Startseite Naturwissenschaften Two mixed-ligand coordination polymers based on 2,5-thiophenedicarboxylic acid and flexible N-donor ligands: the protective effect on periodontitis via reducing the release of IL-1β and TNF-α
Artikel Open Access

Two mixed-ligand coordination polymers based on 2,5-thiophenedicarboxylic acid and flexible N-donor ligands: the protective effect on periodontitis via reducing the release of IL-1β and TNF-α

Dieser Artikel wurde zurückgezogen. Rücknahme-Notiz.
  • Shao-Hsuan Wu und Jun-Hui Huang EMAIL logo
Veröffentlicht/Copyright: 21. April 2020

Abstract

Two novel mixed-ligand coordination polymers, {[Co(tdc)(btrp)]·0.67DMF} n (1) and {[Zn2(bimb)2(tdc)2]·2H2O} n (2) involving 2,5-thiophenedicarboxylate (H2tdc), and bitopic flexible N-donor ligands, 1,3-bis(1,2,4-triazol-1-yl)propane (btrp) and 1,4-bis((1H-benzo[d]imidazol-1-yl)methyl)benzene (bimb), have been synthesized by the hydrothermal method and characterized via IR, elemental analysis, thermal analysis, and powder X-ray diffraction. The biological functional studies were performed; the treatment activity of the compounds on periodontitis and the specific mechanism was explored. First, the real-time RT-PCR was carried out to determine the inflammatory genes nf-κb and p53 relative expression in periodontal mucosal cells after treating with compounds 1 and 2. Then, the level of the inflammatory cytokine in the gingival crevicular fluid after treating with compounds was also determined by the ELISA detection kit.

1 Introduction

Periodontitis is one of the most common oral diseases worldwide. Studies have shown that the invaded pathogens could adhere to the gums and periodontal tissues, multiply, grow, and the metabolic substance produced by the invaded pathogens can activate the immune system, causing edema and bleeding of soft tissue, and formation of periodontal pockets [1,2]. The biggest hidden danger of periodontitis is that periodontitis can induce other systems disease. According to related researches, periodontitis has a certain correlation with the occurrence of diabetes and cardiovascular diseases, and it has a potential and profound threat to human health [3].

In recent years, the design and synthesis of coordination polymers (CPs) have attracted much attention due to their fascinating molecular topologies and potential applications in catalysis, molecular detection, microelectronics, ion exchange, and nonlinear optics [4,5,6,7]. In general, the structural diversity of these crystal materials is decided by many factors such as counterions, templates, metal coordination ratio, metal ions, the value of pH, and the coordination of organic ligands [8,9,10]. In these specific strategies, the reasonable selection of the functional group, rigidity, and length of co-ligand or organic ligand is very significant for structure-controlled CPs assembly, and many important works have been completed via utilizing this strategy [11,12,13]. In general, organic ligands with curved skeletons, for example, quadrilateral, triangular, and V-shaped, are ideal for the construction of interpenetrating, highly connected, or helical coordination systems because of their versatile bridging methods and curved skeletons. In addition, the carboxylic acid groups are the good hydrogen-bond donor and hydrogen-bond acceptor, which are decided by the deprotonation degree. Among these, 3,3′,4,4′-benzophenone tetracarboxylic acid, 1,2,4,5-benzenetetracarboxylic acid, 2,5-thiophene-dicarboxylic acid, 4,4′-oxydibenzoic acid, and other quadrangular polycarboxylic acids have attracted much attention because of their rich coordination patterns [14,15,16]. In addition to carboxylic acid linkers, flexible bisimidazole and its derivatives have multiconformation and strong coordination ability, which can be utilized as the auxiliary ligands in order to construct fascinating metal CPs [17]. Hence, in this research, two novel mixed-ligand coordination polymers, {[Co(tdc)(btrp)]·0.67DMF} n (1) and {[Zn2(bimb)2(tdc)2]·2H2O} n (2) involving 2,5-thiophenedicarboxylate (H2tdc), and bitopic flexible N-donor ligands, 1,3-bis(1,2,4-triazol-1-yl)propane (btrp) and 1,4-bis((1H-benzo[d]imidazol-1-yl)methyl)benzene (bimb), have been synthesized by hydrothermal method and characterized via IR, elemental analysis, thermal analysis, and powder X-ray diffraction (Scheme 1). In the biological research, the treatment activity of compounds 1 and 2 on periodontitis was evaluated, and the related mechanism was revealed. First, the results of the real-time RT-PCR demonstrated that compound 1 revealed a much stronger inhibitory function on the inflammatory genes nf-κb and p53 relative expression level in periodontal mucosal cells than compound 2. Besides, the ELISA data of the inflammatory cytokines’ level in the gingival crevicular fluid also indicated that the anti-inflammatory effect of compound 1 is better than that of compound 2.

Scheme 1 
               The synthesis routes for the two complexes in this work.
Scheme 1

The synthesis routes for the two complexes in this work.

2 Experimental

2.1 Chemicals and measurements

All chemicals were purchased from the market and utilized with no extra purification. The analyses of element (N, H, and C) were carried out with the PerkinElmer 240C analyzer. The infrared spectrum between 4,000 and 400 cm−1 was recorded on the Bruker Alpha spectrometer using pure solid samples. The data of powder X-ray diffraction (PXRD) with the Bruker D8-ADVANCE X-ray diffractometer were collected using Cu Kα radiation (λ = 1.5418 Å) in 2θ range 5–50°. Thermogravimetric analyses were performed with the Labsys Evo thermal analyzer at 25–800°C in the nitrogen atmosphere, and the heating rate was 5°C min−1.

2.2 Preparation and characterization for {[Co(tdc)(btrp)]·0.67DMF} n (1) and {[Zn2(bimb)2(tdc)2]·2H2O} n (2)

For complex 1, the solution of Co(NO3)2·6H2O (0.5 mmol, 1.0 M, 0.5 ml in DMF) was added into a glass bottle containing btrp ligand (89.1 mg and 0.5 mmol) and 1.25 ml of 0.4 M H2tdc (0.5 mmol mixture in DMF). The obtained mixture was stirred at the ambient temperature for a few minutes until all the reagents are completely dissolved. The vial was placed in the oven for half a day at 95°C. Then, the bottle was removed from the oven and then cooled it to the ambient temperature. Pink block-shaped crystals were formed at the bottom. The crystals were washed for twice with 2 ml DMF and then stored in a glass bottle under DMF. The yield was approximately 100 mg (ca. 42%) based on the H2tdc ligand. Elemental analysis: found, %: C 45.19, H 4.22, N 12.83 and calculated ([Co(btrp)(tdc)]·0.67DMF), %: C, 44.97; H, 4.14; Co, 12.98; N, 14.40. IR bands, cm−1: 3,125 m, 2,934 m, 1,668 s, 1,630 s, 1,590 m, 1,531 m, 1,461 s, 1,353 s, 1,280 m, 1,209 m, 1,173 s, 1,128 m, 995 w, 899 s, 812 m, 769 m, 677 m.

For complex 2, Zn(OAc)2·2H2O (0.2 mmol and 43.8 mg), H2tdc (0.1 mmol and 17.0 mg), bimb (0.1 mmol, 34 mg), DMF (5 ml), and H2O (2 ml) were mixed in a 25 ml Telfon-lined stainless steel vessel to form a mixture, heated at 140°C for 72 h under spontaneous pressure, and then cooled to the room temperature at the rate of 5°C/h. Colorless block-shaped single crystals were obtained. The yield was 42.3% based on bimb. Calc. For 1(C60H52N8O10S2Zn2): C, 58.12; H, 4.23; N, 9.04%. Found: C 57.28, H 4.40, N 9.14%. IR (KBr, cm−1): 3,426 s, 1,614 s, 1,527 m, 1,459 m, 1,411 m, 1,343 s, 751 s.

X-ray data were calculated using an Oxford XcaliburE diffractometer. CrysAlisPro software was used to analyze the intensity data and convert them into HKL files. The direct method with SHELXS program was used to establish the initial structure model of compound 1 and modified using least square means with SHELXL-2014 program. All the non-H atoms of complex 1 were refined with anisotropic parameters. Then, all the H atom by using AFIX command to geometrically fix on the C atom they are linked to. The crystallographic parameters and the refinement of these two complexes were listed in Table 1.

Table 1

Refinement details and crystallographic parameters for complexes 1 and 2

Identification code 1 2
Empirical formula C33H35Co2N9O9S2 C60H48N8O8S2Zn2
Formula weight 883.68 1203.92
Temperature/K 296.15 296.15
Crystal system Monoclinic Triclinic
Space group P21/c P
a 6.23690(10) 11.3621(14)
b 15.2236(4) 14.987(2)
c 18.9365(5) 18.963(2)
α 90 103.554(4)
β 90.522(2) 107.1360(10)
γ 90 101.3890(10)
Volume/Å3 1797.91(7) 2873.8(6)
Z 2 2
ρ calc g/cm3 1.632 1.391
μ/mm−1 1.107 0.969
Data/restraints/parameters 3,640/38/249 11,478/0/685
Goodness-of-fit on F 2 1.050 0.974
Final R indexes [I ≥ 2σ(I)] R 1 = 0.0482, ωR 2 = 0.1539 R 1 = 0.0646, ωR 2 = 0.1743
Final R indexes [all data] R 1 = 0.0505, ωR 2 = 0.1564 R 1 = 0.1213, ωR 2 = 0.2093
Largest diff. peak/hole/e Å−3 0.89/−0.75 0.78/−0.68
CCDC 1981070 1981071

2.3 Real-time RT-PCR

In order to determine the inhibitory effect of the compounds 1 and 2 on the inflammatory genes nf-κb and p53 relative expression level in periodontal mucosal cells, the reverse transcription-polymerase chain reaction (RT-PCR) was carried out to detect nf-κb and p53 relative expression. This experiment was conducted with instructions construction. In brief, the periodontitis animal model was established, compounds 1 and 2 were given for indicated treatment with 5 mg/kg via i.p, and ligands and ions were used as control compounds. The periodontal mucosal cells were harvested and cleaned, and total RNA was within cells by TRIzol reagent following the instruction of the manufacturer. The OD260/OD280 ratio was used to determine the total RNA concentration, and total RNA was reverse transcripted into cDNA by a high-capacity cDNA reverse transcription kit. Ultimately, the nf-κb and p53 relative expression levels in periodontal mucosal cells were determined by SYBR Green Master Mix after compound treatment. The 2−ΔΔCt method was used for relative quantification from triplicate preformation. The primers sequences utilized in this experiment were summed up in Table 2.

Table 2

The primers sequences utilized in this study

Genes Sequences
nf-κb CCACCCGGCTTCAGAATGG
AACCTTTGCTGGTCCCACAT
p53 TGCTCAAGACTGGCGCTAAA
GCTCGACGCTAGGATCTGAC
gapdh AATGGGCAGCCGTTAGGAAA
GCGCCCAATACGACCAAATC

2.4 ELISA detection

After treated by compounds 1 and 2, TNF-α and IL-1β contents in the gingival crevicular fluid were detected by ELISA. This preformation was carried out in accordance with the manufactures’ protocols. Briefly, the periodontitis rat model was constructed, and 5 mg/kg of compound 1 or 2 was given for the indicated treatment. Then, the gingival crevicular fluid was collected from all the groups, followed by the IL-1β and TNF-α content determination with the ELISA detection kit. This experiment was carried out three times, and the results were expressed as mean ± standard deviation.

  1. Ethical approval: The conducted research is not related to either human or animal use.

3 Results and discussion

3.1 Molecular structure

The targeted complex 1 could be obtained through the reaction of Co(NO3)2·6H2O with H2tdc btrp in the solution of DMF for half a day, whose chemical formula was established to be {[Co(tdc)(btrp)]·0.67DMF} n on the basis of the diffraction for single-crystal X-ray and the analysis for element along with the TGA curve. According to the crystal data that were collected under the ambient temperature, the results of the structural solution along with refinement reveal that complex 1 is part of the system of monoclinic crystal with a P21/c space group and has a two-dimensional layered structure. In the fundamental molecular repeating unit, there is a crystallography absolute Co(ii) ion, a completely deprotonated ligand tdc2−, two-third DMF, and a ligand btrp (Figure 1a). The Co(ii) center coordination surroundings are composed of two carboxylic acid oxygen atoms of two distinct ligands tdc2− and two nitrogen atoms of two ligand btrp, shaping a CoN2O2-distorted tetrahedral geometry. The Co–O bond distance is between 1.890(3) and 1.946(3) Å, and the Co–N bond length is between 1.960(3) and 1.946(3) Å. The ligands of tdc2− and btrp alternate along the axis a and axis b chains, which contribute to the 2D-layered network (Figure 1b). The entire layer is arranged along plane ab (Figure 1c). Among the layer, the Co atoms deviate 0.55 Å from their average plane. The dicarboxylic acid ligand in complex 1 uses the μ-O2– coordination pattern, exhibiting pairs of short (1.93, 1.98 Å) distances of Co⋯O. Complex 1 reveals a two-layer interpenetration in which each Co node of each array is located below or above the approximate center of the other layer space. Because of interpenetration, only individual voids filled via the DMF molecules are shown, and solvents can enter the volume (about 22%). Each hole involves a DMF molecule, which is disturbed via two positions because of its proximity to the inversion center (Figure 1d).

Figure 1 
                  (a) View for the coordination surrounding of Co(ii) ion in complex
                        1. (b) The coordination patterns for the two ligands in
                        1. (c) 1’s two-dimensional layered network.
                     (d) The packing diagram of 1 showing the voids that occupied via
                     the DMF molecules.
Figure 1

(a) View for the coordination surrounding of Co(ii) ion in complex 1. (b) The coordination patterns for the two ligands in 1. (c) 1’s two-dimensional layered network. (d) The packing diagram of 1 showing the voids that occupied via the DMF molecules.

Complex 2 crystallizes in the triclinic P1̄ space group. The asymmetric unit consisted of two zinc(ii) centers and two ligands of bimb and tdc2− (Figure 2a). Both Zn1 and Zn2 are four-coordinated in the tetrahedron surroundings. Zn1 is coordinated via two N atoms (N5 and N4) of two distinct ligands bimb and two O atoms (O1A and O7, the symmetry code is A = 2 − x, 1 − y, 1 − z) of two absolute tdc2− connectors; Zn2 is coordinated via two N atoms (N1B and N8, the symmetry code is B = 1 + x, y, 1 + z) of two separate ligands of bimb and two diverse O atoms (O5 and O4) of two ligands tdc2−; the Zn–O bond distance is between 1.916(4) and 1.956(4) Å, while the Zn–N bond distance is between 2.011(4) and 2.046(5) Å. All of these bond lengths are between the expected ranges. In complex 2, the ligands tdc2− are completely deprotonated, and the coordination pattern of (κ 1κ 0) − (κ 1κ 0) − μ 2 is used to connect the adjacent centers of Zn(ii) to generate a one-dimensional infinite wave-like chain, and the contiguous Zn⋯Zn distance was 10.366(2) Å, and the bond angle of Zn⋯Zn⋯Zn is 131.45(8)° (Figure 2b). The ligands of bimb, which were used as μ 2 connectors, utilize the conformation of alternating cis-coordinated and trans-coordinated to construct a one-dimensional “ladder”-like chain, and the Zn⋯Zn bond distance is between 11.859 (2) and 13.745 (2) Å. The dihedral angles of two benzimidazole rings for two absolute ligands of bimb are 83.32(5) and 85.49(4)°. In addition, the one-dimensional trapezoid chain intersects the one-dimensional waveform chain vertically via sharing the Zn(ii) centers, forming a complex three-dimensional skeleton (Figure 2c). The analysis of topology was carried out through the program package ToposPro. The Zn center linked via two ligands of bimb and tdc2− can be considered as a 4-linked node, the network has a special sra topology, and its point symbol is {42,63,8} (Figure 2d).

Figure 2 
                  (a) View for an asymmetric unit for complex 2. (b) These two
                     ligands’ coordination modes. (c) 2’s
                     three-dimensional skeleton. (d) The sra topology for complex
                        2.
Figure 2

(a) View for an asymmetric unit for complex 2. (b) These two ligands’ coordination modes. (c) 2’s three-dimensional skeleton. (d) The sra topology for complex 2.

In order to determine these complexes regarding the phase purity, powder X-ray diffraction (PXRD) experiments were carried out (Figure 3a). The simulated and experimental PXRD peak positions are consistent, which shows that the crystal structures are the real representative of the bulk crystal. The strength difference may be due to the crystal samples’ preferred orientation. Meanwhile, in order to study 1's and 2's thermal stability, the experiment thermogravimetric analysis (TGA) was performed between 25 and 800°C with the reflux of nitrogen, and the heating rate is 10°C min−1 (Figure 3a). Complex 1 reveals the TG curve with two weight loss steps: the first weight loss of 10.9% from room temperature until the 240°C temperature, which could be related to the removal of the lattice DMF molecule (calcd: 10.7%), and the second weight loss of 41.4% begins from approximately 250°C and continues to approximately 500°C, indicating the decomposition of the btrp ligand (calcd: 38.9%). The residual powders could be assigned to the Co-tdc complex, which might be further decomposed above the temperature of 600°C. For complex 2's curve of TGA, the main weight loss possesses three distinct steps: the first weight loss occurred from 38 to 95°C, which is due to the removal of two lattice water molecules (found: 3.4%, calcd 2.9%); the second weight loss of 56.2% can attribute to the decomposition of bimb ligands at the range of 300 to 452°C (calcd: 54.7%); and the third weight loss from 556 to 600°C could be due to the release of the tdc2− ligand. Due to the low-temperature range of the TGA curve, a higher weight loss of complex 2 might be expected at a higher temperature.

Figure 3 
                  (a) Complexes 1’s and 2’s PXRD
                     diagrams. (b) Complexes 1’s and 2’s
                     curves of TGA.
Figure 3

(a) Complexes 1’s and 2’s PXRD diagrams. (b) Complexes 1’s and 2’s curves of TGA.

3.2 Compound reduced the expression level of inflammatory genes nf-κb and p53 in periodontal mucosal cells

In the process of periodontitis, there was generally an increased level of the inflammatory response in periodontal mucosal cells, reflected as the increased expression level of the inflammatory genes nf-κb and p53. Therefore, in this study, the real-time RT-PCR was carried out in order to measure the inflammatory genes nf-κb and p53 expression level in periodontal mucosal cells after treated by compounds 1 and 2. According to the result shown in Figure 4, the levels of p53 and nf-κb were increased in the groups model when compared with the group of control. After compound 1 treatment, the inflammatory response in periodontal mucosal cells was significantly relied. However, compound 2 has almost no effect on the level of inflammatory response, which revealed that compound 1 has a stronger inhibitory function against the inflammatory response in periodontal mucosal cells than compound 2. In addition, the related ligands and ions showed no effect on the gene expression.

Figure 4 
                  Reduced the expression level of inflammatory genes
                        nf-κb and p53 in periodontal
                     mucosal cells. The periodontitis rat model was constructed, and then treated by
                     compounds 1 and 2 at the concentration of
                     5 mg/kg. The expression level of inflammatory genes
                        nf-κb and p53 in periodontal
                     mucosal cells was measured with real-time RT-PCR.
Figure 4

Reduced the expression level of inflammatory genes nf-κb and p53 in periodontal mucosal cells. The periodontitis rat model was constructed, and then treated by compounds 1 and 2 at the concentration of 5 mg/kg. The expression level of inflammatory genes nf-κb and p53 in periodontal mucosal cells was measured with real-time RT-PCR.

3.3 Compound inhibited the release of the IL-1β and TNF-α in gingival crevicular fluid

In the former study, we have demonstrated the inhibitory effect of compounds on the relative expression level of the nf-κb and p53 in periodontal mucosal cells. In this experiment, this inhibitory activity of the compounds was further convinced by determining the content of TNF-α and IL-1β in the gingival crevicular fluid, which is the downstream production of the NF-κB-P53 pathway. From the results shown in Figure 5, we can find that the content levels of TNF-α and IL-1β in the group of the model were higher than those in a group of control. Different from compound 2, compound 1 could reduce the TNF-α and IL-1β in the gingival crevicular fluid and exert treatment activity on periodontitis. However, the related ligands and ions showed no effect on the content of TNF-α and IL-1β in the gingival crevicular fluid.

Figure 5 
                  The inhibited release of the TNF-α and IL-1β in the gingival
                     crevicular fluid after compound treatment. The periodontitis rat model was
                     constructed, afterwards treated by compound 1 or 2 at
                     the consistence of 5 mg/kg. The ELISA was carried out to determine the
                     TNF-α and IL-1β content in the gingival crevicular fluid.
Figure 5

The inhibited release of the TNF-α and IL-1β in the gingival crevicular fluid after compound treatment. The periodontitis rat model was constructed, afterwards treated by compound 1 or 2 at the consistence of 5 mg/kg. The ELISA was carried out to determine the TNF-α and IL-1β content in the gingival crevicular fluid.

4 Conclusion

To sum up, we have triumphantly generated two novel mixed-ligand coordination polymers via adopting 2,5-thiophenedicarboxylate (H2tdc) and bitopic flexible N-donor ligands 1,3-bis(1,2,4-triazol-1-yl)propane (btrp) or 1,4-bis((1H-benzo[d]imidazol-1-yl)methyl)benzene (bimb) as the organic building blocks. The two complexes were characterized via analysis of element, IR, thermal analysis and X-ray of powder diffraction. The structural determination shows that complex 1 is a two-dimensional layered network which has a four-connected sql topology, complex 2 features a three-dimensional four-linked sra skeleton, and the symbol point is {42,63,8}. In the bioresearch, the protective function of compounds 1 and 2 against periodontitis were assessed, and the particular mechanism was discussed. The results of real-time RT-PCR exhibit that compound 1 has a stronger inhibitory effect on inflammatory response in periodontal mucosal cells than that of compound 2. And the results of ELISA indicated that TNF-α and IL-1β contents in the gingival crevicular fluid was reduced by compound 1 significantly.



  1. Conflict of interest: Authors declare no conflict of interest.

References

[1] Furugen R, Kawasaki K, Kitamura M, Maeda T, Saito T, Hayashida H. Association of low fetuin-A levels with periodontitis in community-dwelling adults. J Oral Sci. 2020;62:67–9.10.2334/josnusd.18-0282Suche in Google Scholar PubMed

[2] Voinescu I, Petre A, Burlibasa M, Oancea L. Evidence of connections between periodontitis and ischemic cardiac disease – an updated systematic review. Maedica. 2019;14:384–90.Suche in Google Scholar

[3] Demkovych A. Effects of flavonol quercetin on activity of lipid peroxide oxidation in experimental bacterial-immune periodontitis. Interv Med Appl Sci. 2019;11:55–9.10.1556/1646.10.2018.48Suche in Google Scholar PubMed PubMed Central

[4] Li X, Liu A, Du XD, Wang FX, Wang CC. Three silver coordination polymers constructed from 4,4′-bipyridine-like ligands and 2,5-thiophenedicarboxylic acid: crystal structures and photocatalytic performances. Transit Met Chem. 2019;44:311–9.10.1007/s11243-018-00295-ySuche in Google Scholar

[5] Rajak R, Saraf M, Mohammad A, Mobin SM. Design and construction of a ferrocene based inclined polycatenated Co-MOF for supercapacitor and dye adsorption applications. J Mater Chem A. 2017;5:17998–8011.10.1039/C7TA03773BSuche in Google Scholar

[6] Zhang D, Gao B, Cui K. Modifying polysulfone into a bidentate Schiff base type macromolecular ligand and study on photoluminescence property of polymer–rare earth complexes of Eu(iii) and Tb(iii). J Polym Res. 2016;23:266.10.1007/s10965-016-1146-7Suche in Google Scholar

[7] Huang YR, Gao LL, Wang XQ, Fan LM, Hu TP. Syntheses, structures and luminescent properties of two novel Zn(ii) coordination polymers. J Solid State Chem. 2018;258:854–8.10.1016/j.jssc.2017.12.028Suche in Google Scholar

[8] Rajasekhar B, Bodavarapu N, Sridevi M, Thamizhselvi G, RizhaNazar K, Padmanaban R, et al. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(ii) complexes and coordination polymers: synthesis, structural characterization and computational studies. J Mol Struct. 2018;1156:690–9.10.1016/j.molstruc.2017.11.103Suche in Google Scholar

[9] Voda I, Makhloufi G, Lozan V, Shova S, Heering C, Janiak C. Mixed-ligand cobalt, nickel and zinc coordination polymers based on flexible 1,4-bis((1H-imidazol-1-yl)methyl)benzene and rigid carboxylate linkers. Inorg Chim Acta. 2017;455:118–31.10.1016/j.ica.2016.10.007Suche in Google Scholar

[10] Rachuri Y, Subhagan S, Parmar B, Bisht KK, Suresh E. Selective and reversible adsorption of cationic dyes by mixed ligand Zn(ii) coordination polymers synthesized by reactant ratio modulation. Dalton Trans. 2018;47:898–908.10.1039/C7DT03667ASuche in Google Scholar PubMed

[11] Maity DK, Otake K, Ghosh S, Kitagawa H, Ghoshal D. Sulfonic group functionalized mixed ligand coordination polymers: synthesis, characterization, water sorption, and proton conduction studies. Inorg Chem. 2017;56:1581–90.10.1021/acs.inorgchem.6b02674Suche in Google Scholar PubMed

[12] Lysova A, Samsonenko D, Dybtsev D, Fedin V. Synthesis and luminescence properties of new metal–organic frameworks based on zinc(ii) ions and 2,5-thiophendicarboxylate ligands. Crystals. 2017;8:7.10.3390/cryst8010007Suche in Google Scholar

[13] Kang WC, Han C, Liu D, Cui GH. A bifunctional benzimidazole-based luminescent Zn(ii) coordination polymer for detection of Hg2+ and photocatalytic degrading of methylene blue. Inorg Chem Commun. 2019;106:81–5.10.1016/j.inoche.2019.05.034Suche in Google Scholar

[14] Guan BY, Kushima A, Yu L, Li S, Li J, Lou XWD. Coordination polymers derived general synthesis of multishelled mixed metal–oxide particles for hybrid supercapacitors. Adv Mater. 2017;29:1605902.10.1002/adma.201605902Suche in Google Scholar PubMed

[15] Balestri D, Costa D, Bacchi A, Carlucci L, Pelagatti P. Linker dependent dimensionality in Zn(ii)-coordination polymers containing a flexible bis-pyridyl-bis-amide ligand. Polyhedron. 2018;153:278–85.10.1016/j.poly.2018.07.025Suche in Google Scholar

[16] Croitor L, Coropceanu EB, Duca G, Siminel AV, Fonari MS. Nine Mn(ii), Zn(ii) and Cd(ii) mixed-ligand coordination networks with rigid dicarboxylate and pyridine-n-aldoxime ligands: impact of the second ligand in the structures’ dimensionality and solvent capacity. Polyhedron. 2017;129:9–21.10.1016/j.poly.2017.03.026Suche in Google Scholar

[17] Zhu J, Luo J. Effects of entanglements and finite extensibility of polymer chains on the mechanical behavior of hydrogels. Acta Mech. 2018;229:1703–19.10.1007/s00707-017-2060-8Suche in Google Scholar

Received: 2020-01-31
Revised: 2020-03-12
Accepted: 2020-03-17
Published Online: 2020-04-21

© 2020 Shao-Hsuan Wu and Jun-Hui Huang, published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Regular Articles
  2. Electrochemical antioxidant screening and evaluation based on guanine and chitosan immobilized MoS2 nanosheet modified glassy carbon electrode (guanine/CS/MoS2/GCE)
  3. Kinetic models of the extraction of vanillic acid from pumpkin seeds
  4. On the maximum ABC index of bipartite graphs without pendent vertices
  5. Estimation of the total antioxidant potential in the meat samples using thin-layer chromatography
  6. Molecular dynamics simulation of sI methane hydrate under compression and tension
  7. Spatial distribution and potential ecological risk assessment of some trace elements in sediments and grey mangrove (Avicennia marina) along the Arabian Gulf coast, Saudi Arabia
  8. Amino-functionalized graphene oxide for Cr(VI), Cu(II), Pb(II) and Cd(II) removal from industrial wastewater
  9. Chemical composition and in vitro activity of Origanum vulgare L., Satureja hortensis L., Thymus serpyllum L. and Thymus vulgaris L. essential oils towards oral isolates of Candida albicans and Candida glabrata
  10. Effect of excess Fluoride consumption on Urine-Serum Fluorides, Dental state and Thyroid Hormones among children in “Talab Sarai” Punjab Pakistan
  11. Design, Synthesis and Characterization of Novel Isoxazole Tagged Indole Hybrid Compounds
  12. Comparison of kinetic and enzymatic properties of intracellular phosphoserine aminotransferases from alkaliphilic and neutralophilic bacteria
  13. Green Organic Solvent-Free Oxidation of Alkylarenes with tert-Butyl Hydroperoxide Catalyzed by Water-Soluble Copper Complex
  14. Ducrosia ismaelis Asch. essential oil: chemical composition profile and anticancer, antimicrobial and antioxidant potential assessment
  15. DFT calculations as an efficient tool for prediction of Raman and infra-red spectra and activities of newly synthesized cathinones
  16. Influence of Chemical Osmosis on Solute Transport and Fluid Velocity in Clay Soils
  17. A New fatty acid and some triterpenoids from propolis of Nkambe (North-West Region, Cameroon) and evaluation of the antiradical scavenging activity of their extracts
  18. Antiplasmodial Activity of Stigmastane Steroids from Dryobalanops oblongifolia Stem Bark
  19. Rapid identification of direct-acting pancreatic protectants from Cyclocarya paliurus leaves tea by the method of serum pharmacochemistry combined with target cell extraction
  20. Immobilization of Pseudomonas aeruginosa static biomass on eggshell powder for on-line preconcentration and determination of Cr (VI)
  21. Assessment of methyl 2-({[(4,6-dimethoxypyrimidin-2-yl)carbamoyl] sulfamoyl}methyl)benzoate through biotic and abiotic degradation modes
  22. Stability of natural polyphenol fisetin in eye drops Stability of fisetin in eye drops
  23. Production of a bioflocculant by using activated sludge and its application in Pb(II) removal from aqueous solution
  24. Molecular Properties of Carbon Crystal Cubic Structures
  25. Synthesis and characterization of calcium carbonate whisker from yellow phosphorus slag
  26. Study on the interaction between catechin and cholesterol by the density functional theory
  27. Analysis of some pharmaceuticals in the presence of their synthetic impurities by applying hybrid micelle liquid chromatography
  28. Two mixed-ligand coordination polymers based on 2,5-thiophenedicarboxylic acid and flexible N-donor ligands: the protective effect on periodontitis via reducing the release of IL-1β and TNF-α
  29. Incorporation of silver stearate nanoparticles in methacrylate polymeric monoliths for hemeprotein isolation
  30. Development of ultrasound-assisted dispersive solid-phase microextraction based on mesoporous carbon coated with silica@iron oxide nanocomposite for preconcentration of Te and Tl in natural water systems
  31. N,N′-Bis[2-hydroxynaphthylidene]/[2-methoxybenzylidene]amino]oxamides and their divalent manganese complexes: Isolation, spectral characterization, morphology, antibacterial and cytotoxicity against leukemia cells
  32. Determination of the content of selected trace elements in Polish commercial fruit juices and health risk assessment
  33. Diorganotin(iv) benzyldithiocarbamate complexes: synthesis, characterization, and thermal and cytotoxicity study
  34. Keratin 17 is induced in prurigo nodularis lesions
  35. Anticancer, antioxidant, and acute toxicity studies of a Saudi polyherbal formulation, PHF5
  36. LaCoO3 perovskite-type catalysts in syngas conversion
  37. Comparative studies of two vegetal extracts from Stokesia laevis and Geranium pratense: polyphenol profile, cytotoxic effect and antiproliferative activity
  38. Fragmentation pattern of certain isatin–indole antiproliferative conjugates with application to identify their in vitro metabolic profiles in rat liver microsomes by liquid chromatography tandem mass spectrometry
  39. Investigation of polyphenol profile, antioxidant activity and hepatoprotective potential of Aconogonon alpinum (All.) Schur roots
  40. Lead discovery of a guanidinyl tryptophan derivative on amyloid cascade inhibition
  41. Physicochemical evaluation of the fruit pulp of Opuntia spp growing in the Mediterranean area under hard climate conditions
  42. Electronic structural properties of amino/hydroxyl functionalized imidazolium-based bromide ionic liquids
  43. New Schiff bases of 2-(quinolin-8-yloxy)acetohydrazide and their Cu(ii), and Zn(ii) metal complexes: their in vitro antimicrobial potentials and in silico physicochemical and pharmacokinetics properties
  44. Treatment of adhesions after Achilles tendon injury using focused ultrasound with targeted bFGF plasmid-loaded cationic microbubbles
  45. Synthesis of orotic acid derivatives and their effects on stem cell proliferation
  46. Chirality of β2-agonists. An overview of pharmacological activity, stereoselective analysis, and synthesis
  47. Fe3O4@urea/HITh-SO3H as an efficient and reusable catalyst for the solvent-free synthesis of 7-aryl-8H-benzo[h]indeno[1,2-b]quinoline-8-one and indeno[2′,1′:5,6]pyrido[2,3-d]pyrimidine derivatives
  48. Adsorption kinetic characteristics of molybdenum in yellow-brown soil in response to pH and phosphate
  49. Enhancement of thermal properties of bio-based microcapsules intended for textile applications
  50. Exploring the effect of khat (Catha edulis) chewing on the pharmacokinetics of the antiplatelet drug clopidogrel in rats using the newly developed LC-MS/MS technique
  51. A green strategy for obtaining anthraquinones from Rheum tanguticum by subcritical water
  52. Cadmium (Cd) chloride affects the nutrient uptake and Cd-resistant bacterium reduces the adsorption of Cd in muskmelon plants
  53. Removal of H2S by vermicompost biofilter and analysis on bacterial community
  54. Structural cytotoxicity relationship of 2-phenoxy(thiomethyl)pyridotriazolopyrimidines: Quantum chemical calculations and statistical analysis
  55. A self-breaking supramolecular plugging system as lost circulation material in oilfield
  56. Synthesis, characterization, and pharmacological evaluation of thiourea derivatives
  57. Application of drug–metal ion interaction principle in conductometric determination of imatinib, sorafenib, gefitinib and bosutinib
  58. Synthesis and characterization of a novel chitosan-grafted-polyorthoethylaniline biocomposite and utilization for dye removal from water
  59. Optimisation of urine sample preparation for shotgun proteomics
  60. DFT investigations on arylsulphonyl pyrazole derivatives as potential ligands of selected kinases
  61. Treatment of Parkinson’s disease using focused ultrasound with GDNF retrovirus-loaded microbubbles to open the blood–brain barrier
  62. New derivatives of a natural nordentatin
  63. Fluorescence biomarkers of malignant melanoma detectable in urine
  64. Study of the remediation effects of passivation materials on Pb-contaminated soil
  65. Saliva proteomic analysis reveals possible biomarkers of renal cell carcinoma
  66. Withania frutescens: Chemical characterization, analgesic, anti-inflammatory, and healing activities
  67. Design, synthesis and pharmacological profile of (−)-verbenone hydrazones
  68. Synthesis of magnesium carbonate hydrate from natural talc
  69. Stability-indicating HPLC-DAD assay for simultaneous quantification of hydrocortisone 21 acetate, dexamethasone, and fluocinolone acetonide in cosmetics
  70. A novel lactose biosensor based on electrochemically synthesized 3,4-ethylenedioxythiophene/thiophene (EDOT/Th) copolymer
  71. Citrullus colocynthis (L.) Schrad: Chemical characterization, scavenging and cytotoxic activities
  72. Development and validation of a high performance liquid chromatography/diode array detection method for estrogen determination: Application to residual analysis in meat products
  73. PCSK9 concentrations in different stages of subclinical atherosclerosis and their relationship with inflammation
  74. Development of trace analysis for alkyl methanesulfonates in the delgocitinib drug substance using GC-FID and liquid–liquid extraction with ionic liquid
  75. Electrochemical evaluation of the antioxidant capacity of natural compounds on glassy carbon electrode modified with guanine-, polythionine-, and nitrogen-doped graphene
  76. A Dy(iii)–organic framework as a fluorescent probe for highly selective detection of picric acid and treatment activity on human lung cancer cells
  77. A Zn(ii)–organic cage with semirigid ligand for solvent-free cyanosilylation and inhibitory effect on ovarian cancer cell migration and invasion ability via regulating mi-RNA16 expression
  78. Polyphenol content and antioxidant activities of Prunus padus L. and Prunus serotina L. leaves: Electrochemical and spectrophotometric approach and their antimicrobial properties
  79. The combined use of GC, PDSC and FT-IR techniques to characterize fat extracted from commercial complete dry pet food for adult cats
  80. MALDI-TOF MS profiling in the discovery and identification of salivary proteomic patterns of temporomandibular joint disorders
  81. Concentrations of dioxins, furans and dioxin-like PCBs in natural animal feed additives
  82. Structure and some physicochemical and functional properties of water treated under ammonia with low-temperature low-pressure glow plasma of low frequency
  83. Mesoscale nanoparticles encapsulated with emodin for targeting antifibrosis in animal models
  84. Amine-functionalized magnetic activated carbon as an adsorbent for preconcentration and determination of acidic drugs in environmental water samples using HPLC-DAD
  85. Antioxidant activity as a response to cadmium pollution in three durum wheat genotypes differing in salt-tolerance
  86. A promising naphthoquinone [8-hydroxy-2-(2-thienylcarbonyl)naphtho[2,3-b]thiophene-4,9-dione] exerts anti-colorectal cancer activity through ferroptosis and inhibition of MAPK signaling pathway based on RNA sequencing
  87. Synthesis and efficacy of herbicidal ionic liquids with chlorsulfuron as the anion
  88. Effect of isovalent substitution on the crystal structure and properties of two-slab indates BaLa2−xSmxIn2O7
  89. Synthesis, spectral and thermo-kinetics explorations of Schiff-base derived metal complexes
  90. An improved reduction method for phase stability testing in the single-phase region
  91. Comparative analysis of chemical composition of some commercially important fishes with an emphasis on various Malaysian diets
  92. Development of a solventless stir bar sorptive extraction/thermal desorption large volume injection capillary gas chromatographic-mass spectrometric method for ultra-trace determination of pyrethroids pesticides in river and tap water samples
  93. A turbidity sensor development based on NL-PI observers: Experimental application to the control of a Sinaloa’s River Spirulina maxima cultivation
  94. Deep desulfurization of sintering flue gas in iron and steel works based on low-temperature oxidation
  95. Investigations of metallic elements and phenolics in Chinese medicinal plants
  96. Influence of site-classification approach on geochemical background values
  97. Effects of ageing on the surface characteristics and Cu(ii) adsorption behaviour of rice husk biochar in soil
  98. Adsorption and sugarcane-bagasse-derived activated carbon-based mitigation of 1-[2-(2-chloroethoxy)phenyl]sulfonyl-3-(4-methoxy-6-methyl-1,3,5-triazin-2-yl) urea-contaminated soils
  99. Antimicrobial and antifungal activities of bifunctional cooper(ii) complexes with non-steroidal anti-inflammatory drugs, flufenamic, mefenamic and tolfenamic acids and 1,10-phenanthroline
  100. Application of selenium and silicon to alleviate short-term drought stress in French marigold (Tagetes patula L.) as a model plant species
  101. Screening and analysis of xanthine oxidase inhibitors in jute leaves and their protective effects against hydrogen peroxide-induced oxidative stress in cells
  102. Synthesis and physicochemical studies of a series of mixed-ligand transition metal complexes and their molecular docking investigations against Coronavirus main protease
  103. A study of in vitro metabolism and cytotoxicity of mephedrone and methoxetamine in human and pig liver models using GC/MS and LC/MS analyses
  104. A new phenyl alkyl ester and a new combretin triterpene derivative from Combretum fragrans F. Hoffm (Combretaceae) and antiproliferative activity
  105. Erratum
  106. Erratum to: A one-step incubation ELISA kit for rapid determination of dibutyl phthalate in water, beverage and liquor
  107. Review Articles
  108. Sinoporphyrin sodium, a novel sensitizer for photodynamic and sonodynamic therapy
  109. Natural products isolated from Casimiroa
  110. Plant description, phytochemical constituents and bioactivities of Syzygium genus: A review
  111. Evaluation of elastomeric heat shielding materials as insulators for solid propellant rocket motors: A short review
  112. Special Issue on Applied Biochemistry and Biotechnology 2019
  113. An overview of Monascus fermentation processes for monacolin K production
  114. Study on online soft sensor method of total sugar content in chlorotetracycline fermentation tank
  115. Studies on the Anti-Gouty Arthritis and Anti-hyperuricemia Properties of Astilbin in Animal Models
  116. Effects of organic fertilizer on water use, photosynthetic characteristics, and fruit quality of pear jujube in northern Shaanxi
  117. Characteristics of the root exudate release system of typical plants in plateau lakeside wetland under phosphorus stress conditions
  118. Characterization of soil water by the means of hydrogen and oxygen isotope ratio at dry-wet season under different soil layers in the dry-hot valley of Jinsha River
  119. Composition and diurnal variation of floral scent emission in Rosa rugosa Thunb. and Tulipa gesneriana L.
  120. Preparation of a novel ginkgolide B niosomal composite drug
  121. The degradation, biodegradability and toxicity evaluation of sulfamethazine antibiotics by gamma radiation
  122. Special issue on Monitoring, Risk Assessment and Sustainable Management for the Exposure to Environmental Toxins
  123. Insight into the cadmium and zinc binding potential of humic acids derived from composts by EEM spectra combined with PARAFAC analysis
  124. Source apportionment of soil contamination based on multivariate receptor and robust geostatistics in a typical rural–urban area, Wuhan city, middle China
  125. Special Issue on 13th JCC 2018
  126. The Role of H2C2O4 and Na2CO3 as Precipitating Agents on The Physichochemical Properties and Photocatalytic Activity of Bismuth Oxide
  127. Preparation of magnetite-silica–cetyltrimethylammonium for phenol removal based on adsolubilization
  128. Topical Issue on Agriculture
  129. Size-dependent growth kinetics of struvite crystals in wastewater with calcium ions
  130. The effect of silica-calcite sedimentary rock contained in the chicken broiler diet on the overall quality of chicken muscles
  131. Physicochemical properties of selected herbicidal products containing nicosulfuron as an active ingredient
  132. Lycopene in tomatoes and tomato products
  133. Fluorescence in the assessment of the share of a key component in the mixing of feed
  134. Sulfur application alleviates chromium stress in maize and wheat
  135. Effectiveness of removal of sulphur compounds from the air after 3 years of biofiltration with a mixture of compost soil, peat, coconut fibre and oak bark
  136. Special Issue on the 4th Green Chemistry 2018
  137. Study and fire test of banana fibre reinforced composites with flame retardance properties
  138. Special Issue on the International conference CosCI 2018
  139. Disintegration, In vitro Dissolution, and Drug Release Kinetics Profiles of k-Carrageenan-based Nutraceutical Hard-shell Capsules Containing Salicylamide
  140. Synthesis of amorphous aluminosilicate from impure Indonesian kaolin
  141. Special Issue on the International Conf on Science, Applied Science, Teaching and Education 2019
  142. Functionalization of Congo red dye as a light harvester on solar cell
  143. The effect of nitrite food preservatives added to se’i meat on the expression of wild-type p53 protein
  144. Biocompatibility and osteoconductivity of scaffold porous composite collagen–hydroxyapatite based coral for bone regeneration
  145. Special Issue on the Joint Science Congress of Materials and Polymers (ISCMP 2019)
  146. Effect of natural boron mineral use on the essential oil ratio and components of Musk Sage (Salvia sclarea L.)
  147. A theoretical and experimental study of the adsorptive removal of hexavalent chromium ions using graphene oxide as an adsorbent
  148. A study on the bacterial adhesion of Streptococcus mutans in various dental ceramics: In vitro study
  149. Corrosion study of copper in aqueous sulfuric acid solution in the presence of (2E,5E)-2,5-dibenzylidenecyclopentanone and (2E,5E)-bis[(4-dimethylamino)benzylidene]cyclopentanone: Experimental and theoretical study
  150. Special Issue on Chemistry Today for Tomorrow 2019
  151. Diabetes mellitus type 2: Exploratory data analysis based on clinical reading
  152. Multivariate analysis for the classification of copper–lead and copper–zinc glasses
  153. Special Issue on Advances in Chemistry and Polymers
  154. The spatial and temporal distribution of cationic and anionic radicals in early embryo implantation
  155. Special Issue on 3rd IC3PE 2020
  156. Magnetic iron oxide/clay nanocomposites for adsorption and catalytic oxidation in water treatment applications
  157. Special Issue on IC3PE 2018/2019 Conference
  158. Exergy analysis of conventional and hydrothermal liquefaction–esterification processes of microalgae for biodiesel production
  159. Advancing biodiesel production from microalgae Spirulina sp. by a simultaneous extraction–transesterification process using palm oil as a co-solvent of methanol
  160. Topical Issue on Applications of Mathematics in Chemistry
  161. Omega and the related counting polynomials of some chemical structures
  162. M-polynomial and topological indices of zigzag edge coronoid fused by starphene
Heruntergeladen am 8.12.2025 von https://www.degruyterbrill.com/document/doi/10.1515/chem-2020-0081/html
Button zum nach oben scrollen