Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
-
Abdou Azaque Zouré
, Lanyo Jospin Amegnona
Abstract
Several factors contribute to the development of breast cancer, including the immune system. This study is aimed to characterize the carriage of human leukocyte antigen (HLA)-DRB1*11 and 1*12 alleles in patients with breast cancer. This case-control study consisted of 96 histologically diagnosed breast cancer cases and 102 controls (cases without breast abnormalities). A multiplex polymerase chain reaction (PCR) was used to characterize the carriage of HLA-DRB1*11 and 1*12 alleles. The HLA-DRB1*11 allele was present in 26.59% of cases and 22.55% of controls. The HLA-DRB1*12 allele was present in 56.63% of cases and 55.88% of controls. This study found no direct association between the carriage of the HLA-DRB1*11 and HLA-DRB1*12 alleles and the occurrence of breast cancer. In addition, the deletion of the HLA-DRB1*11 allele is associated (beneficial effect) with obesity/overweight (OR = 0.13; 95% CI [0.01–1.14]; and p = 0.03) which is a risk for breast cancer. No direct association was found between the carriage of HLA-DRB1*11 and 1*12 alleles and breast cancer risk. However, further investigation of other HLA alleles involved in the occurrence of breast cancer may provide more information.
1 Introduction
In 2020, according to the GLOBOCAN 2020 database, cancer was diagnosed in over 19.3 million people, causing 10 million deaths. At the same time, female breast cancer was ranked the most diagnosed type of cancer in the world. In fact, 2.3 million new cancer cases were recorded, representing 11.7% of all diagnosed cancers, with 68,496 deaths, representing 6.9% of cancer deaths [1]. Africa is reporting an increase in breast cancer cases [1]. In Burkina Faso, breast cancer ranks first in terms of prevalence, i.e., 30.73 patients per 100,000 inhabitants, and second in terms of mortality, i.e., 20.3% of deaths due to cancer [1]. The high mortality from breast cancer in Africa is related mainly to very late diagnosis, whereas, in developed countries, better treatments are achieved based on early diagnosis. Globally, in the types of breast cancer, there are inherited (5–10%), familial (15–20%), and sporadic (75%) forms [2,3]. A combination of mutations in specific genes would confer risk and are classified as high, moderate, and low risk [4]. Thanks to molecular markers and hormone receptors, various subtypes of breast cancer responding to different treatments can be identified [5,6]. Several mutations on several genes are evoked, of which the mutations on the genes BRCA1, BRCA2, and TP53, which are involved in the repair of the DNA, are of high penetrance with a low frequency. Whereas the CHECK2, ATM, BRIP1, and PALB2, which are also involved in repairing the DNA, are of moderate penetrance [2,4,7,8]. Also, mutations in CASP8/10 (involved in apoptosis), β1-TGF, FGFR2, MAP3K1, LSP1 (involved in cell growth/cell signaling), and TNRC9 (probably encoding a transcription factor) are of low penetrance and frequency. Mutations in tumor suppressor genes such as PTEN, STK11, CDH1, NF1, NBS1, RAD50, and RAD51C are also associated with breast cancer risk [4,9,10]. In addition, the role played by the immune system in breast cancer in relation to the expression of human leukocyte antigen (HLA) genes involved in the anti-tumor immune response is being increasingly studied. The major histocompatibility complex (MHC) carries approximately 220 genes encoding proteins, more than half of which are directly involved in immunity, including the HLA gene system. The HLA genes are subdivided into three regions classified as HLA I, HLA II, and HLA III. Class I includes HLA-A, HLA-B, and HLA-C, while class II includes HLA-D with the subtypes HLA-DO, HLA-DP, HLA-DQ, and HLA-DR [11].
The HLA system has approximately 28,938 alleles, including 21,040 class I and 7,898 class II alleles “http://hla.alleles.org/nomenclature/stats.html” [12]. Allelic polymorphism of the HLA gene system is associated with various diseases. Therefore, other studies have focused on the role of the immune system in carcinogenesis by exploring the HLA. Indeed, the immune system plays a crucial role in tumor growth by eliminating, monitoring, and even promoting cancer cells [13]. Some genes of this system are involved in adaptive immunity via the MHC class II and appear to be significant players in the anti-cancer response through antigenic presentation and coordination of the immune response [14].
At the MHC class I level, two pathways of escape from the immune system by cancer cells are predominant: alteration in the expression of MHC class I [15]; and a complete or partial selection of phenotypes having lost the full expression of HLA I [16]. The alteration may include a total loss of HLA expression, loss of HLA haplotype, downregulation of specific HLA loci (HLA A, HLA B, and HLA C), allelic loss of HLA, and a combination of all these phenotypes [17]. The loss of specific HLA I expression leads to a deficiency in the presentation of immunodominant antigens and thus, allows an escape from the action of cytolytic T lymphocytes (CTC) but exposes to a “Natural Killer” (NK) response [18]. For example, in breast cancer, HLA I is not expressed in 96% of cases. The loss of specific haplotypes of HLA I allows for both CTC and NK to escape and promotes tumor progression. Expression of HLA A and B variants that bind with high affinity to NK inhibitory receptors leads to cancer cell escape from NK action. Overexpression of HLA E, associated with underexpression of HLA A, HLA B, and HLA C would play a role in NK evasion.
Moreover, HLA G is involved in immune evasion during breast carcinogenesis [19,20]. Furthermore, like lymphocytes and NK, immune cells can also be the site of certain dysfunctions in malignant breast tumors [23]. Other mechanisms such as downregulation of tumor-associated antigens, alteration of the apoptosis program, and the expression of inhibitory cytokines or disregard of the immune response have been reported [17,18,22,23]. Also, the modulation of the metastatic phenotype is associated with the modulation of the expression of MHC class I genes [24].
As for MHC class II, the escape of cancer cells from CD4+ T cells seems to be related to the normal functioning of the immune system. Indeed, two facts explain the inefficiency of T-helpers in tumor control: first, solid tumors do not express MHC class II, and therefore cannot directly stimulate CD4+ T cells, and second, tumor cells must be degraded by professional antigen-presenting cells (APCs) to be presented to T cells for action. However, cancer cells express MHC I of self and are therefore considered as self cells; this prevents any phagocytic action of APCs. Thus, the presentation of immunogenic tumor antigens is limited in quality and quantity in the tumor debris and secretion products that APCs can capture and present to TCD4+ [14].
Various studies have investigated a possible association of genes of the HLA system. HLA class I genes are by far the most investigated. As for HLA class II, HLA-DRB, and HLA-DQ are the most studied genes. In various populations, two alleles of the HLA gene, namely HLA-DRB1*11 and HLA-DRB1*12, have been associated either with protection against breast carcinogenesis or with a risk of breast cancer [25].
To our knowledge, no study has been conducted on the role of these two alleles in the occurrence of breast cancer in a sub-Saharan African population, particularly in Burkina Faso. Thus, our study aims to explore the carriage of HLA-DRB1*11 and HLA-DRB1*12 alleles in a Burkinabe population with unselected breast cancer (sporadic or family history/hereditary cases) to determine possible associations between HLA-DRB1*11 and HLA-DRB1*12 alleles and the susceptibility to breast cancer occurrence. This could contribute to the knowledge of breast cancer risk factors and a better prevention strategy of breast cancer in Burkina Faso.
2 Materials and methods
2.1 Materials
The study was conducted between October 2019 and March 2020. The study population (Burkinabe) consisted of 96 patients, histologically diagnosed with breast cancer (cases) and 102 without breast cancer (controls). They came for consultation to the University Hospital Centers: Yalgado OUEDRAOGO (CHU-YO) and BOGODOGO (CHU-B); at the Medical Centers with the surgical branch (Paul VI and Schiphra) in the city of Ouagadougou. Biomolecular analyses were performed at the Laboratory of Molecular Biology and Genetics (LABIOGENE) and at Pietro Annigoni Biomolecular Research Center (CERBA).
Women with breast cancer histologically confirmed by a pathologist were included in this study as cases, and women who came to the gynecological consultation for a pathology other than breast cancer had breast ultrasound scans, and were declared healthy concerning breast cancer were included as controls.
-
Informed consent: Informed consent has been obtained from all individuals included in this study.
-
Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies, and in accordance with the tenets of the Helsinki Declaration, and has been approved by The CERBA/LABIOGENE Ethics Committee.
2.2 Sample collection
After obtaining consent from patients and controls, a questionnaire was administered to collect sociodemographic, anthropometric, and clinical data from participants. Venous blood from consenting women was collected on Ethylene-Diamine-Tetra-Acetic (EDTA) filled tubes. After centrifugation, at 3,500 revolutions per minute for 15 min, the plasma and pellet were separated and stored at −20°C.
2.3 Multiplex polymerase chain reaction (PCR)
Genomic DNA was extracted from the blood pellet using the “Rapid Salting Out” technique modified and adapted from that described in 1988 by Miller et al. [26]. Using the BioDrop µLITE, DNA was quantified and purity was verified. Amplification of HLA-DRB1*11 and HLA-DRB1*12 alleles was performed using the primers described by Ma et al. [27], with a slightly adapted amplification program. This was a multiplex PCR targeting both alleles simultaneously, performed with the GeneAmp PCR System 9700 (Applied Biosystem, USA). The total reaction volume of 25 µL contains 9 µL of pure water (molecular biology grade), 10 µL of AmpliTaq Gold™ DNA Polymerase (10×, Applied Biosystems™), 0.5 µL of each of the three primer pairs [0.2 µM] (Table 1), and 3 µL of DNA [10 ng/µL]. The hepatocyte growth factor (HGF) primer pair is used for internal validation of the DNA amplification of each sample.
Primers and amplicon size
Alleles | Primers | Size (bp) |
---|---|---|
HLA-DRB1*11 | F 5′GTTTCTTGGAGTACTCTACGTC3′ | 176 |
R 5′CTGGCTGTTCCAGTACTCCT3′ | ||
HLA-DRB1*12 | F 5′ACTCTACGGGTGAGTGTT3′ | 244 |
R 5′ACTGTGAAGCTCTCCACAG3′ | ||
HGF | F 5′CAGTGCCTTCCCAACCATTCCCTTA3′ | 432 |
R 5′ATCCACTCACGGATTTCTGTTGTGTTTC3′ |
The amplification program included an activation phase at 94°C for 10 min, followed by 35 cycles of denaturation series at 94°C for 60 s, hybridization at 56°C for 60 s, elongation at 72°C for 60 s, and finally extension at 72°C for 7 min. PCR products were run on a 2% of agarose gel. They were visualized under ultraviolet light at 132 nm using the GeneFlash revelation device (Syngene).
The sequences of the primer pairs used are given in the Table 1.
2.4 Statistical analysis
The study data were recorded into Excel before being processed with the Epi Info 7 software used for data analysis and interpretation. Frequency comparisons were performed with version 6 of the same software. Analyses were considered statistically significant at p ≤ 0.05, using the Fisher’s Exact test. Odds ratio (OR) and 95% confidence intervals (CI) were calculated to estimate associations between allele carriage and selected sociodemographic parameters of breast cancer.
3 Results
3.1 Sociodemographic characteristics
The mean age of the cases was 45.19 ± 0.90 years, and of the controls, 36.69 ± 1.06 years. About one-quarter (25.53%) of the patients were younger than 40 years. About 32.98% of these cases had been diagnosed with breast cancer before the age of 40. A risk of breast cancer was observed for the age group above 40 years (OR = 5.01; 95% CI [2.74–9.32]; and p = 0.001).
Body mass index (BMI) was calculated as the ratio of weight to height squared. These indices were then grouped into Normal/Lean (<25 kg/m2), Overweight (25–30 kg/m2), and Obese (≥30 kg/m2) according to the US National Institute of Health/National Heart Lung and Blood Institute (NCI/NHLBI) criteria. Patients and controls had a mean BMI of 29.77 ± 0.85 and 27.61 ± 0.76 kg/m2, respectively. These results found 34.91 and 24.51% obese in patients and controls, respectively. No association was found between overweight (OR = 1.4; 95% CI [0.59–3.64]; and p = 0.48) and obesity and risk of developing breast cancer (OR = 2.1; 95% CI [0.95–4.70]; and p = 0.07).
3.2 Family histories of breast cancer and other cancers
Patients in this study were asked whether their close relatives had confirmed breast cancer cases (10.63%) or other cancers (10.63%). No association was found between the patients’ relatives and the risk of developing breast cancer.
3.3 Medical treatment
Three types of treatment (chemotherapy, radiotherapy, and surgery) were encountered in this population. Breast surgery was the most frequently performed treatment in 92.55% of all the patients. It was also performed in combination with either chemotherapy (44.68%) or radiotherapy (26.60%) (Figure 1).

Treatments received by patients.
3.4 Validation of PCR results
The validity of the PCR of a sample is based on the observation of an amplification band of the HGF gene which served as an internal control. The presence of HLA-DRB1*11 and HLA-DRB1*12 alleles are linked to a band at 176 bp and 244 bp, respectively (Figure 2).

Electrophoresis gel of PCR products. Legend-M: Molecular weight marker. (1) and (6) Presence of HLA-DRB1*11 & HLA-DRB1*12; (2) Presence of HLA-DRB1*11; (3–5) and (8) HLA-DRB1*12, and (7) Valid PCR with the absence of the targeted alleles.
3.5 Carrying of HLA-DRB1*11 and DRB1*12 alleles
The most common allele was DRB1*12, with a proportion of 56.63% in the general population of our study. The DRB1*11 allele was present in only 24.49% of the study participants. In addition, we did not find a relative risk of carrying both DRB1*11 and 1*12 alleles; this was true both for separate carriage and for combinations of carriage of these two alleles (Table 2).
Carrying of the HLA alleles DRB1*11 and DRB1*12
HLA variable | N = 94 | N = 102 | OR (95% CI) | p value |
---|---|---|---|---|
cases | controls | |||
DRB1*11 | ||||
Presence | 25 (26.59%) | 23 (22.55%) | Ref | |
Absence | 69 (73.40%) | 79 (77.45%) | 0.80 (0.41–1.54) | 0.61 |
DRB1*12 | ||||
Presence | 54 (57.45%) | 57 (55.88%) | Ref | |
Absence | 40 (42.55%) | 45 (44.12%) | 0.93 (0.53–1.65) | 0.88 |
DRB1*11 & 1*12 | ||||
DRB1*11+ & 1*12+ | 16 (17.02%) | 13 (12.74%) | Ref | |
DRB1*11+ & 1*12− | 9 (9.57%) | 10 (39.8%) | 0.73 (0.22–2.33) | 0.76 |
DRB1*11− & 1*12+ | 38 (40.42%) | 44 (43.14%) | 0.70 (0.29–1.64) | 0.51 |
DRB 1*11− & 1*12− | 31 (32.98%) | 35 (34.31%) | 0.71 (0.29–1.72) | 0.50 |
3.6 Association between some clinico-pathological parameters and the carriage of HLA-DRB1*11 and DRB1*12 alleles
No risk was found between both family history of breast cancer (Table 3) and carriage of the HLA-DRB1*11 and DRB1*12 alleles between cases and controls in this study. However, deletion of the HLA-DRB1*11 allele is associated (beneficial effect) with obesity/overweight (OR = 0.13; 95% CI [0.01–1.14]; and p = 0.03) (Table 4).
Allelic carriage and family history of breast cancer
Alleles HLA | Family history of breast cancer | OR (95% CI) | p value | |
---|---|---|---|---|
Yes, N (%) | No, N (%) | |||
DRB1*11 | ||||
Presence | 1 (10) | 24 (28.57) | Ref | |
Absence | 9 (90) | 60 (71.43) | 3.6 (0.43–29.97) | 0.28 |
DRB1*12 | ||||
Presence | 4 (40) | 50 (59.52) | Ref | |
Absence | 6 (60) | 34 (40.48) | 2.2 (0.57–8.4) | 0.31 |
DRB1*11 & 1*12 | ||||
DRB1*11+ & 1*12+ | 1 (10) | 15 (17.86) | Ref | |
DRB1*11− & 1*12− | 6 (60) | 25 (29.76) | 3.6 (0.39–32.87) | 0.39 |
DRB1*11+ & 1*12− | 0 (0) | 9 (10.71) | NA | |
DRB1*11− & 1*12+ | 3 (30) | 35 (41.67) | 1.28 (0.12–13.38) | 0.66 |
Allelic carrying and overweight/obesity
Alleles | BMI | OR (95% CI) | p value | |
---|---|---|---|---|
Normal, N (%) | Overweight/obesity, N (%) | |||
DRB1*11 | ||||
DRB1*11+ | 1 (5.88) | 14 (31.11) | Ref | |
DRB1*11− | 16 (94.12) | 31 (68.89) | 0.13 (0.01–1.14) | 0.03 |
DRB1*12 | ||||
DRB1*12+ | 11 (64.70) | 25 (55.56) | Ref | |
DRB1*12− | 6 (35.30) | 20 (44.44) | 0.8 (0.28–2.22) | 0.43 |
DRB1*11 & 1*12 | ||||
DRB1*11+ & 1*12+ | 1 (5.88) | 9 (20.00) | Ref | |
DRB1*11+ & 1*12− | 0 (0) | 5 (11.11) | — | NA |
DRB1*11− & 1*12+ | 10 (58.82) | 16 (35.56) | 0.17 | 0.10 |
DRB1*11− & 1*12− | 6 (35.30) | 15 (33.33) | 0.27 (0.02–2.69) | 0.37 |
4 Discussion
Once considered a disease of old age, breast cancer now affects much younger women. In our study population, the patients were relatively young (mean age was 45.19 ± 0.9 years). This average age is lower than that found by Bambara et al., 2017, who found average age to be 48.20 ± 12.4 years in their study of a population of Burkinabe women [28]. Since 1997, women with average age in 41–50 years of age group was identified as the most affected by breast cancer in Burkina Faso [29]. In addition, just over a quarter (25.53%) of the patients were under 40 years of age, a higher proportion than the 20.3% found recently in a study by Côte d’Ivoire [30]. In addition, there was a risk of breast cancer in women of age greater than 40 years (OR = 5.01; 95% CI [2.74–9.32]; and p = 0.001). This finding seems to correlate with the increase in breast cancer cases, which is generally proportional to the increase in age [31].
The age at the time of diagnosis of the cases ranged from 11 to 57 years. This average age is slightly lower than that found in the study by Côte d’Ivoire, which found 45.21 years as the age of diagnosis [32]. Our results indicate that early breast cancer is increasingly encountered in Burkina Faso. This situation could be related to the youth of the Burkinabe population. Indeed, 77.9% of the Burkinabe population was under 35 years of age in 2019 [33].
In this study, obesity or overweight was not associated with breast cancer risk (OR = 1.4; 95% CI [0.59–3.64]; and p = 0.48). In a previous study in Burkina Faso, 18.75% of patients were overweight, which increased the risk of developing cancer in non-multiparous women (p = 0.011), but there was no association between obesity and breast cancer [34]. Overall, it is known that African women are plump, so much so that several study cohorts, notably in Nigeria, have not found any risk of cancer linked to obesity [35]. However, postmenopausal obesity contributes to an increased risk of breast cancer in both the Caucasian races [36], black American [37] and black African populations [38].
The treatment of breast cancer depends on several parameters, both economic and technical. In this study, surgery was performed in the majority of patients (92.55% of cases). On the other hand, radiotherapy was used in just over a quarter (26.60%) of cases. These statistics confirm the finding that in sub-Saharan Africa, the treatment of choice was a mastectomy and that radiotherapy is still unavailable to treat breast cancer [39].
In most of these countries, the poor quality of the health systems is associated with the inexistence of a policy of prevention, screening, or management of cancers. Thus, 77% of sub-Saharan women are diagnosed with stage III or IV breast cancer. Hence, the survival rate of breast cancer patients in the country is very low.
The risk of developing breast cancer is proportionally correlated with the family relationship (degree of consanguinity). This risk would also be more accentuated according to the mutated genes found within the family [40]. Our results do not indicate an association between family history and risk of developing breast cancer. However, in Burkina Faso, in 2017, a study found an association between these two factors [28].
The HLA system is one of the most polymorphic gene systems in humans. Our results show that the HLA-DRB1*12 allele was the most frequent (56.63%), while the HLA-DRB1*11 allele was present in 24.49% of the study population. These frequencies are similar to those obtained in a Tunisian population where HLA-DRB1*12 was present in 49% of participants, while HLA-DRB1*11 represented only 14.36% [41]. However, our results are not similar to those of the Allele Frequency Net Database (AFND) accessible via the link http://www.allelefrequencies.net/, which estimates the carriage of the HLA-DRB1*11 allele at 17% and only 1% of the HLA-DRB1*12 allele in a population composed of 53 Mossi (majority ethnic group in Burkina Faso). Another study of 318 Black African descendants from Brazil found that 13.05% expressed the DRB1*11 allele, while 1.72% expressed the DRB1*12 allele [42]. These differences between our results and those of other studies could be related to the number of participants in each study. However, in general, most studies on these two alleles have reported a high carriage frequency of the DRB1*11 allele, while that of the DRB1*12 allele is very low.
Our results show that no risk of breast cancer was associated with the deletion of the HLA-DRB1*11 and DRB1*12 alleles. Various studies have investigated a possible association of genes of the HLA system. HLA class I genes are by far the most investigated. For HLA class II, HLA-DRB and HLA-DQ are the most studied genes. In various populations, two alleles of the HLA gene, namely HLA-DRB1*11 and HLA-DRB1*12, have been associated either with protection against breast carcinogenesis or with a risk of breast cancer [25]. There was no risk of breast cancer associated with carrying or not carrying these two alleles in our study. In addition, research on the associative effect of carrying these two alleles had shown no risk with the family history of breast cancer. Our results are consistent with those found in an Iranian population where the risk of carrying these alleles was not associated with a risk of breast cancer development [43]. The same was the case for studying these alleles in relation to age at the time of diagnosis of breast cancer [44]. In addition, other studies of Arabs in Tunisia [45] and Turkey [46] have not found any risk related to the carriage of HLA-DRB1*11 and HLA-DRB1*12 alleles and breast cancer. On the other hand, another study in Tunisia had found that the allele DRB1*11 was associated with protection against breast cancer in a Caucasian population (p = 0.0001). However, they did not find an association between carrying the DRB1*12 allele and a risk of developing this cancer [47]. However, a study in Iran found the contrast of these latest results in Tunisia. Indeed, this study found an association between carrying the DRB1*12 allele and an increased risk of breast cancer (p = 0.03). In contrast, the DRB1*11 allele did not show a significant association with this cancer [48]. Another study in a Jordanian population found no association between carrying the HLA DRB1*11 allele and the risk of developing breast cancer [49]. Also, Iran authors found a negative association between the alleles, HLA-DRB1*1301 and HLA-DRB1*0101, and breast cancer, while they found positive associations between the allele HLA-DQA1*0301 and this cancer [44]. Similarly, in Mexico, a Latino population study associated the HLA-DRB1*1602 allele with breast cancer [50]. Recently in Italy, authors have shown that DRB1*11 was rather associated with an increased risk of breast cancer (OR = 2.39 and p = 0.0019), while the DRB1*12 allele was not associated with any risk [25]. Also, in Italy, HLA-DRB1*11:01 and HLA-DRB1*10:01 alleles were associated with breast cancer risk [25]. In Turkey, Gun et al. 2012, found no association between HLA-DRB1*03 and breast cancer, while HLA-DRB1*13 was correlated with progesterone receptor expression [46]. In the same study, they found an association between HLA-DRB1*03, HLA-DRB1*13, and protection against this cancer, while HLA-DRB1*04 was linked to a poor prognosis in their study population [46].
In our study, deletion of the HLA-DRB1*11 allele was associated (beneficial effect) with obesity/overweight (OR = 0.13; 95% CI [0.01–1.14]; and p = 0.03). Thus, an obese or overweight person with this mutated HLA-DRB1*11 allele has less risk of tumor cell escape from the HLA system. Although obesity is a risk factor for cancer, this result may be related to the protective effect of obesity on cancer occurrence in the black population [35,51].
Thus, these different studies show divergent or even contradictory results depending on the populations investigated, hence the need for more in-depth studies in different populations to establish meta-analyses that can be used for very advanced risk analyses.
This work is a preliminary study of the involvement of HLA gene system alleles in breast cancer in women of Burkina Faso. In addition, we are aware of the statistical bias due to the size of our study population. For this last point, it is useful to emphasize that access to women with breast cancer in Burkina Faso remains somewhat difficult because cancer care is still being improved through universal health insurance and the creation of cancer services in the country’s regions.
5 Conclusion
This study explored the frequency of HLA-DRB1*11 and 1*12 alleles and their involvement in breast cancer. Deleting the HLA-DRB1*11 allele is associated with obesity/overweight, which is a risk for cancer development. However, the relatively early age of breast cancer diagnosis requires further investigation of the other HLA gene alleles. In addition, further investigation of a wide range of HLA gene alleles in a large population may provide more information.
Acknowledgments
We thank the CHU-Bogodogo. CHU-YO, CMA PAUL VI, CMA SCHIPHRA for hosting the study, the participants for agreeing to be part of the study, and CERBA/LABIOGENE for the technical platform for molecular testing.
-
Funding information: The authors state no funding involved.
-
Author contributions: A.A.Z., I.T.K., A.T.Y., P.A.S., and L.J.A. designed this study. L.J.A., I.T.K., N.Z., A.H.B., M.N.L.O., and A.Y.S. recruited patients and controls cases. L.J.A., I.T.K., F.I.Z., S.V.Z., D.T.L., L.T., I.T.K., and A.A.Z. carried out the manipulations. L.J.A., B.V.J.T.E.B., and A.A.Z. carried out statistical analyses and wrote the manuscript. H.K.S., B.V.J.T.E.B., P.A.S., A.T.Y., T.M.Z., F.W.D., and J.S. revised the manuscript. All authors have read and corrected the manuscript.
-
Conflict of interest: The authors state no conflict of interest.
-
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
[1] Sung H , Ferlay J , Siegel RL , Laversanne M , Soerjomataram I , Jemal A , et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71:209–49. 10.3322/caac.21660.Suche in Google Scholar PubMed
[2] Viassolo V , Ayme A , Chappuis PO . Cancer du sein: risque génétique. Imag de la Femme. 2016;26:95–104. 10.1016/j.femme.2016.04.009.Suche in Google Scholar
[3] Noorani HZ , McGahan L . Office canadien de coordination de l’évaluation des technologies de la santé. L’examen génétique prédictif des cancers du sein et de la prostate. Ottawa: Office canadien de coordination de l’évaluation des technologies de la santé; 2000.Suche in Google Scholar
[4] Oldenburg RA , Meijers-Heijboer H , Cornelisse CJ , Devilee P . Genetic susceptibility for breast cancer: How many more genes to be found? Crit Rev Oncol/Hematol. 2007;63:125–49. 10.1016/j.critrevonc.2006.12.004.Suche in Google Scholar PubMed
[5] Chic N , Schettini F , Brasó-Maristany F , Sanfeliu E , Adamo B , Vidal M , et al. Oestrogen receptor activity in hormone-dependent breast cancer during chemotherapy. EBioMedicine. 2021;69:103451. 10.1016/j.ebiom.2021.103451.Suche in Google Scholar PubMed PubMed Central
[6] Radenkovic S , Konjevic G , Isakovic A , Stevanovic P , Gopcevic K , Jurisic V . HER2-positive breast cancer patients: correlation between mammographic and pathological findings. Radiat Prot Dosimetry. 2014;162:125–8. 10.1093/rpd/ncu243.Suche in Google Scholar PubMed
[7] Antoine M , Teilhac M-F , Poulet B , Cros J . De la cellule mammaire normale à la cellule cancéreuse. Méd Nucl. 2010;34:14–22. 10.1016/j.mednuc.2009.11.003.Suche in Google Scholar
[8] Gewefel H , Salhia B . Breast cancer in adolescent and young adult women. Clin Breast Cancer. 2014;14:390–5. 10.1016/j.clbc.2014.06.002.Suche in Google Scholar PubMed
[9] Cornejo-Moreno BA , Uribe-Escamilla D , Salamanca-Gómez F . Breast cancer genes: looking for BRaCA’s lost brother. IMAJ. 2014;16:6.Suche in Google Scholar
[10] Filippini SE , Vega AV . Breast cancer genes: beyond BRCA1 and BRCA2. Front Biosci. 2013;18:1358. 10.2741/4185.Suche in Google Scholar PubMed
[11] Klein J , Sato A . The HLA system. N Engl J Med. 2000;343:782–6. 10.1056/NEJM200009143431106.Suche in Google Scholar PubMed
[12] Chardon P . Le polymorphisme du complexe majeur d’histocompatibilité. INRA Prod Anim. 2000;13:63–7. 10.20870/productions-animales.2000.13.HS.3812.Suche in Google Scholar
[13] Dunn GP , Bruce AT , Ikeda H , Old LJ , Schreiber RD . Cancer immunoediting: from immunosurveillance to tumor escape. Nat Immunol. 2002;3:991–8. 10.1038/ni1102-991.Suche in Google Scholar
[14] Accolla RS , Ramia E , Tedeschi A , Forlani G . CIITA-driven MHC class II expressing tumor cells as antigen presenting cell performers: toward the construction of an optimal anti-tumor vaccine. Front Immunol. 2019;10:1806. 10.3389/fimmu.2019.01806.Suche in Google Scholar
[15] Garrido F , Ruiz-Cabello F , Cabrera T , Pérez-Villar JJ , López-Botet M , Duggan-Keen M , et al. Implications for immunosurveillance of altered HLA class I phenotypes in human tumours. Immunol Today. 1997;18:89–95. 10.1016/S0167-5699(96)10075-X.Suche in Google Scholar
[16] Algarra I , Garcia-Lora A , Cabrera T , Ruiz-Cabello F , Garrido F . The selection of tumor variants with altered expression of classical and nonclassical MHC class I molecules: implications for tumor immune escape. Cancer Immunol Immunother. 2004;53(10):904–10. 10.1007/s00262-004-0517-9.Suche in Google Scholar PubMed
[17] Garcia‐Lora A , Algarra I , Garrido F . MHC class I antigens, immune surveillance, and tumor immune escape. J Cell Physiol. 2003;195:346–55. 10.1002/jcp.10290.Suche in Google Scholar PubMed
[18] Prestwich RJ , Errington F , Hatfield P , Merrick AE , Ilett EJ , Selby PJ , et al. The Immune system – is it relevant to cancer development, progression and treatment? Clin Oncol. 2008;20:101–12. 10.1016/j.clon.2007.10.011.Suche in Google Scholar PubMed
[19] Yan W-H . HLA-G expression in cancers: potential role in diagnosis, prognosis and therapy. EMIDDT. 2011;11:76–89. 10.2174/187153011794982059.Suche in Google Scholar PubMed
[20] Elliott RL , Jiang XP , Phillips JT , Barnett BG , Head JF . Human leukocyte antigen G expression in breast cancer: role in immunosuppression. Cancer Biother Radiopharma. 2011;26:153–7. 10.1089/cbr.2010.0924.Suche in Google Scholar PubMed
[21] Konjević G , Jurišić V , Spužić I . Association of NK cell dysfunction with changes in LDH characteristics of peripheral blood lymphocytes (PBL) in breast cancer patients. Breast Cancer Res Treat. 2001;66:255–63. 10.1023/A:1010602822483.Suche in Google Scholar
[22] Sengupta N , MacFie TS , MacDonald TT , Pennington D , Silver AR . Cancer immunoediting and “spontaneous” tumor regression. Pathol – Res Pract. 2010;206:1–8. 10.1016/j.prp.2009.10.001.Suche in Google Scholar PubMed
[23] Jurisic V . Multiomic analysis of cytokines in immuno-oncology. Expert Rev Proteom. 2020;17:663–74. 10.1080/14789450.2020.1845654.Suche in Google Scholar PubMed
[24] Paul P . MS_1990_5_449.pdf. Médecine/Sciences. 1990;6:449–55.10.4267/10608/4167Suche in Google Scholar
[25] Aureli A , Canossi A , Del Beato T , Buonomo O , Rossi P , Roselli M , et al. Breast cancer is associated with increased HLA-DRB1*11:01 and HLA-DRB1*10:01 allele frequency in a population of patients from central Italy. Immunol Invest. 2020;49:489–97. 10.1080/08820139.2020.1737539.Suche in Google Scholar PubMed
[26] Miller SA , Dykes DD , Polesky HF . A simple salting out procedure for extracting DNA from human nucleated cells. Nucl Acids Res. 1988;16:1215–5. 10.1093/nar/16.3.1215.Suche in Google Scholar PubMed PubMed Central
[27] Ma S , Wu J , Wu J , Wei Y , Zhang L , Ning Q , et al. Relationship between HLA-DRB1 allele polymorphisms and familial aggregations of hepatocellular carcinoma. Curr Oncol. 2015;23:1. 10.3747/co.23.2839.Suche in Google Scholar PubMed PubMed Central
[28] Bambara HA , Zouré AA , Sawadogo AY , Ouattara AK , Ouédraogo NLM , Traoré SS , et al. Breast cancer: descriptive profile of 80 women attending breast cancer care in the Department of General and Digestive Surgery of CHU-YO. Pan Afr Med J. 2017;28:314. 10.11604/pamj.2017.28.314.10203.Suche in Google Scholar PubMed PubMed Central
[29] Sano D , Lankoande J , Dao B , Cisse R , Traore SS , Soudre RB , et al. Le cancer du sein, problèmes diagnostiques et thérapeutiques au chu de ouagadougou. Méd d’Afrique Noire. 1997;4:578–81.Suche in Google Scholar
[30] Aka EK , Horo A , Koffi A , Fanny M , Didi-Kouko C , Nda G , et al. Breast cancer in adolescent and young adult Ivory coast women: epidemiological and clinical features and molecular subdivision. Int J Reprod Contracept Obstet Gynecol. 2021;10:848. 10.18203/2320-1770.ijrcog20210698.Suche in Google Scholar
[31] McPherson K , Steel CM , Dixon JM . Breast cancer – epidemiology, risk factors, and genetics. BMJ. 2000;321:624–8.10.1136/bmj.321.7261.624Suche in Google Scholar PubMed PubMed Central
[32] Kouame J . Epidemiology and histology aspects of breast cancers of women in Ivory coast. J Cancer Ther. 2012;03:782–6. 10.4236/jct.2012.325098.Suche in Google Scholar
[33] Institut National de la Statistique et de la Démographie (INSD) . Annuaire_Statistique_National_2019.pdf 2020.Suche in Google Scholar
[34] Zouré AA , Bambara AH , Sawadogo AY , Ouattara AK , Ouédraogo M , Traoré SS , et al. Multiparity and breast cancer risk factor among women in Burkina Faso. Asian Pac J Cancer Prev. 2016;17:5095–9. 10.22034/APJCP.2016.17.12.5095.Suche in Google Scholar PubMed PubMed Central
[35] Adebamowo CA , Ogundiran TO , Adenipekun AA , Oyesegun RA , Campbell OB , Akang EE , et al. Waist–hip ratio and breast cancer risk in urbanized Nigerian women. Breast Cancer Res. 2003;5:R18–24.10.1186/bcr567Suche in Google Scholar
[36] Lahmann PH , Hoffmann K , Allen N , van Gils CH , Khaw K-T , Tehard B , et al. Body size and breast cancer risk: findings from the European prospective investigation into cancer and nutrition (EPIC): body size and breast cancer. Int J Cancer. 2004;111:762–71. 10.1002/ijc.20315.Suche in Google Scholar
[37] Zhu K , Caulfield J , Hunter S , Roland CL , Payne-Wilks K , Texter L . Body mass index and breast cancer risk in African American women. Ann Epidemiol. 2005;15:123–8. 10.1016/j.annepidem.2004.05.011 Suche in Google Scholar
[38] Ogundiran TO , Huo D , Adenipekun A , Campbell O , Oyesegun R , Akang E , et al. Case-control study of body size and breast cancer risk in Nigerian women. Am J Epidemiol. 2010;172:682–90. 10.1093/aje/kwq180.Suche in Google Scholar
[39] Kantelhardt EJ , Muluken G , Sefonias G , Wondimu A , Gebert HC , Unverzagt S , et al. A review on breast cancer care in Africa. Breast Care. 2015;10:364–70. 10.1159/000443156.Suche in Google Scholar
[40] Namer M . La prévention des cancers du sein. Méd Nucl. 2010;34:3–13. 10.1016/j.mednuc.2009.11.005.Suche in Google Scholar
[41] Hmida S , Gauthier A , Dridi A , Quillivic F , Genetet B , Boukef K , et al. HLA class II gene polymorphism in Tunisians. Tissue Antigens. 1995;45:63–8. 10.1111/j.1399-0039.1995.tb02416.x.Suche in Google Scholar
[42] Ayo CM , da Silveira Camargo AV , Xavier DH , Batista MF , Carneiro OA , Brandão de Mattos CC , et al. Frequencies of allele groups HLA-A, HLA-B and HLA-DRB1 in a population from the northwestern region of São Paulo State, Brazil. Int J Immunogenet. 2015;42:19–25. 10.1111/iji.12159.Suche in Google Scholar
[43] Amirzargar A , Mytilineos J , Farjadian Sh , Doroudchi , Scherer M , Opelz S , G , et al. Human leukocyte antigen class II allele frequencies and haplotype association in Iranian normal population. Hum Immunol. 2001;62:1234–8. 10.1016/S0198-8859(01)00320-2.Suche in Google Scholar
[44] Mahmoodi M , Nahvi H , Mahmoudi M , Kasaian A , Mohagheghi M-A , Divsalar K , et al. HLA-DRB1, -DQA1 and -DQB1 allele and haplotype frequencies in female patients with early onset breast cancer. Pathol Oncol Res. 2012;18:49– 55. 10.1007/s12253-011-9415-6.Suche in Google Scholar PubMed
[45] Harrath AB , Loueslati BY , Troudi W , Hmida S , Sedkaoui S , Dridi A , et al. HLA class II polymorphism: protective or risk factors to breast cancer in Tunisia? Pathol Oncol Res. 2006;12:79–81. 10.1007/BF02893448.Suche in Google Scholar PubMed
[46] Gun FD , Ozturk OG , Polat A , Polat G . HLA class-II allele frequencies in Turkish breast cancer patients. Med Oncol. 2012;29:466–71. 10.1007/s12032-011-9873-4.Suche in Google Scholar PubMed
[47] Chaudhuri S , Cariappa A , Tang M , Bell D , Haber DA , Isselbacher KJ , et al. Genetic susceptibility to breast cancer: HLA DQB*03032 and HLA DRB1*11 may represent protective alleles. Proc Natl Acad Sci. 2000;97:11451–4. 10.1073/pnas.97.21.11451.Suche in Google Scholar PubMed PubMed Central
[48] Ghaderi A , Talei A , Gharesi-Fard B , Farjadian SH , Amirzargar A , Vasei M. HLA-DRB 1 alleles and the susceptibility of Iranian patients with breast cancer. Pathol Oncol Res. 2001;7:39–41. 10.1007/BF03032603.Suche in Google Scholar PubMed
[49] Atoum MF , Tanashat RQ , Mahmoud SAH . Negative association of the HLA-DQB1*02 allele with breast cancer development among Jordanians. Asian Pac J Cancer Prev. 2013;14:7007–10. 10.7314/APJCP.2013.14.11.7007.Suche in Google Scholar PubMed
[50] Cantú de León D , Pérez-Montiel D , Villavicencio V , Carranca AG , Betancourt AM , Acuña-Alonzo V , et al. High resolution human leukocyte antigen (HLA) class I and class II allele typing in Mexican mestizo women with sporadic breast cancer: case-control study. BMC Cancer. 2009;9:48. 10.1186/1471-2407-9-48.Suche in Google Scholar PubMed PubMed Central
[51] Palmer JR , Adams-Campbell LL , Boggs DA , Wise LA , Rosenberg L . A prospective study of body size and breast cancer in black women. Cancer Epidemiol Biomarkers Prev. 2007;16:1795–802. 10.1158/1055-9965.EPI-07-0336.Suche in Google Scholar PubMed
© 2021 Abdou Azaque Zouré et al., published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Artikel in diesem Heft
- Biomedical Sciences
- Research progress on the mechanism of orexin in pain regulation in different brain regions
- Adriamycin-resistant cells are significantly less fit than adriamycin-sensitive cells in cervical cancer
- Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
- Iris metastasis of diffuse large B-cell lymphoma misdiagnosed as primary angle-closure glaucoma: A case report and review of the literature
- LncRNA PVT1 promotes cervical cancer progression by sponging miR-503 to upregulate ARL2 expression
- Two new inflammatory markers related to the CURB-65 score for disease severity in patients with community-acquired pneumonia: The hypersensitive C-reactive protein to albumin ratio and fibrinogen to albumin ratio
- Circ_0091579 enhances the malignancy of hepatocellular carcinoma via miR-1287/PDK2 axis
- Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-κB signaling pathway
- Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats
- ABCB1 polymorphism in clopidogrel-treated Montenegrin patients
- Metabolic profiling of fatty acids in Tripterygium wilfordii multiglucoside- and triptolide-induced liver-injured rats
- miR-338-3p inhibits cell growth, invasion, and EMT process in neuroblastoma through targeting MMP-2
- Verification of neuroprotective effects of alpha-lipoic acid on chronic neuropathic pain in a chronic constriction injury rat model
- Circ_WWC3 overexpression decelerates the progression of osteosarcoma by regulating miR-421/PDE7B axis
- Knockdown of TUG1 rescues cardiomyocyte hypertrophy through targeting the miR-497/MEF2C axis
- MiR-146b-3p protects against AR42J cell injury in cerulein-induced acute pancreatitis model through targeting Anxa2
- miR-299-3p suppresses cell progression and induces apoptosis by downregulating PAX3 in gastric cancer
- Diabetes and COVID-19
- Discovery of novel potential KIT inhibitors for the treatment of gastrointestinal stromal tumor
- TEAD4 is a novel independent predictor of prognosis in LGG patients with IDH mutation
- circTLK1 facilitates the proliferation and metastasis of renal cell carcinoma by regulating miR-495-3p/CBL axis
- microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury
- Long noncoding RNA TUG1 regulates degradation of chondrocyte extracellular matrix via miR-320c/MMP-13 axis in osteoarthritis
- Duodenal adenocarcinoma with skin metastasis as initial manifestation: A case report
- Effects of Loofah cylindrica extract on learning and memory ability, brain tissue morphology, and immune function of aging mice
- Recombinant Bacteroides fragilis enterotoxin-1 (rBFT-1) promotes proliferation of colorectal cancer via CCL3-related molecular pathways
- Blocking circ_UBR4 suppressed proliferation, migration, and cell cycle progression of human vascular smooth muscle cells in atherosclerosis
- Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
- Downregulation of circ_0037655 impedes glioma formation and metastasis via the regulation of miR-1229-3p/ITGB8 axis
- Vitamin D deficiency and cardiovascular risk in type 2 diabetes population
- Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis
- Mechanisms of circular RNA circ_0066147 on pancreatic cancer progression
- lncRNA myocardial infarction-associated transcript (MIAT) knockdown alleviates LPS-induced chondrocytes inflammatory injury via regulating miR-488-3p/sex determining region Y-related HMG-box 11 (SOX11) axis
- Identification of circRNA circ-CSPP1 as a potent driver of colorectal cancer by directly targeting the miR-431/LASP1 axis
- Hyperhomocysteinemia exacerbates ischemia-reperfusion injury-induced acute kidney injury by mediating oxidative stress, DNA damage, JNK pathway, and apoptosis
- Potential prognostic markers and significant lncRNA–mRNA co-expression pairs in laryngeal squamous cell carcinoma
- Gamma irradiation-mediated inactivation of enveloped viruses with conservation of genome integrity: Potential application for SARS-CoV-2 inactivated vaccine development
- ADHFE1 is a correlative factor of patient survival in cancer
- The association of transcription factor Prox1 with the proliferation, migration, and invasion of lung cancer
- Is there a relationship between the prevalence of autoimmune thyroid disease and diabetic kidney disease?
- Immunoregulatory function of Dictyophora echinovolvata spore polysaccharides in immunocompromised mice induced by cyclophosphamide
- T cell epitopes of SARS-CoV-2 spike protein and conserved surface protein of Plasmodium malariae share sequence homology
- Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
- Long noncoding RNA HULC contributes to paclitaxel resistance in ovarian cancer via miR-137/ITGB8 axis
- Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
- Prognostic value of the neutrophil-to-lymphocyte ratio in acute organophosphorus pesticide poisoning
- Gastroprotective effects of diosgenin against HCl/ethanol-induced gastric mucosal injury through suppression of NF-κβ and myeloperoxidase activities
- Silencing of LINC00707 suppresses cell proliferation, migration, and invasion of osteosarcoma cells by modulating miR-338-3p/AHSA1 axis
- Successful extracorporeal membrane oxygenation resuscitation of patient with cardiogenic shock induced by phaeochromocytoma crisis mimicking hyperthyroidism: A case report
- Effects of miR-185-5p on replication of hepatitis C virus
- Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis
- Primary localized cutaneous nodular amyloidosis presenting as lymphatic malformation: A case report
- Multimodal magnetic resonance imaging analysis in the characteristics of Wilson’s disease: A case report and literature review
- Therapeutic potential of anticoagulant therapy in association with cytokine storm inhibition in severe cases of COVID-19: A case report
- Neoadjuvant immunotherapy combined with chemotherapy for locally advanced squamous cell lung carcinoma: A case report and literature review
- Rufinamide (RUF) suppresses inflammation and maintains the integrity of the blood–brain barrier during kainic acid-induced brain damage
- Inhibition of ADAM10 ameliorates doxorubicin-induced cardiac remodeling by suppressing N-cadherin cleavage
- Invasive ductal carcinoma and small lymphocytic lymphoma/chronic lymphocytic leukemia manifesting as a collision breast tumor: A case report and literature review
- Clonal diversity of the B cell receptor repertoire in patients with coronary in-stent restenosis and type 2 diabetes
- CTLA-4 promotes lymphoma progression through tumor stem cell enrichment and immunosuppression
- WDR74 promotes proliferation and metastasis in colorectal cancer cells through regulating the Wnt/β-catenin signaling pathway
- Down-regulation of IGHG1 enhances Protoporphyrin IX accumulation and inhibits hemin biosynthesis in colorectal cancer by suppressing the MEK-FECH axis
- Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
- Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway
- lncRNA NEAT1 regulates CYP1A2 and influences steroid-induced necrosis
- A two-microRNA signature predicts the progression of male thyroid cancer
- Isolation of microglia from retinas of chronic ocular hypertensive rats
- Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study
- Calcineurin Aβ gene knockdown inhibits transient outward potassium current ion channel remodeling in hypertrophic ventricular myocyte
- Aberrant expression of PI3K/AKT signaling is involved in apoptosis resistance of hepatocellular carcinoma
- Clinical significance of activated Wnt/β-catenin signaling in apoptosis inhibition of oral cancer
- circ_CHFR regulates ox-LDL-mediated cell proliferation, apoptosis, and EndoMT by miR-15a-5p/EGFR axis in human brain microvessel endothelial cells
- Resveratrol pretreatment mitigates LPS-induced acute lung injury by regulating conventional dendritic cells’ maturation and function
- Ubiquitin-conjugating enzyme E2T promotes tumor stem cell characteristics and migration of cervical cancer cells by regulating the GRP78/FAK pathway
- Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
- Protective effect of Lactobacillus-containing probiotics on intestinal mucosa of rats experiencing traumatic hemorrhagic shock
- Glucocorticoids induce osteonecrosis of the femoral head through the Hippo signaling pathway
- Endothelial cell-derived SSAO can increase MLC20 phosphorylation in VSMCs
- Downregulation of STOX1 is a novel prognostic biomarker for glioma patients
- miR-378a-3p regulates glioma cell chemosensitivity to cisplatin through IGF1R
- The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats
- TGF-β1-overexpressing mesenchymal stem cells reciprocally regulate Th17/Treg cells by regulating the expression of IFN-γ
- The influence of MTHFR genetic polymorphisms on methotrexate therapy in pediatric acute lymphoblastic leukemia
- Red blood cell distribution width-standard deviation but not red blood cell distribution width-coefficient of variation as a potential index for the diagnosis of iron-deficiency anemia in mid-pregnancy women
- Small cell neuroendocrine carcinoma expressing alpha fetoprotein in the endometrium
- Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers
- Molecular characterization and phylogenetic studies of Echinococcus granulosus and Taenia multiceps coenurus cysts in slaughtered sheep in Saudi Arabia
- ITGB5 mutation discovered in a Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
- ACTB and GAPDH appear at multiple SDS-PAGE positions, thus not suitable as reference genes for determining protein loading in techniques like Western blotting
- Facilitation of mouse skin-derived precursor growth and yield by optimizing plating density
- 3,4-Dihydroxyphenylethanol ameliorates lipopolysaccharide-induced septic cardiac injury in a murine model
- Downregulation of PITX2 inhibits the proliferation and migration of liver cancer cells and induces cell apoptosis
- Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B
- Novel predictor of the occurrence of DKA in T1DM patients without infection: A combination of neutrophil/lymphocyte ratio and white blood cells
- Investigation of molecular regulation mechanism under the pathophysiology of subarachnoid hemorrhage
- miR-25-3p protects renal tubular epithelial cells from apoptosis induced by renal IRI by targeting DKK3
- Bioengineering and Biotechnology
- Green fabrication of Co and Co3O4 nanoparticles and their biomedical applications: A review
- Agriculture
- Effects of inorganic and organic selenium sources on the growth performance of broilers in China: A meta-analysis
- Crop-livestock integration practices, knowledge, and attitudes among smallholder farmers: Hedging against climate change-induced shocks in semi-arid Zimbabwe
- Food Science and Nutrition
- Effect of food processing on the antioxidant activity of flavones from Polygonatum odoratum (Mill.) Druce
- Vitamin D and iodine status was associated with the risk and complication of type 2 diabetes mellitus in China
- Diversity of microbiota in Slovak summer ewes’ cheese “Bryndza”
- Comparison between voltammetric detection methods for abalone-flavoring liquid
- Composition of low-molecular-weight glutenin subunits in common wheat (Triticum aestivum L.) and their effects on the rheological properties of dough
- Application of culture, PCR, and PacBio sequencing for determination of microbial composition of milk from subclinical mastitis dairy cows of smallholder farms
- Investigating microplastics and potentially toxic elements contamination in canned Tuna, Salmon, and Sardine fishes from Taif markets, KSA
- From bench to bar side: Evaluating the red wine storage lesion
- Establishment of an iodine model for prevention of iodine-excess-induced thyroid dysfunction in pregnant women
- Plant Sciences
- Characterization of GMPP from Dendrobium huoshanense yielding GDP-D-mannose
- Comparative analysis of the SPL gene family in five Rosaceae species: Fragaria vesca, Malus domestica, Prunus persica, Rubus occidentalis, and Pyrus pyrifolia
- Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR
- Investigation of bioactivities of Taxus chinensis, Taxus cuspidata, and Taxus × media by gas chromatography-mass spectrometry
- Morphological structures and histochemistry of roots and shoots in Myricaria laxiflora (Tamaricaceae)
- Transcriptome analysis of resistance mechanism to potato wart disease
- In silico analysis of glycosyltransferase 2 family genes in duckweed (Spirodela polyrhiza) and its role in salt stress tolerance
- Comparative study on growth traits and ions regulation of zoysiagrasses under varied salinity treatments
- Role of MS1 homolog Ntms1 gene of tobacco infertility
- Biological characteristics and fungicide sensitivity of Pyricularia variabilis
- In silico/computational analysis of mevalonate pyrophosphate decarboxylase gene families in Campanulids
- Identification of novel drought-responsive miRNA regulatory network of drought stress response in common vetch (Vicia sativa)
- How photoautotrophy, photomixotrophy, and ventilation affect the stomata and fluorescence emission of pistachios rootstock?
- Apoplastic histochemical features of plant root walls that may facilitate ion uptake and retention
- Ecology and Environmental Sciences
- The impact of sewage sludge on the fungal communities in the rhizosphere and roots of barley and on barley yield
- Domestication of wild animals may provide a springboard for rapid variation of coronavirus
- Response of benthic invertebrate assemblages to seasonal and habitat condition in the Wewe River, Ashanti region (Ghana)
- Molecular record for the first authentication of Isaria cicadae from Vietnam
- Twig biomass allocation of Betula platyphylla in different habitats in Wudalianchi Volcano, northeast China
- Animal Sciences
- Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens
- Predators of the giant pine scale, Marchalina hellenica (Gennadius 1883; Hemiptera: Marchalinidae), out of its natural range in Turkey
- Honey in wound healing: An updated review
- NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block
- Radiotherapy for the treatment of pulmonary hydatidosis in sheep
- Retraction
- Retraction of “Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating microRNA-34a-5p/NOTCH1 signaling pathway”
- Special Issue on Reuse of Agro-Industrial By-Products
- An effect of positional isomerism of benzoic acid derivatives on antibacterial activity against Escherichia coli
- Special Issue on Computing and Artificial Techniques for Life Science Applications - Part II
- Relationship of Gensini score with retinal vessel diameter and arteriovenous ratio in senile CHD
- Effects of different enantiomers of amlodipine on lipid profiles and vasomotor factors in atherosclerotic rabbits
- Establishment of the New Zealand white rabbit animal model of fatty keratopathy associated with corneal neovascularization
- lncRNA MALAT1/miR-143 axis is a potential biomarker for in-stent restenosis and is involved in the multiplication of vascular smooth muscle cells
Artikel in diesem Heft
- Biomedical Sciences
- Research progress on the mechanism of orexin in pain regulation in different brain regions
- Adriamycin-resistant cells are significantly less fit than adriamycin-sensitive cells in cervical cancer
- Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
- Iris metastasis of diffuse large B-cell lymphoma misdiagnosed as primary angle-closure glaucoma: A case report and review of the literature
- LncRNA PVT1 promotes cervical cancer progression by sponging miR-503 to upregulate ARL2 expression
- Two new inflammatory markers related to the CURB-65 score for disease severity in patients with community-acquired pneumonia: The hypersensitive C-reactive protein to albumin ratio and fibrinogen to albumin ratio
- Circ_0091579 enhances the malignancy of hepatocellular carcinoma via miR-1287/PDK2 axis
- Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-κB signaling pathway
- Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats
- ABCB1 polymorphism in clopidogrel-treated Montenegrin patients
- Metabolic profiling of fatty acids in Tripterygium wilfordii multiglucoside- and triptolide-induced liver-injured rats
- miR-338-3p inhibits cell growth, invasion, and EMT process in neuroblastoma through targeting MMP-2
- Verification of neuroprotective effects of alpha-lipoic acid on chronic neuropathic pain in a chronic constriction injury rat model
- Circ_WWC3 overexpression decelerates the progression of osteosarcoma by regulating miR-421/PDE7B axis
- Knockdown of TUG1 rescues cardiomyocyte hypertrophy through targeting the miR-497/MEF2C axis
- MiR-146b-3p protects against AR42J cell injury in cerulein-induced acute pancreatitis model through targeting Anxa2
- miR-299-3p suppresses cell progression and induces apoptosis by downregulating PAX3 in gastric cancer
- Diabetes and COVID-19
- Discovery of novel potential KIT inhibitors for the treatment of gastrointestinal stromal tumor
- TEAD4 is a novel independent predictor of prognosis in LGG patients with IDH mutation
- circTLK1 facilitates the proliferation and metastasis of renal cell carcinoma by regulating miR-495-3p/CBL axis
- microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury
- Long noncoding RNA TUG1 regulates degradation of chondrocyte extracellular matrix via miR-320c/MMP-13 axis in osteoarthritis
- Duodenal adenocarcinoma with skin metastasis as initial manifestation: A case report
- Effects of Loofah cylindrica extract on learning and memory ability, brain tissue morphology, and immune function of aging mice
- Recombinant Bacteroides fragilis enterotoxin-1 (rBFT-1) promotes proliferation of colorectal cancer via CCL3-related molecular pathways
- Blocking circ_UBR4 suppressed proliferation, migration, and cell cycle progression of human vascular smooth muscle cells in atherosclerosis
- Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
- Downregulation of circ_0037655 impedes glioma formation and metastasis via the regulation of miR-1229-3p/ITGB8 axis
- Vitamin D deficiency and cardiovascular risk in type 2 diabetes population
- Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis
- Mechanisms of circular RNA circ_0066147 on pancreatic cancer progression
- lncRNA myocardial infarction-associated transcript (MIAT) knockdown alleviates LPS-induced chondrocytes inflammatory injury via regulating miR-488-3p/sex determining region Y-related HMG-box 11 (SOX11) axis
- Identification of circRNA circ-CSPP1 as a potent driver of colorectal cancer by directly targeting the miR-431/LASP1 axis
- Hyperhomocysteinemia exacerbates ischemia-reperfusion injury-induced acute kidney injury by mediating oxidative stress, DNA damage, JNK pathway, and apoptosis
- Potential prognostic markers and significant lncRNA–mRNA co-expression pairs in laryngeal squamous cell carcinoma
- Gamma irradiation-mediated inactivation of enveloped viruses with conservation of genome integrity: Potential application for SARS-CoV-2 inactivated vaccine development
- ADHFE1 is a correlative factor of patient survival in cancer
- The association of transcription factor Prox1 with the proliferation, migration, and invasion of lung cancer
- Is there a relationship between the prevalence of autoimmune thyroid disease and diabetic kidney disease?
- Immunoregulatory function of Dictyophora echinovolvata spore polysaccharides in immunocompromised mice induced by cyclophosphamide
- T cell epitopes of SARS-CoV-2 spike protein and conserved surface protein of Plasmodium malariae share sequence homology
- Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
- Long noncoding RNA HULC contributes to paclitaxel resistance in ovarian cancer via miR-137/ITGB8 axis
- Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
- Prognostic value of the neutrophil-to-lymphocyte ratio in acute organophosphorus pesticide poisoning
- Gastroprotective effects of diosgenin against HCl/ethanol-induced gastric mucosal injury through suppression of NF-κβ and myeloperoxidase activities
- Silencing of LINC00707 suppresses cell proliferation, migration, and invasion of osteosarcoma cells by modulating miR-338-3p/AHSA1 axis
- Successful extracorporeal membrane oxygenation resuscitation of patient with cardiogenic shock induced by phaeochromocytoma crisis mimicking hyperthyroidism: A case report
- Effects of miR-185-5p on replication of hepatitis C virus
- Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis
- Primary localized cutaneous nodular amyloidosis presenting as lymphatic malformation: A case report
- Multimodal magnetic resonance imaging analysis in the characteristics of Wilson’s disease: A case report and literature review
- Therapeutic potential of anticoagulant therapy in association with cytokine storm inhibition in severe cases of COVID-19: A case report
- Neoadjuvant immunotherapy combined with chemotherapy for locally advanced squamous cell lung carcinoma: A case report and literature review
- Rufinamide (RUF) suppresses inflammation and maintains the integrity of the blood–brain barrier during kainic acid-induced brain damage
- Inhibition of ADAM10 ameliorates doxorubicin-induced cardiac remodeling by suppressing N-cadherin cleavage
- Invasive ductal carcinoma and small lymphocytic lymphoma/chronic lymphocytic leukemia manifesting as a collision breast tumor: A case report and literature review
- Clonal diversity of the B cell receptor repertoire in patients with coronary in-stent restenosis and type 2 diabetes
- CTLA-4 promotes lymphoma progression through tumor stem cell enrichment and immunosuppression
- WDR74 promotes proliferation and metastasis in colorectal cancer cells through regulating the Wnt/β-catenin signaling pathway
- Down-regulation of IGHG1 enhances Protoporphyrin IX accumulation and inhibits hemin biosynthesis in colorectal cancer by suppressing the MEK-FECH axis
- Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
- Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway
- lncRNA NEAT1 regulates CYP1A2 and influences steroid-induced necrosis
- A two-microRNA signature predicts the progression of male thyroid cancer
- Isolation of microglia from retinas of chronic ocular hypertensive rats
- Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study
- Calcineurin Aβ gene knockdown inhibits transient outward potassium current ion channel remodeling in hypertrophic ventricular myocyte
- Aberrant expression of PI3K/AKT signaling is involved in apoptosis resistance of hepatocellular carcinoma
- Clinical significance of activated Wnt/β-catenin signaling in apoptosis inhibition of oral cancer
- circ_CHFR regulates ox-LDL-mediated cell proliferation, apoptosis, and EndoMT by miR-15a-5p/EGFR axis in human brain microvessel endothelial cells
- Resveratrol pretreatment mitigates LPS-induced acute lung injury by regulating conventional dendritic cells’ maturation and function
- Ubiquitin-conjugating enzyme E2T promotes tumor stem cell characteristics and migration of cervical cancer cells by regulating the GRP78/FAK pathway
- Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
- Protective effect of Lactobacillus-containing probiotics on intestinal mucosa of rats experiencing traumatic hemorrhagic shock
- Glucocorticoids induce osteonecrosis of the femoral head through the Hippo signaling pathway
- Endothelial cell-derived SSAO can increase MLC20 phosphorylation in VSMCs
- Downregulation of STOX1 is a novel prognostic biomarker for glioma patients
- miR-378a-3p regulates glioma cell chemosensitivity to cisplatin through IGF1R
- The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats
- TGF-β1-overexpressing mesenchymal stem cells reciprocally regulate Th17/Treg cells by regulating the expression of IFN-γ
- The influence of MTHFR genetic polymorphisms on methotrexate therapy in pediatric acute lymphoblastic leukemia
- Red blood cell distribution width-standard deviation but not red blood cell distribution width-coefficient of variation as a potential index for the diagnosis of iron-deficiency anemia in mid-pregnancy women
- Small cell neuroendocrine carcinoma expressing alpha fetoprotein in the endometrium
- Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers
- Molecular characterization and phylogenetic studies of Echinococcus granulosus and Taenia multiceps coenurus cysts in slaughtered sheep in Saudi Arabia
- ITGB5 mutation discovered in a Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
- ACTB and GAPDH appear at multiple SDS-PAGE positions, thus not suitable as reference genes for determining protein loading in techniques like Western blotting
- Facilitation of mouse skin-derived precursor growth and yield by optimizing plating density
- 3,4-Dihydroxyphenylethanol ameliorates lipopolysaccharide-induced septic cardiac injury in a murine model
- Downregulation of PITX2 inhibits the proliferation and migration of liver cancer cells and induces cell apoptosis
- Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B
- Novel predictor of the occurrence of DKA in T1DM patients without infection: A combination of neutrophil/lymphocyte ratio and white blood cells
- Investigation of molecular regulation mechanism under the pathophysiology of subarachnoid hemorrhage
- miR-25-3p protects renal tubular epithelial cells from apoptosis induced by renal IRI by targeting DKK3
- Bioengineering and Biotechnology
- Green fabrication of Co and Co3O4 nanoparticles and their biomedical applications: A review
- Agriculture
- Effects of inorganic and organic selenium sources on the growth performance of broilers in China: A meta-analysis
- Crop-livestock integration practices, knowledge, and attitudes among smallholder farmers: Hedging against climate change-induced shocks in semi-arid Zimbabwe
- Food Science and Nutrition
- Effect of food processing on the antioxidant activity of flavones from Polygonatum odoratum (Mill.) Druce
- Vitamin D and iodine status was associated with the risk and complication of type 2 diabetes mellitus in China
- Diversity of microbiota in Slovak summer ewes’ cheese “Bryndza”
- Comparison between voltammetric detection methods for abalone-flavoring liquid
- Composition of low-molecular-weight glutenin subunits in common wheat (Triticum aestivum L.) and their effects on the rheological properties of dough
- Application of culture, PCR, and PacBio sequencing for determination of microbial composition of milk from subclinical mastitis dairy cows of smallholder farms
- Investigating microplastics and potentially toxic elements contamination in canned Tuna, Salmon, and Sardine fishes from Taif markets, KSA
- From bench to bar side: Evaluating the red wine storage lesion
- Establishment of an iodine model for prevention of iodine-excess-induced thyroid dysfunction in pregnant women
- Plant Sciences
- Characterization of GMPP from Dendrobium huoshanense yielding GDP-D-mannose
- Comparative analysis of the SPL gene family in five Rosaceae species: Fragaria vesca, Malus domestica, Prunus persica, Rubus occidentalis, and Pyrus pyrifolia
- Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR
- Investigation of bioactivities of Taxus chinensis, Taxus cuspidata, and Taxus × media by gas chromatography-mass spectrometry
- Morphological structures and histochemistry of roots and shoots in Myricaria laxiflora (Tamaricaceae)
- Transcriptome analysis of resistance mechanism to potato wart disease
- In silico analysis of glycosyltransferase 2 family genes in duckweed (Spirodela polyrhiza) and its role in salt stress tolerance
- Comparative study on growth traits and ions regulation of zoysiagrasses under varied salinity treatments
- Role of MS1 homolog Ntms1 gene of tobacco infertility
- Biological characteristics and fungicide sensitivity of Pyricularia variabilis
- In silico/computational analysis of mevalonate pyrophosphate decarboxylase gene families in Campanulids
- Identification of novel drought-responsive miRNA regulatory network of drought stress response in common vetch (Vicia sativa)
- How photoautotrophy, photomixotrophy, and ventilation affect the stomata and fluorescence emission of pistachios rootstock?
- Apoplastic histochemical features of plant root walls that may facilitate ion uptake and retention
- Ecology and Environmental Sciences
- The impact of sewage sludge on the fungal communities in the rhizosphere and roots of barley and on barley yield
- Domestication of wild animals may provide a springboard for rapid variation of coronavirus
- Response of benthic invertebrate assemblages to seasonal and habitat condition in the Wewe River, Ashanti region (Ghana)
- Molecular record for the first authentication of Isaria cicadae from Vietnam
- Twig biomass allocation of Betula platyphylla in different habitats in Wudalianchi Volcano, northeast China
- Animal Sciences
- Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens
- Predators of the giant pine scale, Marchalina hellenica (Gennadius 1883; Hemiptera: Marchalinidae), out of its natural range in Turkey
- Honey in wound healing: An updated review
- NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block
- Radiotherapy for the treatment of pulmonary hydatidosis in sheep
- Retraction
- Retraction of “Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating microRNA-34a-5p/NOTCH1 signaling pathway”
- Special Issue on Reuse of Agro-Industrial By-Products
- An effect of positional isomerism of benzoic acid derivatives on antibacterial activity against Escherichia coli
- Special Issue on Computing and Artificial Techniques for Life Science Applications - Part II
- Relationship of Gensini score with retinal vessel diameter and arteriovenous ratio in senile CHD
- Effects of different enantiomers of amlodipine on lipid profiles and vasomotor factors in atherosclerotic rabbits
- Establishment of the New Zealand white rabbit animal model of fatty keratopathy associated with corneal neovascularization
- lncRNA MALAT1/miR-143 axis is a potential biomarker for in-stent restenosis and is involved in the multiplication of vascular smooth muscle cells