-549 (Figure 7c and d) cells. More interestingly, this effect of ATXN8OS knockdown was remarkably abated by restored miR-16-5p expression in the two BC cells (Figure 7a–d). All these results strongly pointed a role of ATXN8OS as a molecular sponge of miR-16-5p to modulate VASP expression.

Figure 7 ATXN8OS acted a ceRNA of miR-16-5p to regulate VASP expression. MCF-7 (a and b) and BT-549 (c and d) cells were transfected with si-NC, si-ATXN8OS, si-ATXN8OS + anti-miR-NC, or si-ATXN8OS + anti-miR-16-5p, followed by the evaluation of VASP mRNA and protein levels by qRT-PCR and western blot, respectively. *P < 0.05.
Figure 7

ATXN8OS acted a ceRNA of miR-16-5p to regulate VASP expression. MCF-7 (a and b) and BT-549 (c and d) cells were transfected with si-NC, si-ATXN8OS, si-ATXN8OS + anti-miR-NC, or si-ATXN8OS + anti-miR-16-5p, followed by the evaluation of VASP mRNA and protein levels by qRT-PCR and western blot, respectively. *P < 0.05.

In addition, we asked whether ATXN8OS modulated cell autophagy by VASP. In contrast to the control group, the transfection of VASP overexpression plasmid significantly reversed the reduction of ATXN8OS knockdown on Beclin 1 expression and LC3 II/I ratio (Supplement Figure S2a and b), showing the repression of ATXN8OS knockdown on cell autophagy by downregulating VASP.

3.8 ATXN8OS knockdown enhanced TAMR sensitivity in vivo

Finally, we further explored the influence of ATXN8OS knockdown on TAMR sensitivity in vivo using xenograft mice model. In contrast to negative control, sh-ATXN8OS transduction promoted TAMR-induced anti-tumor effect, as evidenced by the decrease in tumor volume (Figure 8a) and weight (Figure 8b). As shown by qRT-PCR, ATXN8OS expression was significantly reduced in tumor tissues derived from sh-ATXN8OS-transduced MCF-7 cells (Figure 8c). Moreover, ATXN8OS knockdown resulted in a distinct increase in miR-16-5p expression (Figure 8d) and an obvious decrease in VASP level (Figure 8e and f).

Figure 8 The knockdown of ATXN8OS promoted TAMR sensitivity in vivo. MCF-7 cells stably transduced with sh-NC or sh-ATXN8OS were subcutaneously inoculated into the left flank of nude mice, followed by the administration of TAMR (50 mg/kg) every 5 days after 5 days of implantation (n = 9 each group). Thirty-five days after injection, all mice were killed to remove the tumor tissues. (a) Tumor volume was assessed every 1 week after first injection. (b) Tumor weight was weighed. The expression levels of ATXN8OS (c), miR-16-5p (d), and VASP (e and f) were determined in xenograft tissues by qRT-PCR and western blot. *P < 0.05.
Figure 8

The knockdown of ATXN8OS promoted TAMR sensitivity in vivo. MCF-7 cells stably transduced with sh-NC or sh-ATXN8OS were subcutaneously inoculated into the left flank of nude mice, followed by the administration of TAMR (50 mg/kg) every 5 days after 5 days of implantation (n = 9 each group). Thirty-five days after injection, all mice were killed to remove the tumor tissues. (a) Tumor volume was assessed every 1 week after first injection. (b) Tumor weight was weighed. The expression levels of ATXN8OS (c), miR-16-5p (d), and VASP (e and f) were determined in xenograft tissues by qRT-PCR and western blot. *P < 0.05.

4 Discussion

TAMR resistance is still an obstacle in the management of BC, leading to chemotherapy failure. Thus, identifying novel therapeutic targets is very imperative for improving BC treatment. LncRNAs have recently been found to have relevance to the development of TAMR resistance in BC, offering a possibility of lncRNAs as biomarkers for therapy and prognosis of chemoresistant BC [4,21]. In the present study, we first showed that ATXN8OS depletion promoted TAMR sensitivity in BC in vitro and in vivo partially through sponging miR-16-5p and modulating VASP expression.

In the current work, our data showed a significant upregulation of ATXN8OS in BC tissues and cells, consistent with a previous report [11]. Considering the oncogenic effect of ATXN8OS in BC [11], our study started from the hypothesis that ATXN8OS accelerated BC resistance to TAMR. To confirm this, loss-of-function experiments were carried out using si-ATXN8OS before TAMR treatment, followed by the determination of IC50 value, cell apoptosis, and autophagy. Bcl-2 and Bax levels are closely related to the apoptosis in tumor cells [22]. The LC3 II/I ratio and Beclin 1 level are widely acknowledged to reflect the activity of autophagy [23]. In this study, we were the first to uncover that ATXN8OS knockdown augmented TAMR sensitivity in BC cells through enhancing apoptosis and repressing autophagy. Similar to our findings, Wang et al. reported that lncRNA H9 augmented BC cell resistance to TAMR by inducing autophagy [24]. Li et al. discovered that the silencing of lncRNA regulator of reprogramming (ROR) regulated autophagy to abate TAMR resistance in BC cells [25].

It is widely acknowledged that lncRNAs exert their biological functions through acting as a molecular sponge of miRNAs. Therefore, starBase 3.0 software was used to help identify the endogenous interacted miRNAs of ATXN8OS. Among these predicted candidates, miR-16-5p was of interest in the present study owing to its tumor suppressive role in many human cancers, such as malignant mesothelioma, papillary thyroid carcinoma, and hepatocellular carcinoma [26,27,28]. Moreover, Zhang et al. reported that circulating miR-16-5p could act as a potential biomarker for progression indication in gastric cancer [29]. A previous study uncovered that miR-16-5p was a stably expressed housekeeping miRNA in BC tissues from primary tumor to metastatic sites [30]. Subsequently, we first verified that ATXN8OS sequestered miR-16-5p through acting as a miR-16-5p sponge. Our data also showed a significant downregulation of miR-16-5p in BC tissues and cells, in line with earlier researches [13,14]. We further uncovered that miR-16-5p overexpression promoted TAMR sensitivity in BC cells. Previous reports had discovered that several other miRNAs, such as miR-320a and miR-873, could sensitize TAMR-resistant BC cell to TAMR [31,32]. In this study, we also substantiated that the promotional effect of ATXN8OS knockdown on TAMR sensitivity was abolished by restored expression of miR-16-5p in BC cells. In other words, ATXN8OS knockdown enhanced TAMR sensitivity by upregulating miR-16-5p. Deng et al. underscored that ATXN8OS facilitated BC progression through acting as a molecular sponge of miR-204 [11].

Then, we used starBase 3.0 software to help identify the molecular targets of miR-16-5p in humans. Among these candidates, VASP was selected for further research because of its promotional effect on BC cell migration and metastasis [18,33,34]. In addition, the phosphorylation of VASP was reported to drive tumor cell migration and platinum resistance in ovarian cancer [35]. VASP was involved in the regulatory network of miRNA–mRNA to contribute to the development of gemcitabine resistance in human pancreatic cancer cells [36]. In the present study, we were the first to confirm that VASP was directly targeted and repressed by miR-16-5p. Our data also showed that VASP mediated the promotional effect of miR-16-5p overexpression on TAMR sensitivity in BC cells. Moreover, our study first suggested that ATXN8OS modulated VASP expression through acting as a ceRNA of miR-16-5p.

Finally, the xenograft model assay showed that ATXN8OS knockdown enhanced TAMR sensitivity in vivo. Moreover, ATXN8OS knockdown triggered an increase in miR-16-5p expression and a decrease in VASP level, eliciting that the knockdown of ATXN8OS augmented BC TAMR sensitivity in vivo possibly through miR-16-5p/VASP axis. Therefore, more researches about the role of VASP and the regulatory relationship between ATXN8OS/miR-16-5p axis and VASP on BC TAMR resistance will be performed in further work.

5 Conclusion

In conclusion, our study suggested that ATXN8OS knockdown promoted TAMR sensitivity in BC cells in vitro and in vivo at least partially through miR-16-5p/VASP axis. Our findings highlighted a novel promising therapeutic target for improving the clinical benefits of TAMR treatment in BC patients.

tel: +86-18-01-763-4978

Acknowledgments

Not applicable.

  1. Competing interests: The authors declare that they have no competing interests.

  2. Funding: No funding was received.

  3. Availability of data and materials: The analyzed data sets generated during the present study are available from the corresponding author on reasonable request.

References

[1] Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394–424.10.3322/caac.21492Suche in Google Scholar

[2] Cuzick J, Sestak I, Cawthorn S, Hamed H, Holli K, Howell A, et al. Tamoxifen for prevention of breast cancer: extended long-term follow-up of the IBIS-I breast cancer prevention trial. Lancet Oncol. 2015;16(1):67–75.10.1016/S1470-2045(14)71171-4Suche in Google Scholar

[3] Bhatt S, Stender JD, Joshi S, Wu G, Katzenellenbogen BS. OCT-4: a novel estrogen receptor-alpha collaborator that promotes tamoxifen resistance in breast cancer cells. Oncogene. 2016;35(44):5722–34.10.1038/onc.2016.105Suche in Google Scholar PubMed

[4] Xue X, Yang YA, Zhang A, Fong KW, Kim J, Song B, et al. LncRNA HOTAIR enhances ER signaling and confers tamoxifen resistance in breast cancer. Oncogene. 2016;35(21):2746–55.10.1038/onc.2015.340Suche in Google Scholar PubMed PubMed Central

[5] Huarte M. The emerging role of lncRNAs in cancer. Nat Med. 2015;21(11):1253–61.10.1038/nm.3981Suche in Google Scholar PubMed

[6] Niknafs YS, Han S, Ma T, Speers C, Zhang C, Wilder-Romans K, et al. The lncRNA landscape of breast cancer reveals a role for DSCAM-AS1 in breast cancer progression. Nat Commun. 2016;7:12791.10.1038/ncomms12791Suche in Google Scholar PubMed PubMed Central

[7] Farhan M, Aatif M, Dandawate P, Ahmad A. Non-coding RNAs as mediators of tamoxifen resistance in breast cancers. Adv Exp Med Biol. 2019;1152(229):41.10.1007/978-3-030-20301-6_11Suche in Google Scholar PubMed

[8] Ma Y, Bu D, Long J, Chai W, Dong J. LncRNA DSCAM-AS1 acts as a sponge of miR-137 to enhance Tamoxifen resistance in breast cancer. J Cell Physiol. 2019;234(3):2880–94.10.1002/jcp.27105Suche in Google Scholar PubMed

[9] Moseley ML, Zu T, Ikeda Y, Gao W, Mosemiller AK, Daughters RS, et al. Bidirectional expression of CUG and CAG expansion transcripts and intranuclear polyglutamine inclusions in spinocerebellar ataxia type 8. Nat Genet. 2006;38(7):758–69.10.1038/ng1827Suche in Google Scholar PubMed

[10] Mao Y, Dong L, Zheng Y, Dong J, Li X. Prediction of recurrence in cervical cancer using a nine-lncRNA signature. Front Genet. 2019;10:284.10.3389/fgene.2019.00284Suche in Google Scholar PubMed PubMed Central

[11] Deng Z, Cai H, Lin L, Zhu L, Wu W, Yang S, et al. lncRNA ATXN8OS promotes breast cancer by sequestering miR204. Mol Med Rep. 2019;20(2):1057–64.10.3892/mmr.2019.10367Suche in Google Scholar

[12] Guo H, Ingolia NT, Weissman JS, Bartel DP. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature. 2010;466(7308):835–40.10.1038/nature09267Suche in Google Scholar PubMed PubMed Central

[13] Ruan L, Qian X. MiR-16-5p inhibits breast cancer by reducing AKT3 to restrain NF-kappaB pathway. Biosci Rep. 2019;39(8):BSR20191611.10.1042/BSR20191611Suche in Google Scholar PubMed PubMed Central

[14] Patel N, Garikapati KR, Ramaiah MJ, Polavarapu KK, Bhadra U, Bhadra MP. miR-15a/miR-16 induces mitochondrial dependent apoptosis in breast cancer cells by suppressing oncogene BMI1. Life Sci. 2016;164:60–70.10.1016/j.lfs.2016.08.028Suche in Google Scholar PubMed

[15] Gu J, Wang Y, Wang X, Zhou D, Shao C, Zhou M, et al. Downregulation of lncRNA GAS5 confers tamoxifen resistance by activating miR-222 in breast cancer. Cancer Lett. 2018;434:1–10.10.1016/j.canlet.2018.06.039Suche in Google Scholar PubMed

[16] Zhang HY, Liang F, Zhang JW, Wang F, Wang L, Kang XG. Effects of long noncoding RNA-ROR on tamoxifen resistance of breast cancer cells by regulating microRNA-205. Cancer Chemother Pharmacol. 2017;79(2):327–37.10.1007/s00280-016-3208-2Suche in Google Scholar PubMed

[17] Wu J, Yuan P, Mao Q, Lu P, Xie T, Yang H, et al. miR-613 inhibits proliferation and invasion of breast cancer cell via VEGFA. Biochem Biophys Res Commun. 2016;478(1):274–8.10.1016/j.bbrc.2016.07.031Suche in Google Scholar PubMed

[18] Han G, Fan B, Zhang Y, Zhou X, Wang Y, Dong H, et al. Positive regulation of migration and invasion by vasodilator-stimulated phosphoprotein via Rac1 pathway in human breast cancer cells. Oncol Rep. 2008;20(4):929–39.Suche in Google Scholar

[19] Li Y, Huang J, Yang D, Xiang S, Sun J, Li H, et al. Expression patterns of E2F transcription factors and their potential prognostic roles in breast cancer. Oncol Lett. 2018;15(6):9216–30.10.3892/ol.2018.8514Suche in Google Scholar PubMed PubMed Central

[20] Chen X, Yun J, Fei F, Yi J, Tian R, Li S, et al. Prognostic value of nuclear hepatoma-derived growth factor (HDGF) localization in patients with breast cancer. Pathol Res Pract. 2012;208(8):437–43.10.1016/j.prp.2012.03.004Suche in Google Scholar PubMed

[21] Zheng L, Li X, Meng X, Chou J, Hu J, Zhang F, et al. Competing endogenous RNA networks of CYP4Z1 and pseudogene CYP4Z2P confer tamoxifen resistance in breast cancer. Mol Cell Endocrinol. 2016;427:133–42.10.1016/j.mce.2016.03.012Suche in Google Scholar PubMed

[22] Bagci EZ, Vodovotz Y, Billiar TR, Ermentrout GB, Bahar I. Bistability in apoptosis: roles of bax, bcl-2, and mitochondrial permeability transition pores. Biophys J. 2006;90(5):1546–59.10.1529/biophysj.105.068122Suche in Google Scholar PubMed PubMed Central

[23] Barth S, Glick D, Macleod KF. Autophagy: assays and artifacts. J Pathol. 2010;221(2):117–24.10.1002/path.2694Suche in Google Scholar PubMed PubMed Central

[24] Wang J, Xie S, Yang J, Xiong H, Jia Y, Zhou Y, et al. The long noncoding RNA H19 promotes tamoxifen resistance in breast cancer via autophagy. J Hematol Oncol. 2019;12(1):81.10.1186/s13045-019-0747-0Suche in Google Scholar PubMed PubMed Central

[25] Li Y, Jiang B, Zhu H, Qu X, Zhao L, Tan Y, et al. Inhibition of long non-coding RNA ROR reverses resistance to Tamoxifen by inducing autophagy in breast cancer. Tumour Biol. 2017;39(6):1010428317705790.10.1177/1010428317705790Suche in Google Scholar PubMed

[26] Munson PB, Hall EM, Farina NH, Pass HI, Shukla A. Exosomal miR-16-5p as a target for malignant mesothelioma. Sci Rep. 2019;9(1):11688.10.1038/s41598-019-48133-0Suche in Google Scholar PubMed PubMed Central

[27] Feng X, Dong X, Wu D, Zhao H, Xu C, Li H. Long noncoding RNA small nucleolar RNA host gene 12 promotes papillary thyroid carcinoma cell growth and invasion by targeting miR-16-5p. Histol Histopathol. 2020;35(2):217–24.Suche in Google Scholar

[28] Liu Z, Wang Y, Wang L, Yao B, Sun L, Liu R, et al. Long non-coding RNA AGAP2-AS1, functioning as a competitive endogenous RNA, upregulates ANXA11 expression by sponging miR-16-5p and promotes proliferation and metastasis in hepatocellular carcinoma. J Exp Clin Cancer Res. 2019;38(1):194.10.1186/s13046-019-1188-xSuche in Google Scholar PubMed PubMed Central

[29] Zhang J, Song Y, Zhang C, Zhi X, Fu H, Ma Y, et al. Circulating MiR-16-5p and MiR-19b-3p as two novel potential biomarkers to indicate progression of gastric cancer. Theranostics. 2015;5(7):733–45.10.7150/thno.10305Suche in Google Scholar PubMed PubMed Central

[30] Rinnerthaler G, Hackl H, Gampenrieder SP, Hamacher F, Hufnagl C, Hauser-Kronberger C, et al. miR-16-5p is a stably-expressed housekeeping microRNA in breast cancer tissues from primary tumors and from metastatic sites. Int J Mol Sci. 2016;17(2):156.10.3390/ijms17020156Suche in Google Scholar PubMed PubMed Central

[31] Lu M, Ding K, Zhang G, Yin M, Yao G, Tian H, et al. MicroRNA-320a sensitizes tamoxifen-resistant breast cancer cells to tamoxifen by targeting ARPP-19 and ERRgamma. Sci Rep. 2015;5:8735.10.1038/srep08735Suche in Google Scholar PubMed PubMed Central

[32] Cui J, Yang Y, Li H, Leng Y, Qian K, Huang Q, et al. MiR-873 regulates ERalpha transcriptional activity and tamoxifen resistance via targeting CDK3 in breast cancer cells. Oncogene. 2015;34(30):3895–907.10.1038/onc.2014.430Suche in Google Scholar PubMed

[33] Gkretsi V, Stylianou A, Stylianopoulos T. Vasodilator-Stimulated Phosphoprotein (VASP) depletion from breast cancer MDA-MB-231 cells inhibits tumor spheroid invasion through downregulation of Migfilin, β-catenin and urokinase-plasminogen activator (uPA). Exp Cell Res. 2017;352(2):281–92.10.1016/j.yexcr.2017.02.019Suche in Google Scholar PubMed PubMed Central

[34] Zhang Y, Han G, Fan B, Zhou Y, Zhou X, Wei L, et al. Green tea (−)-epigallocatechin-3-gallate down-regulates VASP expression and inhibits breast cancer cell migration and invasion by attenuating Rac1 activity. Eur J Pharmacol. 2009;606(1–3):172–9.10.1016/j.ejphar.2008.12.033Suche in Google Scholar PubMed

[35] Wong JC, Fiscus RR. Protein kinase G-Iα hyperactivation and VASP phosphorylation in promoting ovarian cancer cell migration and platinum resistance. Ovarian Cancer-A Clin Transl Update: IntechOpen. 2013;12:251–73.Suche in Google Scholar

[36] Shen Y, Pan Y, Xu L, Chen L, Liu L, Chen H, et al. Identifying microRNA-mRNA regulatory network in gemcitabine-resistant cells derived from human pancreatic cancer cells. Tumour Biol. 2015;36(6):4525–34.10.1007/s13277-015-3097-8Suche in Google Scholar PubMed

Received: 2020-05-14
Revised: 2020-07-27
Accepted: 2020-08-07
Published Online: 2020-12-15

© 2021 Hongkai Zhang et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. Identification of ZG16B as a prognostic biomarker in breast cancer
  3. Behçet’s disease with latent Mycobacterium tuberculosis infection
  4. Erratum
  5. Erratum to “Suffering from Cerebral Small Vessel Disease with and without Metabolic Syndrome”
  6. Research Articles
  7. GPR37 promotes the malignancy of lung adenocarcinoma via TGF-β/Smad pathway
  8. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  9. Additional baricitinib loading dose improves clinical outcome in COVID-19
  10. The co-treatment of rosuvastatin with dapagliflozin synergistically inhibited apoptosis via activating the PI3K/AKt/mTOR signaling pathway in myocardial ischemia/reperfusion injury rats
  11. SLC12A8 plays a key role in bladder cancer progression and EMT
  12. LncRNA ATXN8OS enhances tamoxifen resistance in breast cancer
  13. Case Report
  14. Serratia marcescens as a cause of unfavorable outcome in the twin pregnancy
  15. Spleno-adrenal fusion mimicking an adrenal metastasis of a renal cell carcinoma: A case report and embryological background
  16. Research Articles
  17. TRIM25 contributes to the malignancy of acute myeloid leukemia and is negatively regulated by microRNA-137
  18. CircRNA circ_0004370 promotes cell proliferation, migration, and invasion and inhibits cell apoptosis of esophageal cancer via miR-1301-3p/COL1A1 axis
  19. LncRNA XIST regulates atherosclerosis progression in ox-LDL-induced HUVECs
  20. Potential role of IFN-γ and IL-5 in sepsis prediction of preterm neonates
  21. Rapid Communication
  22. COVID-19 vaccine: Call for employees in international transportation industries and international travelers as the first priority in global distribution
  23. Case Report
  24. Rare squamous cell carcinoma of the kidney with concurrent xanthogranulomatous pyelonephritis: A case report and review of the literature
  25. An infertile female delivered a baby after removal of primary renal carcinoid tumor
  26. Research Articles
  27. Hypertension, BMI, and cardiovascular and cerebrovascular diseases
  28. Case Report
  29. Coexistence of bilateral macular edema and pale optic disc in the patient with Cohen syndrome
  30. Research Articles
  31. Correlation between kinematic sagittal parameters of the cervical lordosis or head posture and disc degeneration in patients with posterior neck pain
  32. Review Articles
  33. Hepatoid adenocarcinoma of the lung: An analysis of the Surveillance, Epidemiology, and End Results (SEER) database
  34. Research Articles
  35. Thermography in the diagnosis of carpal tunnel syndrome
  36. Pemetrexed-based first-line chemotherapy had particularly prominent objective response rate for advanced NSCLC: A network meta-analysis
  37. Comparison of single and double autologous stem cell transplantation in multiple myeloma patients
  38. The influence of smoking in minimally invasive spinal fusion surgery
  39. Impact of body mass index on left atrial dimension in HOCM patients
  40. Expression and clinical significance of CMTM1 in hepatocellular carcinoma
  41. miR-142-5p promotes cervical cancer progression by targeting LMX1A through Wnt/β-catenin pathway
  42. Comparison of multiple flatfoot indicators in 5–8-year-old children
  43. Early MRI imaging and follow-up study in cerebral amyloid angiopathy
  44. Intestinal fatty acid-binding protein as a biomarker for the diagnosis of strangulated intestinal obstruction: A meta-analysis
  45. miR-128-3p inhibits apoptosis and inflammation in LPS-induced sepsis by targeting TGFBR2
  46. Dynamic perfusion CT – A promising tool to diagnose pancreatic ductal adenocarcinoma
  47. Biomechanical evaluation of self-cinching stitch techniques in rotator cuff repair: The single-loop and double-loop knot stitches
  48. Review Articles
  49. The ambiguous role of mannose-binding lectin (MBL) in human immunity
  50. Case Report
  51. Membranous nephropathy with pulmonary cryptococcosis with improved 1-year follow-up results: A case report
  52. Fertility problems in males carrying an inversion of chromosome 10
  53. Acute myeloid leukemia with leukemic pleural effusion and high levels of pleural adenosine deaminase: A case report and review of literature
  54. Metastatic renal Ewing’s sarcoma in adult woman: Case report and review of the literature
  55. Burkitt-like lymphoma with 11q aberration in a patient with AIDS and a patient without AIDS: Two cases reports and literature review
  56. Skull hemophilia pseudotumor: A case report
  57. Judicious use of low-dosage corticosteroids for non-severe COVID-19: A case report
  58. Adult-onset citrullinaemia type II with liver cirrhosis: A rare cause of hyperammonaemia
  59. Clinicopathologic features of Good’s syndrome: Two cases and literature review
  60. Fatal immune-related hepatitis with intrahepatic cholestasis and pneumonia associated with camrelizumab: A case report and literature review
  61. Research Articles
  62. Effects of hydroxyethyl starch and gelatin on the risk of acute kidney injury following orthotopic liver transplantation: A multicenter retrospective comparative clinical study
  63. Significance of nucleic acid positive anal swab in COVID-19 patients
  64. circAPLP2 promotes colorectal cancer progression by upregulating HELLS by targeting miR-335-5p
  65. Ratios between circulating myeloid cells and lymphocytes are associated with mortality in severe COVID-19 patients
  66. Risk factors of left atrial appendage thrombus in patients with non-valvular atrial fibrillation
  67. Clinical features of hypertensive patients with COVID-19 compared with a normotensive group: Single-center experience in China
  68. Surgical myocardial revascularization outcomes in Kawasaki disease: systematic review and meta-analysis
  69. Decreased chromobox homologue 7 expression is associated with epithelial–mesenchymal transition and poor prognosis in cervical cancer
  70. FGF16 regulated by miR-520b enhances the cell proliferation of lung cancer
  71. Platelet-rich fibrin: Basics of biological actions and protocol modifications
  72. Accurate diagnosis of prostate cancer using logistic regression
  73. miR-377 inhibition enhances the survival of trophoblast cells via upregulation of FNDC5 in gestational diabetes mellitus
  74. Prognostic significance of TRIM28 expression in patients with breast carcinoma
  75. Integrative bioinformatics analysis of KPNA2 in six major human cancers
  76. Exosomal-mediated transfer of OIP5-AS1 enhanced cell chemoresistance to trastuzumab in breast cancer via up-regulating HMGB3 by sponging miR-381-3p
  77. A four-lncRNA signature for predicting prognosis of recurrence patients with gastric cancer
  78. Knockdown of circ_0003204 alleviates oxidative low-density lipoprotein-induced human umbilical vein endothelial cells injury: Circulating RNAs could explain atherosclerosis disease progression
  79. Propofol postpones colorectal cancer development through circ_0026344/miR-645/Akt/mTOR signal pathway
  80. Knockdown of lncRNA TapSAKI alleviates LPS-induced injury in HK-2 cells through the miR-205/IRF3 pathway
  81. COVID-19 severity in relation to sociodemographics and vitamin D use
  82. Clinical analysis of 11 cases of nocardiosis
  83. Cis-regulatory elements in conserved non-coding sequences of nuclear receptor genes indicate for crosstalk between endocrine systems
  84. Four long noncoding RNAs act as biomarkers in lung adenocarcinoma
  85. Real-world evidence of cytomegalovirus reactivation in non-Hodgkin lymphomas treated with bendamustine-containing regimens
  86. Relation between IL-8 level and obstructive sleep apnea syndrome
  87. circAGFG1 sponges miR-28-5p to promote non-small-cell lung cancer progression through modulating HIF-1α level
  88. Nomogram prediction model for renal anaemia in IgA nephropathy patients
  89. Effect of antibiotic use on the efficacy of nivolumab in the treatment of advanced/metastatic non-small cell lung cancer: A meta-analysis
  90. NDRG2 inhibition facilitates angiogenesis of hepatocellular carcinoma
  91. A nomogram for predicting metabolic steatohepatitis: The combination of NAMPT, RALGDS, GADD45B, FOSL2, RTP3, and RASD1
  92. Clinical and prognostic features of MMP-2 and VEGF in AEG patients
  93. The value of miR-510 in the prognosis and development of colon cancer
  94. Functional implications of PABPC1 in the development of ovarian cancer
  95. Prognostic value of preoperative inflammation-based predictors in patients with bladder carcinoma after radical cystectomy
  96. Sublingual immunotherapy increases Treg/Th17 ratio in allergic rhinitis
  97. Prediction of improvement after anterior cruciate ligament reconstruction
  98. Effluent Osteopontin levels reflect the peritoneal solute transport rate
  99. circ_0038467 promotes PM2.5-induced bronchial epithelial cell dysfunction
  100. Significance of miR-141 and miR-340 in cervical squamous cell carcinoma
  101. Association between hair cortisol concentration and metabolic syndrome
  102. Microvessel density as a prognostic indicator of prostate cancer: A systematic review and meta-analysis
  103. Characteristics of BCR–ABL gene variants in patients of chronic myeloid leukemia
  104. Knee alterations in rheumatoid arthritis: Comparison of US and MRI
  105. Long non-coding RNA TUG1 aggravates cerebral ischemia and reperfusion injury by sponging miR-493-3p/miR-410-3p
  106. lncRNA MALAT1 regulated ATAD2 to facilitate retinoblastoma progression via miR-655-3p
  107. Development and validation of a nomogram for predicting severity in patients with hemorrhagic fever with renal syndrome: A retrospective study
  108. Analysis of COVID-19 outbreak origin in China in 2019 using differentiation method for unusual epidemiological events
  109. Laparoscopic versus open major liver resection for hepatocellular carcinoma: A case-matched analysis of short- and long-term outcomes
  110. Travelers’ vaccines and their adverse events in Nara, Japan
  111. Association between Tfh and PGA in children with Henoch–Schönlein purpura
  112. Can exchange transfusion be replaced by double-LED phototherapy?
  113. circ_0005962 functions as an oncogene to aggravate NSCLC progression
  114. Circular RNA VANGL1 knockdown suppressed viability, promoted apoptosis, and increased doxorubicin sensitivity through targeting miR-145-5p to regulate SOX4 in bladder cancer cells
  115. Serum intact fibroblast growth factor 23 in healthy paediatric population
  116. Algorithm of rational approach to reconstruction in Fournier’s disease
  117. A meta-analysis of exosome in the treatment of spinal cord injury
  118. Src-1 and SP2 promote the proliferation and epithelial–mesenchymal transition of nasopharyngeal carcinoma
  119. Dexmedetomidine may decrease the bupivacaine toxicity to heart
  120. Hypoxia stimulates the migration and invasion of osteosarcoma via up-regulating the NUSAP1 expression
  121. Long noncoding RNA XIST knockdown relieves the injury of microglia cells after spinal cord injury by sponging miR-219-5p
  122. External fixation via the anterior inferior iliac spine for proximal femoral fractures in young patients
  123. miR-128-3p reduced acute lung injury induced by sepsis via targeting PEL12
  124. HAGLR promotes neuron differentiation through the miR-130a-3p-MeCP2 axis
  125. Phosphoglycerate mutase 2 is elevated in serum of patients with heart failure and correlates with the disease severity and patient’s prognosis
  126. Cell population data in identifying active tuberculosis and community-acquired pneumonia
  127. Prognostic value of microRNA-4521 in non-small cell lung cancer and its regulatory effect on tumor progression
  128. Mean platelet volume and red blood cell distribution width is associated with prognosis in premature neonates with sepsis
  129. 3D-printed porous scaffold promotes osteogenic differentiation of hADMSCs
  130. Association of gene polymorphisms with women urinary incontinence
  131. Influence of COVID-19 pandemic on stress levels of urologic patients
  132. miR-496 inhibits proliferation via LYN and AKT pathway in gastric cancer
  133. miR-519d downregulates LEP expression to inhibit preeclampsia development
  134. Comparison of single- and triple-port VATS for lung cancer: A meta-analysis
  135. Fluorescent light energy modulates healing in skin grafted mouse model
  136. Silencing CDK6-AS1 inhibits LPS-induced inflammatory damage in HK-2 cells
  137. Predictive effect of DCE-MRI and DWI in brain metastases from NSCLC
  138. Severe postoperative hyperbilirubinemia in congenital heart disease
  139. Baicalin improves podocyte injury in rats with diabetic nephropathy by inhibiting PI3K/Akt/mTOR signaling pathway
  140. Clinical factors predicting ureteral stent failure in patients with external ureteral compression
  141. Novel H2S donor proglumide-ADT-OH protects HUVECs from ox-LDL-induced injury through NF-κB and JAK/SATA pathway
  142. Triple-Endobutton and clavicular hook: A propensity score matching analysis
  143. Long noncoding RNA MIAT inhibits the progression of diabetic nephropathy and the activation of NF-κB pathway in high glucose-treated renal tubular epithelial cells by the miR-182-5p/GPRC5A axis
  144. Serum exosomal miR-122-5p, GAS, and PGR in the non-invasive diagnosis of CAG
  145. miR-513b-5p inhibits the proliferation and promotes apoptosis of retinoblastoma cells by targeting TRIB1
  146. Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p
  147. The diagnostic and prognostic value of miR-92a in gastric cancer: A systematic review and meta-analysis
  148. Prognostic value of α2δ1 in hypopharyngeal carcinoma: A retrospective study
  149. No significant benefit of moderate-dose vitamin C on severe COVID-19 cases
  150. circ_0000467 promotes the proliferation, metastasis, and angiogenesis in colorectal cancer cells through regulating KLF12 expression by sponging miR-4766-5p
  151. Downregulation of RAB7 and Caveolin-1 increases MMP-2 activity in renal tubular epithelial cells under hypoxic conditions
  152. Educational program for orthopedic surgeons’ influences for osteoporosis
  153. Expression and function analysis of CRABP2 and FABP5, and their ratio in esophageal squamous cell carcinoma
  154. GJA1 promotes hepatocellular carcinoma progression by mediating TGF-β-induced activation and the epithelial–mesenchymal transition of hepatic stellate cells
  155. lncRNA-ZFAS1 promotes the progression of endometrial carcinoma by targeting miR-34b to regulate VEGFA expression
  156. Anticoagulation is the answer in treating noncritical COVID-19 patients
  157. Effect of late-onset hemorrhagic cystitis on PFS after haplo-PBSCT
  158. Comparison of Dako HercepTest and Ventana PATHWAY anti-HER2 (4B5) tests and their correlation with silver in situ hybridization in lung adenocarcinoma
  159. VSTM1 regulates monocyte/macrophage function via the NF-κB signaling pathway
  160. Comparison of vaginal birth outcomes in midwifery-led versus physician-led setting: A propensity score-matched analysis
  161. Treatment of osteoporosis with teriparatide: The Slovenian experience
  162. New targets of morphine postconditioning protection of the myocardium in ischemia/reperfusion injury: Involvement of HSP90/Akt and C5a/NF-κB
  163. Superenhancer–transcription factor regulatory network in malignant tumors
  164. β-Cell function is associated with osteosarcopenia in middle-aged and older nonobese patients with type 2 diabetes: A cross-sectional study
  165. Clinical features of atypical tuberculosis mimicking bacterial pneumonia
  166. Proteoglycan-depleted regions of annular injury promote nerve ingrowth in a rabbit disc degeneration model
  167. Effect of electromagnetic field on abortion: A systematic review and meta-analysis
  168. miR-150-5p affects AS plaque with ASMC proliferation and migration by STAT1
  169. MALAT1 promotes malignant pleural mesothelioma by sponging miR-141-3p
  170. Effects of remifentanil and propofol on distant organ lung injury in an ischemia–reperfusion model
  171. miR-654-5p promotes gastric cancer progression via the GPRIN1/NF-κB pathway
  172. Identification of LIG1 and LIG3 as prognostic biomarkers in breast cancer
  173. MitoQ inhibits hepatic stellate cell activation and liver fibrosis by enhancing PINK1/parkin-mediated mitophagy
  174. Dissecting role of founder mutation p.V727M in GNE in Indian HIBM cohort
  175. circATP2A2 promotes osteosarcoma progression by upregulating MYH9
  176. Prognostic role of oxytocin receptor in colon adenocarcinoma
  177. Review Articles
  178. The function of non-coding RNAs in idiopathic pulmonary fibrosis
  179. Efficacy and safety of therapeutic plasma exchange in stiff person syndrome
  180. Role of cesarean section in the development of neonatal gut microbiota: A systematic review
  181. Small cell lung cancer transformation during antitumor therapies: A systematic review
  182. Research progress of gut microbiota and frailty syndrome
  183. Recommendations for outpatient activity in COVID-19 pandemic
  184. Rapid Communication
  185. Disparity in clinical characteristics between 2019 novel coronavirus pneumonia and leptospirosis
  186. Use of microspheres in embolization for unruptured renal angiomyolipomas
  187. COVID-19 cases with delayed absorption of lung lesion
  188. A triple combination of treatments on moderate COVID-19
  189. Social networks and eating disorders during the Covid-19 pandemic
  190. Letter
  191. COVID-19, WHO guidelines, pedagogy, and respite
  192. Inflammatory factors in alveolar lavage fluid from severe COVID-19 pneumonia: PCT and IL-6 in epithelial lining fluid
  193. COVID-19: Lessons from Norway tragedy must be considered in vaccine rollout planning in least developed/developing countries
  194. What is the role of plasma cell in the lamina propria of terminal ileum in Good’s syndrome patient?
  195. Case Report
  196. Rivaroxaban triggered multifocal intratumoral hemorrhage of the cabozantinib-treated diffuse brain metastases: A case report and review of literature
  197. CTU findings of duplex kidney in kidney: A rare duplicated renal malformation
  198. Synchronous primary malignancy of colon cancer and mantle cell lymphoma: A case report
  199. Sonazoid-enhanced ultrasonography and pathologic characters of CD68 positive cell in primary hepatic perivascular epithelioid cell tumors: A case report and literature review
  200. Persistent SARS-CoV-2-positive over 4 months in a COVID-19 patient with CHB
  201. Pulmonary parenchymal involvement caused by Tropheryma whipplei
  202. Mediastinal mixed germ cell tumor: A case report and literature review
  203. Ovarian female adnexal tumor of probable Wolffian origin – Case report
  204. Rare paratesticular aggressive angiomyxoma mimicking an epididymal tumor in an 82-year-old man: Case report
  205. Perimenopausal giant hydatidiform mole complicated with preeclampsia and hyperthyroidism: A case report and literature review
  206. Primary orbital ganglioneuroblastoma: A case report
  207. Primary aortic intimal sarcoma masquerading as intramural hematoma
  208. Sustained false-positive results for hepatitis A virus immunoglobulin M: A case report and literature review
  209. Peritoneal loose body presenting as a hepatic mass: A case report and review of the literature
  210. Chondroblastoma of mandibular condyle: Case report and literature review
  211. Trauma-induced complete pacemaker lead fracture 8 months prior to hospitalization: A case report
  212. Primary intradural extramedullary extraosseous Ewing’s sarcoma/peripheral primitive neuroectodermal tumor (PIEES/PNET) of the thoracolumbar spine: A case report and literature review
  213. Computer-assisted preoperative planning of reduction of and osteosynthesis of scapular fracture: A case report
  214. High quality of 58-month life in lung cancer patient with brain metastases sequentially treated with gefitinib and osimertinib
  215. Rapid response of locally advanced oral squamous cell carcinoma to apatinib: A case report
  216. Retrieval of intrarenal coiled and ruptured guidewire by retrograde intrarenal surgery: A case report and literature review
  217. Usage of intermingled skin allografts and autografts in a senior patient with major burn injury
  218. Retraction
  219. Retraction on “Dihydromyricetin attenuates inflammation through TLR4/NF-kappa B pathway”
  220. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part I
  221. An artificial immune system with bootstrap sampling for the diagnosis of recurrent endometrial cancers
  222. Breast cancer recurrence prediction with ensemble methods and cost-sensitive learning
https://doi.org/10.1515/med-2021-0012
Schlagwörter für diesen Artikel
BC; ATXN8OS; miR-16-5p; VASP; TAMR resistance
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Research Articles
  2. Identification of ZG16B as a prognostic biomarker in breast cancer
  3. Behçet’s disease with latent Mycobacterium tuberculosis infection
  4. Erratum
  5. Erratum to “Suffering from Cerebral Small Vessel Disease with and without Metabolic Syndrome”
  6. Research Articles
  7. GPR37 promotes the malignancy of lung adenocarcinoma via TGF-β/Smad pathway
  8. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  9. Additional baricitinib loading dose improves clinical outcome in COVID-19
  10. The co-treatment of rosuvastatin with dapagliflozin synergistically inhibited apoptosis via activating the PI3K/AKt/mTOR signaling pathway in myocardial ischemia/reperfusion injury rats
  11. SLC12A8 plays a key role in bladder cancer progression and EMT
  12. LncRNA ATXN8OS enhances tamoxifen resistance in breast cancer
  13. Case Report
  14. Serratia marcescens as a cause of unfavorable outcome in the twin pregnancy
  15. Spleno-adrenal fusion mimicking an adrenal metastasis of a renal cell carcinoma: A case report and embryological background
  16. Research Articles
  17. TRIM25 contributes to the malignancy of acute myeloid leukemia and is negatively regulated by microRNA-137
  18. CircRNA circ_0004370 promotes cell proliferation, migration, and invasion and inhibits cell apoptosis of esophageal cancer via miR-1301-3p/COL1A1 axis
  19. LncRNA XIST regulates atherosclerosis progression in ox-LDL-induced HUVECs
  20. Potential role of IFN-γ and IL-5 in sepsis prediction of preterm neonates
  21. Rapid Communication
  22. COVID-19 vaccine: Call for employees in international transportation industries and international travelers as the first priority in global distribution
  23. Case Report
  24. Rare squamous cell carcinoma of the kidney with concurrent xanthogranulomatous pyelonephritis: A case report and review of the literature
  25. An infertile female delivered a baby after removal of primary renal carcinoid tumor
  26. Research Articles
  27. Hypertension, BMI, and cardiovascular and cerebrovascular diseases
  28. Case Report
  29. Coexistence of bilateral macular edema and pale optic disc in the patient with Cohen syndrome
  30. Research Articles
  31. Correlation between kinematic sagittal parameters of the cervical lordosis or head posture and disc degeneration in patients with posterior neck pain
  32. Review Articles
  33. Hepatoid adenocarcinoma of the lung: An analysis of the Surveillance, Epidemiology, and End Results (SEER) database
  34. Research Articles
  35. Thermography in the diagnosis of carpal tunnel syndrome
  36. Pemetrexed-based first-line chemotherapy had particularly prominent objective response rate for advanced NSCLC: A network meta-analysis
  37. Comparison of single and double autologous stem cell transplantation in multiple myeloma patients
  38. The influence of smoking in minimally invasive spinal fusion surgery
  39. Impact of body mass index on left atrial dimension in HOCM patients
  40. Expression and clinical significance of CMTM1 in hepatocellular carcinoma
  41. miR-142-5p promotes cervical cancer progression by targeting LMX1A through Wnt/β-catenin pathway
  42. Comparison of multiple flatfoot indicators in 5–8-year-old children
  43. Early MRI imaging and follow-up study in cerebral amyloid angiopathy
  44. Intestinal fatty acid-binding protein as a biomarker for the diagnosis of strangulated intestinal obstruction: A meta-analysis
  45. miR-128-3p inhibits apoptosis and inflammation in LPS-induced sepsis by targeting TGFBR2
  46. Dynamic perfusion CT – A promising tool to diagnose pancreatic ductal adenocarcinoma
  47. Biomechanical evaluation of self-cinching stitch techniques in rotator cuff repair: The single-loop and double-loop knot stitches
  48. Review Articles
  49. The ambiguous role of mannose-binding lectin (MBL) in human immunity
  50. Case Report
  51. Membranous nephropathy with pulmonary cryptococcosis with improved 1-year follow-up results: A case report
  52. Fertility problems in males carrying an inversion of chromosome 10
  53. Acute myeloid leukemia with leukemic pleural effusion and high levels of pleural adenosine deaminase: A case report and review of literature
  54. Metastatic renal Ewing’s sarcoma in adult woman: Case report and review of the literature
  55. Burkitt-like lymphoma with 11q aberration in a patient with AIDS and a patient without AIDS: Two cases reports and literature review
  56. Skull hemophilia pseudotumor: A case report
  57. Judicious use of low-dosage corticosteroids for non-severe COVID-19: A case report
  58. Adult-onset citrullinaemia type II with liver cirrhosis: A rare cause of hyperammonaemia
  59. Clinicopathologic features of Good’s syndrome: Two cases and literature review
  60. Fatal immune-related hepatitis with intrahepatic cholestasis and pneumonia associated with camrelizumab: A case report and literature review
  61. Research Articles
  62. Effects of hydroxyethyl starch and gelatin on the risk of acute kidney injury following orthotopic liver transplantation: A multicenter retrospective comparative clinical study
  63. Significance of nucleic acid positive anal swab in COVID-19 patients
  64. circAPLP2 promotes colorectal cancer progression by upregulating HELLS by targeting miR-335-5p
  65. Ratios between circulating myeloid cells and lymphocytes are associated with mortality in severe COVID-19 patients
  66. Risk factors of left atrial appendage thrombus in patients with non-valvular atrial fibrillation
  67. Clinical features of hypertensive patients with COVID-19 compared with a normotensive group: Single-center experience in China
  68. Surgical myocardial revascularization outcomes in Kawasaki disease: systematic review and meta-analysis
  69. Decreased chromobox homologue 7 expression is associated with epithelial–mesenchymal transition and poor prognosis in cervical cancer
  70. FGF16 regulated by miR-520b enhances the cell proliferation of lung cancer
  71. Platelet-rich fibrin: Basics of biological actions and protocol modifications
  72. Accurate diagnosis of prostate cancer using logistic regression
  73. miR-377 inhibition enhances the survival of trophoblast cells via upregulation of FNDC5 in gestational diabetes mellitus
  74. Prognostic significance of TRIM28 expression in patients with breast carcinoma
  75. Integrative bioinformatics analysis of KPNA2 in six major human cancers
  76. Exosomal-mediated transfer of OIP5-AS1 enhanced cell chemoresistance to trastuzumab in breast cancer via up-regulating HMGB3 by sponging miR-381-3p
  77. A four-lncRNA signature for predicting prognosis of recurrence patients with gastric cancer
  78. Knockdown of circ_0003204 alleviates oxidative low-density lipoprotein-induced human umbilical vein endothelial cells injury: Circulating RNAs could explain atherosclerosis disease progression
  79. Propofol postpones colorectal cancer development through circ_0026344/miR-645/Akt/mTOR signal pathway
  80. Knockdown of lncRNA TapSAKI alleviates LPS-induced injury in HK-2 cells through the miR-205/IRF3 pathway
  81. COVID-19 severity in relation to sociodemographics and vitamin D use
  82. Clinical analysis of 11 cases of nocardiosis
  83. Cis-regulatory elements in conserved non-coding sequences of nuclear receptor genes indicate for crosstalk between endocrine systems
  84. Four long noncoding RNAs act as biomarkers in lung adenocarcinoma
  85. Real-world evidence of cytomegalovirus reactivation in non-Hodgkin lymphomas treated with bendamustine-containing regimens
  86. Relation between IL-8 level and obstructive sleep apnea syndrome
  87. circAGFG1 sponges miR-28-5p to promote non-small-cell lung cancer progression through modulating HIF-1α level
  88. Nomogram prediction model for renal anaemia in IgA nephropathy patients
  89. Effect of antibiotic use on the efficacy of nivolumab in the treatment of advanced/metastatic non-small cell lung cancer: A meta-analysis
  90. NDRG2 inhibition facilitates angiogenesis of hepatocellular carcinoma
  91. A nomogram for predicting metabolic steatohepatitis: The combination of NAMPT, RALGDS, GADD45B, FOSL2, RTP3, and RASD1
  92. Clinical and prognostic features of MMP-2 and VEGF in AEG patients
  93. The value of miR-510 in the prognosis and development of colon cancer
  94. Functional implications of PABPC1 in the development of ovarian cancer
  95. Prognostic value of preoperative inflammation-based predictors in patients with bladder carcinoma after radical cystectomy
  96. Sublingual immunotherapy increases Treg/Th17 ratio in allergic rhinitis
  97. Prediction of improvement after anterior cruciate ligament reconstruction
  98. Effluent Osteopontin levels reflect the peritoneal solute transport rate
  99. circ_0038467 promotes PM2.5-induced bronchial epithelial cell dysfunction
  100. Significance of miR-141 and miR-340 in cervical squamous cell carcinoma
  101. Association between hair cortisol concentration and metabolic syndrome
  102. Microvessel density as a prognostic indicator of prostate cancer: A systematic review and meta-analysis
  103. Characteristics of BCR–ABL gene variants in patients of chronic myeloid leukemia
  104. Knee alterations in rheumatoid arthritis: Comparison of US and MRI
  105. Long non-coding RNA TUG1 aggravates cerebral ischemia and reperfusion injury by sponging miR-493-3p/miR-410-3p
  106. lncRNA MALAT1 regulated ATAD2 to facilitate retinoblastoma progression via miR-655-3p
  107. Development and validation of a nomogram for predicting severity in patients with hemorrhagic fever with renal syndrome: A retrospective study
  108. Analysis of COVID-19 outbreak origin in China in 2019 using differentiation method for unusual epidemiological events
  109. Laparoscopic versus open major liver resection for hepatocellular carcinoma: A case-matched analysis of short- and long-term outcomes
  110. Travelers’ vaccines and their adverse events in Nara, Japan
  111. Association between Tfh and PGA in children with Henoch–Schönlein purpura
  112. Can exchange transfusion be replaced by double-LED phototherapy?
  113. circ_0005962 functions as an oncogene to aggravate NSCLC progression
  114. Circular RNA VANGL1 knockdown suppressed viability, promoted apoptosis, and increased doxorubicin sensitivity through targeting miR-145-5p to regulate SOX4 in bladder cancer cells
  115. Serum intact fibroblast growth factor 23 in healthy paediatric population
  116. Algorithm of rational approach to reconstruction in Fournier’s disease
  117. A meta-analysis of exosome in the treatment of spinal cord injury
  118. Src-1 and SP2 promote the proliferation and epithelial–mesenchymal transition of nasopharyngeal carcinoma
  119. Dexmedetomidine may decrease the bupivacaine toxicity to heart
  120. Hypoxia stimulates the migration and invasion of osteosarcoma via up-regulating the NUSAP1 expression
  121. Long noncoding RNA XIST knockdown relieves the injury of microglia cells after spinal cord injury by sponging miR-219-5p
  122. External fixation via the anterior inferior iliac spine for proximal femoral fractures in young patients
  123. miR-128-3p reduced acute lung injury induced by sepsis via targeting PEL12
  124. HAGLR promotes neuron differentiation through the miR-130a-3p-MeCP2 axis
  125. Phosphoglycerate mutase 2 is elevated in serum of patients with heart failure and correlates with the disease severity and patient’s prognosis
  126. Cell population data in identifying active tuberculosis and community-acquired pneumonia
  127. Prognostic value of microRNA-4521 in non-small cell lung cancer and its regulatory effect on tumor progression
  128. Mean platelet volume and red blood cell distribution width is associated with prognosis in premature neonates with sepsis
  129. 3D-printed porous scaffold promotes osteogenic differentiation of hADMSCs
  130. Association of gene polymorphisms with women urinary incontinence
  131. Influence of COVID-19 pandemic on stress levels of urologic patients
  132. miR-496 inhibits proliferation via LYN and AKT pathway in gastric cancer
  133. miR-519d downregulates LEP expression to inhibit preeclampsia development
  134. Comparison of single- and triple-port VATS for lung cancer: A meta-analysis
  135. Fluorescent light energy modulates healing in skin grafted mouse model
  136. Silencing CDK6-AS1 inhibits LPS-induced inflammatory damage in HK-2 cells
  137. Predictive effect of DCE-MRI and DWI in brain metastases from NSCLC
  138. Severe postoperative hyperbilirubinemia in congenital heart disease
  139. Baicalin improves podocyte injury in rats with diabetic nephropathy by inhibiting PI3K/Akt/mTOR signaling pathway
  140. Clinical factors predicting ureteral stent failure in patients with external ureteral compression
  141. Novel H2S donor proglumide-ADT-OH protects HUVECs from ox-LDL-induced injury through NF-κB and JAK/SATA pathway
  142. Triple-Endobutton and clavicular hook: A propensity score matching analysis
  143. Long noncoding RNA MIAT inhibits the progression of diabetic nephropathy and the activation of NF-κB pathway in high glucose-treated renal tubular epithelial cells by the miR-182-5p/GPRC5A axis
  144. Serum exosomal miR-122-5p, GAS, and PGR in the non-invasive diagnosis of CAG
  145. miR-513b-5p inhibits the proliferation and promotes apoptosis of retinoblastoma cells by targeting TRIB1
  146. Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p
  147. The diagnostic and prognostic value of miR-92a in gastric cancer: A systematic review and meta-analysis
  148. Prognostic value of α2δ1 in hypopharyngeal carcinoma: A retrospective study
  149. No significant benefit of moderate-dose vitamin C on severe COVID-19 cases
  150. circ_0000467 promotes the proliferation, metastasis, and angiogenesis in colorectal cancer cells through regulating KLF12 expression by sponging miR-4766-5p
  151. Downregulation of RAB7 and Caveolin-1 increases MMP-2 activity in renal tubular epithelial cells under hypoxic conditions
  152. Educational program for orthopedic surgeons’ influences for osteoporosis
  153. Expression and function analysis of CRABP2 and FABP5, and their ratio in esophageal squamous cell carcinoma
  154. GJA1 promotes hepatocellular carcinoma progression by mediating TGF-β-induced activation and the epithelial–mesenchymal transition of hepatic stellate cells
  155. lncRNA-ZFAS1 promotes the progression of endometrial carcinoma by targeting miR-34b to regulate VEGFA expression
  156. Anticoagulation is the answer in treating noncritical COVID-19 patients
  157. Effect of late-onset hemorrhagic cystitis on PFS after haplo-PBSCT
  158. Comparison of Dako HercepTest and Ventana PATHWAY anti-HER2 (4B5) tests and their correlation with silver in situ hybridization in lung adenocarcinoma
  159. VSTM1 regulates monocyte/macrophage function via the NF-κB signaling pathway
  160. Comparison of vaginal birth outcomes in midwifery-led versus physician-led setting: A propensity score-matched analysis
  161. Treatment of osteoporosis with teriparatide: The Slovenian experience
  162. New targets of morphine postconditioning protection of the myocardium in ischemia/reperfusion injury: Involvement of HSP90/Akt and C5a/NF-κB
  163. Superenhancer–transcription factor regulatory network in malignant tumors
  164. β-Cell function is associated with osteosarcopenia in middle-aged and older nonobese patients with type 2 diabetes: A cross-sectional study
  165. Clinical features of atypical tuberculosis mimicking bacterial pneumonia
  166. Proteoglycan-depleted regions of annular injury promote nerve ingrowth in a rabbit disc degeneration model
  167. Effect of electromagnetic field on abortion: A systematic review and meta-analysis
  168. miR-150-5p affects AS plaque with ASMC proliferation and migration by STAT1
  169. MALAT1 promotes malignant pleural mesothelioma by sponging miR-141-3p
  170. Effects of remifentanil and propofol on distant organ lung injury in an ischemia–reperfusion model
  171. miR-654-5p promotes gastric cancer progression via the GPRIN1/NF-κB pathway
  172. Identification of LIG1 and LIG3 as prognostic biomarkers in breast cancer
  173. MitoQ inhibits hepatic stellate cell activation and liver fibrosis by enhancing PINK1/parkin-mediated mitophagy
  174. Dissecting role of founder mutation p.V727M in GNE in Indian HIBM cohort
  175. circATP2A2 promotes osteosarcoma progression by upregulating MYH9
  176. Prognostic role of oxytocin receptor in colon adenocarcinoma
  177. Review Articles
  178. The function of non-coding RNAs in idiopathic pulmonary fibrosis
  179. Efficacy and safety of therapeutic plasma exchange in stiff person syndrome
  180. Role of cesarean section in the development of neonatal gut microbiota: A systematic review
  181. Small cell lung cancer transformation during antitumor therapies: A systematic review
  182. Research progress of gut microbiota and frailty syndrome
  183. Recommendations for outpatient activity in COVID-19 pandemic
  184. Rapid Communication
  185. Disparity in clinical characteristics between 2019 novel coronavirus pneumonia and leptospirosis
  186. Use of microspheres in embolization for unruptured renal angiomyolipomas
  187. COVID-19 cases with delayed absorption of lung lesion
  188. A triple combination of treatments on moderate COVID-19
  189. Social networks and eating disorders during the Covid-19 pandemic
  190. Letter
  191. COVID-19, WHO guidelines, pedagogy, and respite
  192. Inflammatory factors in alveolar lavage fluid from severe COVID-19 pneumonia: PCT and IL-6 in epithelial lining fluid
  193. COVID-19: Lessons from Norway tragedy must be considered in vaccine rollout planning in least developed/developing countries
  194. What is the role of plasma cell in the lamina propria of terminal ileum in Good’s syndrome patient?
  195. Case Report
  196. Rivaroxaban triggered multifocal intratumoral hemorrhage of the cabozantinib-treated diffuse brain metastases: A case report and review of literature
  197. CTU findings of duplex kidney in kidney: A rare duplicated renal malformation
  198. Synchronous primary malignancy of colon cancer and mantle cell lymphoma: A case report
  199. Sonazoid-enhanced ultrasonography and pathologic characters of CD68 positive cell in primary hepatic perivascular epithelioid cell tumors: A case report and literature review
  200. Persistent SARS-CoV-2-positive over 4 months in a COVID-19 patient with CHB
  201. Pulmonary parenchymal involvement caused by Tropheryma whipplei
  202. Mediastinal mixed germ cell tumor: A case report and literature review
  203. Ovarian female adnexal tumor of probable Wolffian origin – Case report
  204. Rare paratesticular aggressive angiomyxoma mimicking an epididymal tumor in an 82-year-old man: Case report
  205. Perimenopausal giant hydatidiform mole complicated with preeclampsia and hyperthyroidism: A case report and literature review
  206. Primary orbital ganglioneuroblastoma: A case report
  207. Primary aortic intimal sarcoma masquerading as intramural hematoma
  208. Sustained false-positive results for hepatitis A virus immunoglobulin M: A case report and literature review
  209. Peritoneal loose body presenting as a hepatic mass: A case report and review of the literature
  210. Chondroblastoma of mandibular condyle: Case report and literature review
  211. Trauma-induced complete pacemaker lead fracture 8 months prior to hospitalization: A case report
  212. Primary intradural extramedullary extraosseous Ewing’s sarcoma/peripheral primitive neuroectodermal tumor (PIEES/PNET) of the thoracolumbar spine: A case report and literature review
  213. Computer-assisted preoperative planning of reduction of and osteosynthesis of scapular fracture: A case report
  214. High quality of 58-month life in lung cancer patient with brain metastases sequentially treated with gefitinib and osimertinib
  215. Rapid response of locally advanced oral squamous cell carcinoma to apatinib: A case report
  216. Retrieval of intrarenal coiled and ruptured guidewire by retrograde intrarenal surgery: A case report and literature review
  217. Usage of intermingled skin allografts and autografts in a senior patient with major burn injury
  218. Retraction
  219. Retraction on “Dihydromyricetin attenuates inflammation through TLR4/NF-kappa B pathway”
  220. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part I
  221. An artificial immune system with bootstrap sampling for the diagnosis of recurrent endometrial cancers
  222. Breast cancer recurrence prediction with ensemble methods and cost-sensitive learning
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 19.9.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2021-0012/html
Button zum nach oben scrollen