Home Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
Article Open Access

Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus

  • Dongmei Jiang , Guilin Mo , Yilong Jiang and Bo Kang EMAIL logo
Published/Copyright: January 20, 2021
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 16 Issue 1

Abstract

Spermidine is important for the hypothalamic control of pituitary secretion of hormones involved in neuroendocrine functions in mammals. In this study, the effect of exogenous spermidine on the expression of genes and proteins related to polyamine metabolism and polyamine levels was examined. The results indicated that treatment with spermidine at 0.05 mg/g (BW) significantly increased the levels of Oaz1 mRNA and protein expression and decreased putrescine content in mouse hypothalamus (p < 0.05). The administration with spermidine at 0.10 mg/g significantly increased the levels of Oaz1, Oaz2, and Odc expression in mouse hypothalamus (p < 0.05). Treatment with spermidine at 0.05 mg/g significantly increased the levels of Ssat mRNA expression and reduced the level of Smo mRNA expression in mouse hypothalamus (p < 0.05). Putrescine concentrations in the hypothalamus after the administration of spermidine at 0.10 and 0.15 mg/g were significantly higher than those in the control group (p < 0.05). The concentration of both spermidine and spermine in the hypothalamus after the administration of spermidine at 0.15 mg/g was decreased significantly (p < 0.05). In summary, our results indicate that exogenous spermidine affects polyamine homeostasis in the mouse hypothalamus by modulating the expression of genes and proteins related to polyamine metabolism.

Keywords: spermidine; putrescine; spermine; polyamine metabolism; hypothalamus

1 Introduction

The polyamines spermidine, spermine, and their precursor putrescine are organic polycations present in all eukaryotes and perform various functions in different organisms [1]. The biosynthetic and catabolic pathways of polyamines in mammals are well-understood and have been described in multiple reviews [2]. Ornithine decarboxylase (ODC) catalyzes the decarboxylation of l-ornithine to produce putrescine. Putrescine is used as a substrate by constitutive spermidine synthase (SPDS), which transfers to putrescine an aminopropyl group donated by decarboxylated S-adenosylmethionine, which is generated by S-adenosylmethionine decarboxylase (SAMDC). Similarly, spermine synthase (SPMS) transfers an aminopropyl group to spermidine. Spermine oxidase (SMO) directly catalyzes the conversion of spermine to spermidine, and both spermidine/spermine N 1-acetyltransferase (SSAT) and acetylpolyamine oxidase (APAO) catalyze the conversion of spermine into spermidine and spermidine into putrescine [3,4].

In mammals, polyamines play important roles in protein and nucleic acid synthesis and stability, cell proliferation, differentiation, apoptosis, and oxidative stress [5]. In addition to serving as the biosynthetic precursor of spermine, spermidine-derived aminobutyl modification of eIF5A and subsequent hydroxylation results in the formation of a modified amino acid known as hypusine [6]. Hypusinated eIF5A is essential for the translation of mRNAs that encode proteins containing polyproline tracts [7,8]. Therefore, spermidine is an essential determinant of normal cellular translation in eukaryotes [9]. In rats, studies have shown that polyamine levels and ODC activity were higher during development and declined after growth was interrupted [10]. Thyssen and Libertun [11] reported that spermidine level was high during the first postnatal days in the rat hypothalamus, putrescine reached the highest concentration on postnatal day 6, and α-difluoromethylornithine (a specific and irreversible inhibitor of ODC) decreased putrescine and spermidine levels in the hypothalamus. These results indicate that spermidine is important for the hypothalamic control of the pituitary secretion of hormones involved in reproduction in mammals [10,12]. The results of our previous studies suggested that the enzyme ornithine decarboxylase antizyme (OAZ) played an important role in reproductive function mediated by the hypothalamic–pituitary–gonadal axis in female goose [13,14]. In the brain, spermidine and spermine are particularly abundant in neurons of the hypothalamus [15]. Recent studies suggested that spermidine supplementation extended the lifespan of mice and exerted cardioprotective effects by reducing cardiac hypertrophy and preserving diastolic function in old mice [16,17]. Changes in polyamine homeostasis in the hypothalamus are gaining importance in neuroendocrine and reproductive research; therefore, understanding the role of exogenous spermidine in the regulation of polyamine metabolism in the hypothalamus is essential. In this study, different doses of exogenous spermidine were administered to adult mice by intraperitoneal injection, and the expression levels of polyamine metabolism-related genes and proteins and polyamine contents were measured using quantitative real-time PCR (qRT-PCR), western blot, and high-performance liquid chromatography (HPLC). Our results demonstrated that spermidine affected polyamine metabolism in the mouse hypothalamus by modulating the expression of genes and proteins related to polyamine metabolism.

2 Materials and methods

2.1 Animals and sample collection

Thirty two female Kunming mice (6-week-old, 30 ± 3 g) were housed in eight polypropylene cages under an air-conditioned animal room (24 ± 2°C) at a relative humidity of 45 ± 5% with a 12h light–dark cycle. These animals were fed a laboratory diet and drinking water. Two cages of mice were assigned to one specific spermidine treatment, and each group was composed of four animals. The control group (n = 8) and three groups (n = 8, each) were treated with 0.9% sodium chloride and exogenous spermidine (Sigma-Aldrich, Shanghai, China) at 0.05, 0.10, and 0.15 mg/g (body weight), respectively. Spermidine was dissolved in 0.9% sodium chloride to a volume of 300 µL and then injected intraperitoneally. Animals were euthanized under general anesthesia (diethyl ether) 24 h after spermidine administration. Hypothalamus samples were bordered by the caudal edge of the mammillary bodies, the hypothalamic fissures, the rostral edge of the optic chiasm, and extended dorsally 1–2 mm.

  1. Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals and has been approved by the Animal Ethics Committee of the College of Animal Science and Technology, Sichuan Agricultural University (Chengdu, China).

2.2 Total RNA extraction and qRT-PCR

Total RNA was isolated from hypothalamic tissues using the RNAiso Plus kit (Takara, Dalian, China) according to the manufacturer’s instructions. Reverse transcription to obtain cDNA was performed using a PrimeScript™ RT reagent kit with a gDNA Eraser (Takara). Primers used were synthesized in BGI Company (Shenzhen, China) (Table 1). The qRT-PCR was carried out using the iQ SYBR Green Supermix kit (Bio-Rad Laboratories, CA, USA) in a 96-well iCycle CFX96 (Bio-Rad Laboratories). The reaction containing 5.0 µL of SYBR®Green Supermix, 4.1 µL of RNase-free water, 0.5 µL of cDNA, and 0.2 µL of each of the primers was performed as follows: 95°C for 3 min; 40 cycles of 95°C for 10 s; 58.0–62.2°C (according to Table 1) for 30 s; and 72°C for 30 s, followed by measuring the melting curves. The expression level of each gene was normalized by Gapdh expression level and expressed as arbitrary unit (AU). Relative quantization of gene expression was performed in three replicates for each sample.

Table 1

Primer sequences for mice used in the study

Gene Primer sequence (5′–3′) Amplicon size (bp) T m (°C)
Azin1 F: CTTTCCACGAACCATCTGCT 96 61.4
R: TTCCAGCATCTTGCATCTCA
Azin2 F: GCTTAGAGGGAGCCAAAGTG 104 62.2
R: CTCAGCAAGGATGTCCACAC
Oaz1 F: GAGTTCGCAGAGGAGCAACT 101 60.0
R: CCAAGAAAGCTGAAGGTTCG
Oaz2 F: AGTAAGTGTCCCCAGCTCCA 87 61.4
R: ATCTTCGACAGTGGGTGAGG
Odc F: TTGACTGCCACATCCTTG 199 58.0
R: GCTCTGCTATCGTTACACT
Samdc F: TCATGAAGCCTTCTCACCAAGGGT 155 59.0
R: TCGGCTCTCTGGGAAATCCAAAGT
Spds F: ACCAGCTCATGAAGACAGCACTCA 189 60.0
R: TGCTACACAGCATGAAGCCGATCT
Spms F: TTCGGGTGACTCAGTTCCTGCTAA 199 60.0
R: AACGGAGACCCTCCTTCAGCAAAT
Ssat F: TGCCGGTGTAGACAATGACAACCT 114 59.0
R: TAAAGCTTTGGAATGGGTGCTCGC
Apao F: AGTCTTCACATGTGCTCTGTGGGT 131 59.0
R: TGGCAATTGTGGGTTTCCTGTCAC
Smo F: TCTGCACAGAGATGCTTCGACAGT 129 59.0
R: TTGAGCCCACCTGTGTGTAGGAAT
Gapdh F: AACGACCCCTTCATTGAC 191 58.0
R: TCCACGACATACTCAGCAC

2.3 Western blot

Hypothalamus tissue was lysed in RIPA buffer and protein concentration was determined by BCA assay. Equal amount of proteins (approximately 30 µg) per sample were separated using 10% SDS-PAGE, transferred electrophoretically onto the polyvinylidene membrane (Bio-Rad), and blocked with 5% nonfat dry milk in Vertical Electrophoresis Systems (Bio-Rad). The primary antibodies used in this study were OAZ1 (A744, 1:1,000 dilution; ABclonal, Wuhan, China), SSAT (10708-1-AP, 1:500 dilution; Proteintech, Wuhan, China), and β-actin (A3854, 1:50,000 dilution; Sigma-Aldrich). The membrane was incubated with the primary antibody solution overnight at 4°C and then washed with the TBST. The corresponding secondary antibody (A028, 1:1,000 dilution; Beyotime, Shanghai, China) was added and incubated at room temperature for 2 h. The protein bands were visualized by using the BeyoECL Plus (a chemiluminescence reaction; Beyotime, China) in Gel Imaging Systems with an Image Lab software (Bio-Rad, USA). The bands were quantified using an ImageJ software (NIH, USA).

2.4 Measurement of polyamine contents

Polyamine contents were measured by HPLC using an Agilent 1100 Series system (Agilent Technologies, CA, USA) following a benzoylation procedure as described previously [18]. A 20 µL of benzoyl polyamines were separated on a 5 μm particle size C18, 4.6 × 250 mm column (Agilent Technologies). The proportion of mobile phase A (methyl alcohol) and B (water) was 62:38. The isocratic elution was performed as follows: 17 min, 62% mobile phase A. The temperature of the column was maintained at 25°C. The flow rate was at 1 mL/min. The polyamine peaks were detected with a fluorescence detector at 229 nm. Results were compared to the internal standard (1,6-hexanediamine, cat. no. 124-09-4; Sigma-Aldrich) and the standard curves for putrescine (cat. no. 51799), spermidine (cat. no. 49761), and spermine (cat. no. 55513) standards (Sigma-Aldrich).

2.5 Statistical analysis

Data are presented as mean ± standard error of mean (SEM). Statistical analysis was performed by one-way analysis of variance using the SAS 9.2 statistical software for Windows (SAS Institute Inc, NC, USA) followed by Duncan’s multiple range test. A p < 0.05 was considered to be statistically significant.

3 Results

3.1 Effect of spermidine on polyamine biosynthesis in the mouse hypothalamus

The effect of exogenous spermidine on polyamine biosynthesis was assessed by measuring the mRNA expression levels of genes ornithine decarboxylase antizyme inhibitor 1 (AZIN1), Azin2, Oaz1, Oaz2, Odc, Samdc, Spds, and Spms. The mRNA expression level of Oaz1 in the mouse hypothalamus after the administration of spermidine at 0.05 and 0.10 mg/g was 3.71- and 2.51-fold, respectively, compared to the control group (p < 0.05) (Figure 1). No significant difference in the Oaz1 expression level was found between mice treated with 0.15 mg/g spermidine and control mice (p > 0.05). Furthermore, the level of OAZ1 protein in the mouse hypothalamus after the administration of spermidine at 0.05 mg/g was 1.49-fold compared to the control group (p < 0.05), while the level of OAZ1 protein in mice treated with 0.10 and 0.15 mg/g spermidine was not significantly different compared to the control group (p > 0.05) (Figure 3). As the dosage of spermidine administration increased, the level of OAZ1 protein expression showed a decreasing trend, as much as the amount of Oaz1 mRNA expression (Figures 1 and 3). The mRNA expression levels of Oaz2 and Odc after the administration of spermidine at 0.10 mg/g were 1.36- and 1.51-fold, respectively, compared to the control group (p < 0.05) (Figure 1). There was no significant difference in the mRNA expression levels of Oaz2 and Odc by treatment with spermidine at 0.05 and 0.15 mg/g compared to control mice (p > 0.05) (Figure 1). Moreover, there was no significant difference in the mRNA expression levels of Azin1, Azin2, Samdc, Spds, and Spms in the hypothalamus of mice treated with spermidine compared to control mice (p > 0.05) (Figure 1).

Figure 1 Effect of spermidine on expression levels of genes related to polyamine biosynthesis in the mouse hypothalamus. Expression levels of genes related to polyamine biosynthesis were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and presented in AU. Values are mean ± SEM. Bars with different letter are significantly different between spermidine administration and control group (p < 0.05).
Figure 1

Effect of spermidine on expression levels of genes related to polyamine biosynthesis in the mouse hypothalamus. Expression levels of genes related to polyamine biosynthesis were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and presented in AU. Values are mean ± SEM. Bars with different letter are significantly different between spermidine administration and control group (p < 0.05).

3.2 Effect of spermidine on polyamine catabolism in the mouse hypothalamus

The mRNA expression level of Ssat in the hypothalamus after the administration of spermidine at 0.05 and 0.15 mg/g was 1.49- and 0.64-fold, respectively, compared to the control group (p < 0.05) (Figure 2). Furthermore, the level of SSAT protein in the hypothalamus after the administration of spermidine at 0.10 and 0.15 mg/g was 0.73- and 0.67-fold, respectively, compared to the control group (p < 0.05) (Figure 3). However, there was no significant difference in Apao expression level between the spermidine-treated and the control group (p > 0.05) (Figure 2). The mRNA expression level of Smo in the mouse hypothalamus after the administration of 0.05 mg/g spermidine was 0.42-fold compared to the control group (p < 0.05) (Figure 2).

Figure 2 Effect of spermidine on expression levels of genes related to polyamine catabolism in the mouse hypothalamus. Expression levels of genes related to polyamine catabolism were normalized to GAPDH and presented in AU. Values are mean ± SEM. Bars with different letter are significantly different between spermidine administration and control group (p < 0.05).
Figure 2

Effect of spermidine on expression levels of genes related to polyamine catabolism in the mouse hypothalamus. Expression levels of genes related to polyamine catabolism were normalized to GAPDH and presented in AU. Values are mean ± SEM. Bars with different letter are significantly different between spermidine administration and control group (p < 0.05).

Figure 3 Effect of spermidine on OAZ1 and SSAT protein expression in the mouse hypothalamus. Mice were treated with spermidine at 0.05, 0.10, and 0.15 mg/g (body weight) for 24 h. (a) The expression of OAZ1, SSAT, and β-actin proteins in the hypothalamus was determined by western blot. (b) The expression of OAZ1 and SSAT proteins was quantified by densitometry, and data were normalized to β-actin. Values are mean ± SEM. Bars with different letter are significantly different (p < 0.05).
Figure 3

Effect of spermidine on OAZ1 and SSAT protein expression in the mouse hypothalamus. Mice were treated with spermidine at 0.05, 0.10, and 0.15 mg/g (body weight) for 24 h. (a) The expression of OAZ1, SSAT, and β-actin proteins in the hypothalamus was determined by western blot. (b) The expression of OAZ1 and SSAT proteins was quantified by densitometry, and data were normalized to β-actin. Values are mean ± SEM. Bars with different letter are significantly different (p < 0.05).

3.3 Exogenous spermidine alters polyamine contents in the mouse hypothalamus

Putrescine contents in the hypothalamus were significantly lower in mice treated with 0.05 mg/g spermidine compared to the control group (p < 0.05). It was significantly higher in mice treated with 0.10 and 0.15 mg/g spermidine compared to control mice (p < 0.05) (Figure 4). Spermidine contents were significantly increased in the hypothalamus after the administration of 0.10 mg/g spermidine (p < 0.05), but were significantly decreased after the administration of 0.15 mg/g spermidine (p < 0.05). Spermine content was significantly decreased in the hypothalamus after the administration of 0.15 mg/g (p < 0.05).

Figure 4 Effect of spermidine on polyamine contents in the mouse hypothalamus. Values are mean ± SEM. Bars with different letter are significantly different between spermidine administration and control group (p < 0.05).
Figure 4

Effect of spermidine on polyamine contents in the mouse hypothalamus. Values are mean ± SEM. Bars with different letter are significantly different between spermidine administration and control group (p < 0.05).

4 Discussion

The intracellular accumulation of polyamines can induce apoptosis and lead to toxicity in various cell types [4]. Therefore, the maintenance of polyamine homeostasis is critical in different organisms [19,20]. OAZ binds to the ODC subunit, targets ODC to ubiquitin-independent degradation by the 26 S proteasome [21,22], and inhibits polyamine transport across the plasma membrane. In our study, Oaz1 mRNA expression after treatment with 0.05 and 0.10 mg/g spermidine and Oaz2 mRNA expression after treatment with 0.10 mg/g spermidine were significantly increased. The level of OAZ1 protein after the treatment of spermidine at 0.05 mg/g was upregulated significantly (p < 0.05), while putrescine content decreased. Polyamines promote Oaz expression via the stimulation of programmed +1 ribosomal frameshifting that combines two different open reading frames to produce a full-length functional protein [23]. Our results demonstrated that exogenous spermidine at 0.05 mg/g decreases putrescine content by upregulating the expression of Oaz1 mRNA and protein and that the expression of Oaz1 mRNA and protein was more susceptive to exogenous spermidine than Oaz2. Ray et al. observed that the intracellular spermidine levels were sensed by the ribosomal frameshifting mechanism controlling Oaz translation [24]. These results suggest that spermidine supplementation can regulate the expression of Oaz mRNA and protein expression in mouse hypothalamus. The level of Oaz1 mRNA expression after 0.10 mg/g spermidine treatment increased, whereas the amount of OAZ1 protein has no significant difference. That indicates that 0.10 mg/g spermidine did not promote Oaz1 translation by the ribosomal frameshifting mechanism, and in turn was incapable of downregulating putrescine content in mouse hypothalamus. However, the reason why the mRNA expression level of Oaz1 was not increased and putrescine content increased in mice treated with 0.15 mg/g has not been determined. Except for the increased level of Odc in the mouse hypothalamus after the administration of 0.10 mg/g spermidine, there was no significant difference in the mRNA expression levels of Azin1, Azin2, Odc, Samdc, Spds, and Spms between the spermidine-treated and control group. The levels of Spds and Spms are not rate limiting for polyamine biosynthesis in vivo and are unlikely to exert significant regulatory effects on cellular polyamine levels [25]. Our results indicate that exogenous spermidine primarily regulates the expression of Oaz1 and Oaz2, particularly Oaz1 mRNA and protein expression, which in turn affects polyamine pool in the mouse hypothalamus.

In this study, exogenous spermidine affected Ssat and Smo mRNA expression, but did not change the mRNA expression level of Apao in mouse hypothalamus. SSAT acetylates spermine and spermidine to form N 1-acetylspermine and N 1-acetylspermidine, respectively. The latter can be either exported from the cell or serve as substrates for APAO [26]. SSAT is strongly regulated and highly inducible by polyamines [27,28]. Our results indicate that exogenous spermidine affects significantly the level of Ssat mRNA expression and protein in the mouse hypothalamus in a dose-dependent manner in vivo and that the SSAT levels are regulated not only at the translation and protein levels but also at the transcription level [29,30]. In addition, no significant changes in Apao mRNA expression in the hypothalamus of mice treated with exogenous spermidine were observed. One possible explanation is that excess polyamines are excreted by transmembrane transporter.

The permeability of a substance through the blood–brain barrier depends on its lipid solubility and the presence of a specific carrier system. Polyamine transport is highly restricted by the blood–brain barrier but is not blocked [31]. In the present study, exogenous spermidine at 0.05 mg/g increased Oaz1 mRNA and protein expression and decreased putrescine levels, whereas spermidine at 0.10 and 0.15 mg/g increased putrescine levels in the mouse hypothalamus. It is possible that the increased levels of OAZ1 inhibit ODC activity and then reduce the anabolic activity of putrescine. However, exogenous spermidine at a dose of 0.10 mg/g increased Oaz1 mRNA expression and putrescine levels, whereas the level of OAZ1 protein showed no significant difference in the mouse hypothalamus. One possible explanation for this discrepancy is that spermidine supplementation also affects polyamine pool through the putrescine transport system in the mouse hypothalamus. In addition, the levels of both spermidine and spermine in the hypothalamus were decreased after treatment with 0.15 mg/g spermidine. It indicates that exogenous spermidine affects polyamine pool in the mouse hypothalamus and may penetrate the blood–brain barrier via an undetermined pathway. A suitable experimental design needs to be established to elucidate this pathway. Polyamines are classified in the following order for their ability to enter leukemic cells and the toxicity level: spermine > spermidine > putrescine [32]. In the present study, we have shown that spermidine and spermine levels were decreased significantly after the administration of 0.15 mg/g spermidine. It can be hypothesized that the higher dose of spermidine enhanced the activity of the polyamine transport system to alleviate the toxicity of excess polyamines and thus promoted polyamine efflux. Further research is needed to elucidate this hypothesis.

In summary, our results indicated that exogenous spermidine affected polyamine homeostasis in the mouse hypothalamus by modulating the expression of genes and proteins related to polyamine metabolism. The regulation of the mechanism of polyamine transport by exogenous spermidine in the hypothalamus needs to be elucidated because of the importance of polyamines in growth and development.

These authors contributed equally to this work.

Funding

This work was supported by the National Natural Science Foundation of China (31872358 and 31702116) and the Scientific Research Fund of Sichuan Provincial Education Department (18ZB0469).

  1. Author contributions: D.J. and G.M. contributed equally to this work. D.J., G.M., and Y.J. performed the experiments. B.K. designed the experiments. D.J. and G.M. analyzed the data. D.J. wrote the paper. B.K. revised and edited the manuscript.

  2. Conflict of interest: The authors state no conflict of interest.

  3. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] van Veen S, Martin S, Van den Haute C, Benoy V, Lyons J, Vanhoutte R, et al. ATP13A2 deficiency disrupts lysosomal polyamine export. Nature. 2020;578(7795):419–24.10.1038/s41586-020-1968-7Search in Google Scholar PubMed

[2] Battaglia V, DeStefano Shields C, Murray-Stewart T, Casero RA Jr. Polyamine catabolism in carcinogenesis: Potential targets for chemotherapy and chemoprevention. Amino Acids. 2014;46(3):511–9.10.1007/s00726-013-1529-6Search in Google Scholar PubMed PubMed Central

[3] Affronti HC, Rowsam AM, Pellerite AJ, Rosario SR, Long MD, Jacobi JJ, et al. Pharmacological polyamine catabolism upregulation with methionine salvage pathway inhibition as an effective prostate cancer therapy. Nat Commun. 2020;11(1):52.10.1038/s41467-019-13950-4Search in Google Scholar PubMed PubMed Central

[4] Liu J, Wang T, Lin Y, Ho W, Tsai H, Chen S, et al. Acrolein is involved in ischemic stroke-induced neurotoxicity through spermidine/spermine-N1-acetyltransferase activation. Exp Neurol. 2020;323:113066.10.1016/j.expneurol.2019.113066Search in Google Scholar PubMed

[5] Eisenberg T, Knauer H, Schauer A, Buttner S, Ruckenstuhl C, Carmona-Gutierrez D, et al. Induction of autophagy by spermidine promotes longevity. Nat Cell Biol. 2009;11(11):1305–14.10.1038/ncb1975Search in Google Scholar PubMed

[6] Frohnhofer HG, Geiger-Rudolph S, Pattky M, Meixner M, Huhn C, Maischein HM, et al. Spermidine, but not spermine, is essential for pigment pattern formation in zebrafish. Biol Open. 2016;5(6):736–44.10.1242/bio.018721Search in Google Scholar PubMed PubMed Central

[7] Gutierrez E, Shin BS, Woolstenhulme CJ, Kim JR, Saini P, Buskirk AR, et al. eIF5A promotes translation of polyproline motifs. Mol Cell. 2013;51(1):35–45.10.1016/j.molcel.2013.04.021Search in Google Scholar PubMed PubMed Central

[8] Nakanishi S, Cleveland JL. Targeting the polyamine-hypusine circuit for the prevention and treatment of cancer. Amino Acids. 2016;48(10):2353–62.10.1007/s00726-016-2275-3Search in Google Scholar PubMed PubMed Central

[9] Kim SH, Wang Y, Khomutov M, Khomutov A, Fuqua C, Michael AJ. The essential role of spermidine in growth of agrobacterium tumefaciens is determined by the 1,3-diaminopropane moiety. ACS Chem Biol. 2016;11(2):491–9.10.1021/acschembio.5b00893Search in Google Scholar PubMed PubMed Central

[10] Thyssen SM, Hockl PF, Chamson A, Lux-Lantos VA, Libertun C. Effects of polyamines on the release of gonadotropin-releasing hormone and gonadotropins in developing female rats. Exp Biol Med. 2002;227(4):276–81.10.1177/153537020222700408Search in Google Scholar PubMed

[11] Thyssen SM, Libertun C. Quantitation of polyamines in hypothalamus and pituitary of female and male developing rats. Neurosci Lett. 2002;323(1):65–9.10.1016/S0304-3940(02)00097-6Search in Google Scholar

[12] Laube G, Bernstein HG, Wolf G, Veh RW. Differential distribution of spermidine/spermine-like immunoreactivity in neurons of the adult rat brain. J Comp Neurol. 2002;444(4):369–86.10.1002/cne.10157Search in Google Scholar PubMed

[13] Ma R, Kang B, Jiang D, He H. Expressions of OAZ1 and OAZ2 genes in HPG axis of goose at pre-laying and laying stages. J Northwest A&F Univ (Nat Sci Ed). 2015;43(2):44–8.Search in Google Scholar

[14] Kang B, Jiang D, He H, Ma R, Chen Z, Yi Z. Effect of Oaz1 overexpression on goose ovarian granulosa cells. Amino Acids. 2017;49(6):1123–32.10.1007/s00726-017-2411-8Search in Google Scholar PubMed

[15] Greenwood MP, Greenwood M, Paton JF, Murphy D. Control of polyamine biosynthesis by antizyme inhibitor 1 is important for transcriptional regulation of arginine vasopressin in the male rat hypothalamus. Endocrinology. 2015;156(8):2905–17.10.1210/en.2015-1074Search in Google Scholar PubMed PubMed Central

[16] Minois N. Molecular basis of the ‘anti-aging’ effect of spermidine and other natural polyamines – a mini-review. Gerontology. 2014;60(4):319–26.10.1159/000356748Search in Google Scholar PubMed

[17] Eisenberg T, Abdellatif M, Schroeder S, Primessnig U, Stekovic S, Pendl T, et al. Cardioprotection and lifespan extension by the natural polyamine spermidine. Nat Med. 2016;22(12):1428–38.10.1038/nm.4222Search in Google Scholar PubMed PubMed Central

[18] Kang B, Jiang D, Ma R, He H, Yi Z, Chen Z. OAZ1 knockdown enhances viability and inhibits ER and LHR transcriptions of granulosa cells in geese. PLoS One. 2017;12(3):e0175016.10.1371/journal.pone.0175016Search in Google Scholar PubMed PubMed Central

[19] Pegg AE. Toxicity of polyamines and their metabolic products. Chem Res Toxicol. 2013;26(12):1782–800.10.1021/tx400316sSearch in Google Scholar PubMed

[20] Michail K, Aljuhani N, Siraki AG. The interaction of diamines and polyamines with the peroxidase-catalyzed metabolism of aromatic amines: a potential mechanism for the modulation of aniline toxicity. Can J Physiol Pharmacol. 2013;91(3):228–35.10.1139/cjpp-2012-0253Search in Google Scholar PubMed

[21] Wang X, Jiang L. Effects of ornithine decarboxylase antizyme 1 on the proliferation and differentiation of human oral cancer cells. Int J Mol Med. 2014;34(6):1606–12.10.3892/ijmm.2014.1961Search in Google Scholar PubMed

[22] Kahana C. Antizyme and antizyme inhibitor, a regulatory tango. Cell Mol Life Sci. 2009;66(15):2479–88.10.1007/s00018-009-0033-3Search in Google Scholar PubMed

[23] Bercovich Z, Snapir Z, Keren-Paz A, Kahana C. Antizyme affects cell proliferation and viability solely through regulating cellular polyamines. J Biol Chem. 2011;286(39):33778–83.10.1074/jbc.M111.270637Search in Google Scholar PubMed PubMed Central

[24] Ray RM, Bhattacharya S, Bavaria MN, Viar MJ, Johnson LR. Spermidine, a sensor for antizyme 1 expression regulates intracellular polyamine homeostasis. Amino Acids. 2014;46(8):2005–13.10.1007/s00726-014-1757-4Search in Google Scholar PubMed PubMed Central

[25] Shi C, Welsh PA, Sass-Kuhn S, Wang X, McCloskey DE, Pegg AE, et al. Characterization of transgenic mice with overexpression of spermidine synthase. Amino Acids. 2012;42(2–3):495–505.10.1007/s00726-011-1028-6Search in Google Scholar PubMed PubMed Central

[26] Nowotarski SL, Woster PM, Casero, Jr RA. Polyamines and cancer: implications for chemotherapy and chemoprevention. Expert Rev Mol Med. 2013;15:e3.10.1017/erm.2013.3Search in Google Scholar PubMed PubMed Central

[27] Pegg AE. Spermidine/spermine-N(1)-acetyltransferase: a key metabolic regulator. Am J Physiol Endocrinol Metab. 2008;294(6):E995–1010.10.1152/ajpendo.90217.2008Search in Google Scholar PubMed

[28] Xiao Y, Li C, Wang H, Liu Y. LINC00265 targets miR-382-5p to regulate SAT1, VAV3 and angiogenesis in osteosarcoma. Aging. 2020. 12(20):20212–25.10.18632/aging.103762Search in Google Scholar PubMed PubMed Central

[29] Hyvonen MT, Uimari A, Vepsalainen J, Khomutov AR, Keinanen TA, Alhonen L. Tissue-specific alternative splicing of spermidine/spermine N1-acetyltransferase. Amino Acids. 2012;42(2–3):485–93.10.1007/s00726-011-1027-7Search in Google Scholar PubMed

[30] Perez-Leal O, Barrero CA, Clarkson AB, Casero Jr. RA, Merali S. Polyamine-regulated translation of spermidine/spermine-N1-acetyltransferase. Mol Cell Biol. 2012;32(8):1453–67.10.1128/MCB.06444-11Search in Google Scholar PubMed PubMed Central

[31] Shin WW, Fong WF, Pang SF, Wong PC. Limited blood–brain barrier transport of polyamines. J Neurochem. 1985;44(4):1056–9.10.1111/j.1471-4159.1985.tb08724.xSearch in Google Scholar PubMed

[32] Turecki G. Polyamines and suicide risk. Mol Psychiatr. 2013;18(12):1242–3.10.1038/mp.2013.153Search in Google Scholar PubMed PubMed Central

Received: 2020-03-10
Revised: 2020-10-06
Accepted: 2020-11-23
Published Online: 2021-01-20

© 2021 Dongmei Jiang et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Research progress on the mechanism of orexin in pain regulation in different brain regions
  3. Adriamycin-resistant cells are significantly less fit than adriamycin-sensitive cells in cervical cancer
  4. Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
  5. Iris metastasis of diffuse large B-cell lymphoma misdiagnosed as primary angle-closure glaucoma: A case report and review of the literature
  6. LncRNA PVT1 promotes cervical cancer progression by sponging miR-503 to upregulate ARL2 expression
  7. Two new inflammatory markers related to the CURB-65 score for disease severity in patients with community-acquired pneumonia: The hypersensitive C-reactive protein to albumin ratio and fibrinogen to albumin ratio
  8. Circ_0091579 enhances the malignancy of hepatocellular carcinoma via miR-1287/PDK2 axis
  9. Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-κB signaling pathway
  10. Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats
  11. ABCB1 polymorphism in clopidogrel-treated Montenegrin patients
  12. Metabolic profiling of fatty acids in Tripterygium wilfordii multiglucoside- and triptolide-induced liver-injured rats
  13. miR-338-3p inhibits cell growth, invasion, and EMT process in neuroblastoma through targeting MMP-2
  14. Verification of neuroprotective effects of alpha-lipoic acid on chronic neuropathic pain in a chronic constriction injury rat model
  15. Circ_WWC3 overexpression decelerates the progression of osteosarcoma by regulating miR-421/PDE7B axis
  16. Knockdown of TUG1 rescues cardiomyocyte hypertrophy through targeting the miR-497/MEF2C axis
  17. MiR-146b-3p protects against AR42J cell injury in cerulein-induced acute pancreatitis model through targeting Anxa2
  18. miR-299-3p suppresses cell progression and induces apoptosis by downregulating PAX3 in gastric cancer
  19. Diabetes and COVID-19
  20. Discovery of novel potential KIT inhibitors for the treatment of gastrointestinal stromal tumor
  21. TEAD4 is a novel independent predictor of prognosis in LGG patients with IDH mutation
  22. circTLK1 facilitates the proliferation and metastasis of renal cell carcinoma by regulating miR-495-3p/CBL axis
  23. microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury
  24. Long noncoding RNA TUG1 regulates degradation of chondrocyte extracellular matrix via miR-320c/MMP-13 axis in osteoarthritis
  25. Duodenal adenocarcinoma with skin metastasis as initial manifestation: A case report
  26. Effects of Loofah cylindrica extract on learning and memory ability, brain tissue morphology, and immune function of aging mice
  27. Recombinant Bacteroides fragilis enterotoxin-1 (rBFT-1) promotes proliferation of colorectal cancer via CCL3-related molecular pathways
  28. Blocking circ_UBR4 suppressed proliferation, migration, and cell cycle progression of human vascular smooth muscle cells in atherosclerosis
  29. Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
  30. Downregulation of circ_0037655 impedes glioma formation and metastasis via the regulation of miR-1229-3p/ITGB8 axis
  31. Vitamin D deficiency and cardiovascular risk in type 2 diabetes population
  32. Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis
  33. Mechanisms of circular RNA circ_0066147 on pancreatic cancer progression
  34. lncRNA myocardial infarction-associated transcript (MIAT) knockdown alleviates LPS-induced chondrocytes inflammatory injury via regulating miR-488-3p/sex determining region Y-related HMG-box 11 (SOX11) axis
  35. Identification of circRNA circ-CSPP1 as a potent driver of colorectal cancer by directly targeting the miR-431/LASP1 axis
  36. Hyperhomocysteinemia exacerbates ischemia-reperfusion injury-induced acute kidney injury by mediating oxidative stress, DNA damage, JNK pathway, and apoptosis
  37. Potential prognostic markers and significant lncRNA–mRNA co-expression pairs in laryngeal squamous cell carcinoma
  38. Gamma irradiation-mediated inactivation of enveloped viruses with conservation of genome integrity: Potential application for SARS-CoV-2 inactivated vaccine development
  39. ADHFE1 is a correlative factor of patient survival in cancer
  40. The association of transcription factor Prox1 with the proliferation, migration, and invasion of lung cancer
  41. Is there a relationship between the prevalence of autoimmune thyroid disease and diabetic kidney disease?
  42. Immunoregulatory function of Dictyophora echinovolvata spore polysaccharides in immunocompromised mice induced by cyclophosphamide
  43. T cell epitopes of SARS-CoV-2 spike protein and conserved surface protein of Plasmodium malariae share sequence homology
  44. Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
  45. Long noncoding RNA HULC contributes to paclitaxel resistance in ovarian cancer via miR-137/ITGB8 axis
  46. Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
  47. Prognostic value of the neutrophil-to-lymphocyte ratio in acute organophosphorus pesticide poisoning
  48. Gastroprotective effects of diosgenin against HCl/ethanol-induced gastric mucosal injury through suppression of NF-κβ and myeloperoxidase activities
  49. Silencing of LINC00707 suppresses cell proliferation, migration, and invasion of osteosarcoma cells by modulating miR-338-3p/AHSA1 axis
  50. Successful extracorporeal membrane oxygenation resuscitation of patient with cardiogenic shock induced by phaeochromocytoma crisis mimicking hyperthyroidism: A case report
  51. Effects of miR-185-5p on replication of hepatitis C virus
  52. Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis
  53. Primary localized cutaneous nodular amyloidosis presenting as lymphatic malformation: A case report
  54. Multimodal magnetic resonance imaging analysis in the characteristics of Wilson’s disease: A case report and literature review
  55. Therapeutic potential of anticoagulant therapy in association with cytokine storm inhibition in severe cases of COVID-19: A case report
  56. Neoadjuvant immunotherapy combined with chemotherapy for locally advanced squamous cell lung carcinoma: A case report and literature review
  57. Rufinamide (RUF) suppresses inflammation and maintains the integrity of the blood–brain barrier during kainic acid-induced brain damage
  58. Inhibition of ADAM10 ameliorates doxorubicin-induced cardiac remodeling by suppressing N-cadherin cleavage
  59. Invasive ductal carcinoma and small lymphocytic lymphoma/chronic lymphocytic leukemia manifesting as a collision breast tumor: A case report and literature review
  60. Clonal diversity of the B cell receptor repertoire in patients with coronary in-stent restenosis and type 2 diabetes
  61. CTLA-4 promotes lymphoma progression through tumor stem cell enrichment and immunosuppression
  62. WDR74 promotes proliferation and metastasis in colorectal cancer cells through regulating the Wnt/β-catenin signaling pathway
  63. Down-regulation of IGHG1 enhances Protoporphyrin IX accumulation and inhibits hemin biosynthesis in colorectal cancer by suppressing the MEK-FECH axis
  64. Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
  65. Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway
  66. lncRNA NEAT1 regulates CYP1A2 and influences steroid-induced necrosis
  67. A two-microRNA signature predicts the progression of male thyroid cancer
  68. Isolation of microglia from retinas of chronic ocular hypertensive rats
  69. Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study
  70. Calcineurin Aβ gene knockdown inhibits transient outward potassium current ion channel remodeling in hypertrophic ventricular myocyte
  71. Aberrant expression of PI3K/AKT signaling is involved in apoptosis resistance of hepatocellular carcinoma
  72. Clinical significance of activated Wnt/β-catenin signaling in apoptosis inhibition of oral cancer
  73. circ_CHFR regulates ox-LDL-mediated cell proliferation, apoptosis, and EndoMT by miR-15a-5p/EGFR axis in human brain microvessel endothelial cells
  74. Resveratrol pretreatment mitigates LPS-induced acute lung injury by regulating conventional dendritic cells’ maturation and function
  75. Ubiquitin-conjugating enzyme E2T promotes tumor stem cell characteristics and migration of cervical cancer cells by regulating the GRP78/FAK pathway
  76. Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
  77. Protective effect of Lactobacillus-containing probiotics on intestinal mucosa of rats experiencing traumatic hemorrhagic shock
  78. Glucocorticoids induce osteonecrosis of the femoral head through the Hippo signaling pathway
  79. Endothelial cell-derived SSAO can increase MLC20 phosphorylation in VSMCs
  80. Downregulation of STOX1 is a novel prognostic biomarker for glioma patients
  81. miR-378a-3p regulates glioma cell chemosensitivity to cisplatin through IGF1R
  82. The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats
  83. TGF-β1-overexpressing mesenchymal stem cells reciprocally regulate Th17/Treg cells by regulating the expression of IFN-γ
  84. The influence of MTHFR genetic polymorphisms on methotrexate therapy in pediatric acute lymphoblastic leukemia
  85. Red blood cell distribution width-standard deviation but not red blood cell distribution width-coefficient of variation as a potential index for the diagnosis of iron-deficiency anemia in mid-pregnancy women
  86. Small cell neuroendocrine carcinoma expressing alpha fetoprotein in the endometrium
  87. Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers
  88. Molecular characterization and phylogenetic studies of Echinococcus granulosus and Taenia multiceps coenurus cysts in slaughtered sheep in Saudi Arabia
  89. ITGB5 mutation discovered in a Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
  90. ACTB and GAPDH appear at multiple SDS-PAGE positions, thus not suitable as reference genes for determining protein loading in techniques like Western blotting
  91. Facilitation of mouse skin-derived precursor growth and yield by optimizing plating density
  92. 3,4-Dihydroxyphenylethanol ameliorates lipopolysaccharide-induced septic cardiac injury in a murine model
  93. Downregulation of PITX2 inhibits the proliferation and migration of liver cancer cells and induces cell apoptosis
  94. Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B
  95. Novel predictor of the occurrence of DKA in T1DM patients without infection: A combination of neutrophil/lymphocyte ratio and white blood cells
  96. Investigation of molecular regulation mechanism under the pathophysiology of subarachnoid hemorrhage
  97. miR-25-3p protects renal tubular epithelial cells from apoptosis induced by renal IRI by targeting DKK3
  98. Bioengineering and Biotechnology
  99. Green fabrication of Co and Co3O4 nanoparticles and their biomedical applications: A review
  100. Agriculture
  101. Effects of inorganic and organic selenium sources on the growth performance of broilers in China: A meta-analysis
  102. Crop-livestock integration practices, knowledge, and attitudes among smallholder farmers: Hedging against climate change-induced shocks in semi-arid Zimbabwe
  103. Food Science and Nutrition
  104. Effect of food processing on the antioxidant activity of flavones from Polygonatum odoratum (Mill.) Druce
  105. Vitamin D and iodine status was associated with the risk and complication of type 2 diabetes mellitus in China
  106. Diversity of microbiota in Slovak summer ewes’ cheese “Bryndza”
  107. Comparison between voltammetric detection methods for abalone-flavoring liquid
  108. Composition of low-molecular-weight glutenin subunits in common wheat (Triticum aestivum L.) and their effects on the rheological properties of dough
  109. Application of culture, PCR, and PacBio sequencing for determination of microbial composition of milk from subclinical mastitis dairy cows of smallholder farms
  110. Investigating microplastics and potentially toxic elements contamination in canned Tuna, Salmon, and Sardine fishes from Taif markets, KSA
  111. From bench to bar side: Evaluating the red wine storage lesion
  112. Establishment of an iodine model for prevention of iodine-excess-induced thyroid dysfunction in pregnant women
  113. Plant Sciences
  114. Characterization of GMPP from Dendrobium huoshanense yielding GDP-D-mannose
  115. Comparative analysis of the SPL gene family in five Rosaceae species: Fragaria vesca, Malus domestica, Prunus persica, Rubus occidentalis, and Pyrus pyrifolia
  116. Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR
  117. Investigation of bioactivities of Taxus chinensis, Taxus cuspidata, and Taxus × media by gas chromatography-mass spectrometry
  118. Morphological structures and histochemistry of roots and shoots in Myricaria laxiflora (Tamaricaceae)
  119. Transcriptome analysis of resistance mechanism to potato wart disease
  120. In silico analysis of glycosyltransferase 2 family genes in duckweed (Spirodela polyrhiza) and its role in salt stress tolerance
  121. Comparative study on growth traits and ions regulation of zoysiagrasses under varied salinity treatments
  122. Role of MS1 homolog Ntms1 gene of tobacco infertility
  123. Biological characteristics and fungicide sensitivity of Pyricularia variabilis
  124. In silico/computational analysis of mevalonate pyrophosphate decarboxylase gene families in Campanulids
  125. Identification of novel drought-responsive miRNA regulatory network of drought stress response in common vetch (Vicia sativa)
  126. How photoautotrophy, photomixotrophy, and ventilation affect the stomata and fluorescence emission of pistachios rootstock?
  127. Apoplastic histochemical features of plant root walls that may facilitate ion uptake and retention
  128. Ecology and Environmental Sciences
  129. The impact of sewage sludge on the fungal communities in the rhizosphere and roots of barley and on barley yield
  130. Domestication of wild animals may provide a springboard for rapid variation of coronavirus
  131. Response of benthic invertebrate assemblages to seasonal and habitat condition in the Wewe River, Ashanti region (Ghana)
  132. Molecular record for the first authentication of Isaria cicadae from Vietnam
  133. Twig biomass allocation of Betula platyphylla in different habitats in Wudalianchi Volcano, northeast China
  134. Animal Sciences
  135. Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens
  136. Predators of the giant pine scale, Marchalina hellenica (Gennadius 1883; Hemiptera: Marchalinidae), out of its natural range in Turkey
  137. Honey in wound healing: An updated review
  138. NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block
  139. Radiotherapy for the treatment of pulmonary hydatidosis in sheep
  140. Retraction
  141. Retraction of “Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating microRNA-34a-5p/NOTCH1 signaling pathway”
  142. Special Issue on Reuse of Agro-Industrial By-Products
  143. An effect of positional isomerism of benzoic acid derivatives on antibacterial activity against Escherichia coli
  144. Special Issue on Computing and Artificial Techniques for Life Science Applications - Part II
  145. Relationship of Gensini score with retinal vessel diameter and arteriovenous ratio in senile CHD
  146. Effects of different enantiomers of amlodipine on lipid profiles and vasomotor factors in atherosclerotic rabbits
  147. Establishment of the New Zealand white rabbit animal model of fatty keratopathy associated with corneal neovascularization
  148. lncRNA MALAT1/miR-143 axis is a potential biomarker for in-stent restenosis and is involved in the multiplication of vascular smooth muscle cells
https://doi.org/10.1515/biol-2021-0006
Keywords for this article
spermidine; putrescine; spermine; polyamine metabolism; hypothalamus
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Research progress on the mechanism of orexin in pain regulation in different brain regions
  3. Adriamycin-resistant cells are significantly less fit than adriamycin-sensitive cells in cervical cancer
  4. Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
  5. Iris metastasis of diffuse large B-cell lymphoma misdiagnosed as primary angle-closure glaucoma: A case report and review of the literature
  6. LncRNA PVT1 promotes cervical cancer progression by sponging miR-503 to upregulate ARL2 expression
  7. Two new inflammatory markers related to the CURB-65 score for disease severity in patients with community-acquired pneumonia: The hypersensitive C-reactive protein to albumin ratio and fibrinogen to albumin ratio
  8. Circ_0091579 enhances the malignancy of hepatocellular carcinoma via miR-1287/PDK2 axis
  9. Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-κB signaling pathway
  10. Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats
  11. ABCB1 polymorphism in clopidogrel-treated Montenegrin patients
  12. Metabolic profiling of fatty acids in Tripterygium wilfordii multiglucoside- and triptolide-induced liver-injured rats
  13. miR-338-3p inhibits cell growth, invasion, and EMT process in neuroblastoma through targeting MMP-2
  14. Verification of neuroprotective effects of alpha-lipoic acid on chronic neuropathic pain in a chronic constriction injury rat model
  15. Circ_WWC3 overexpression decelerates the progression of osteosarcoma by regulating miR-421/PDE7B axis
  16. Knockdown of TUG1 rescues cardiomyocyte hypertrophy through targeting the miR-497/MEF2C axis
  17. MiR-146b-3p protects against AR42J cell injury in cerulein-induced acute pancreatitis model through targeting Anxa2
  18. miR-299-3p suppresses cell progression and induces apoptosis by downregulating PAX3 in gastric cancer
  19. Diabetes and COVID-19
  20. Discovery of novel potential KIT inhibitors for the treatment of gastrointestinal stromal tumor
  21. TEAD4 is a novel independent predictor of prognosis in LGG patients with IDH mutation
  22. circTLK1 facilitates the proliferation and metastasis of renal cell carcinoma by regulating miR-495-3p/CBL axis
  23. microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury
  24. Long noncoding RNA TUG1 regulates degradation of chondrocyte extracellular matrix via miR-320c/MMP-13 axis in osteoarthritis
  25. Duodenal adenocarcinoma with skin metastasis as initial manifestation: A case report
  26. Effects of Loofah cylindrica extract on learning and memory ability, brain tissue morphology, and immune function of aging mice
  27. Recombinant Bacteroides fragilis enterotoxin-1 (rBFT-1) promotes proliferation of colorectal cancer via CCL3-related molecular pathways
  28. Blocking circ_UBR4 suppressed proliferation, migration, and cell cycle progression of human vascular smooth muscle cells in atherosclerosis
  29. Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
  30. Downregulation of circ_0037655 impedes glioma formation and metastasis via the regulation of miR-1229-3p/ITGB8 axis
  31. Vitamin D deficiency and cardiovascular risk in type 2 diabetes population
  32. Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis
  33. Mechanisms of circular RNA circ_0066147 on pancreatic cancer progression
  34. lncRNA myocardial infarction-associated transcript (MIAT) knockdown alleviates LPS-induced chondrocytes inflammatory injury via regulating miR-488-3p/sex determining region Y-related HMG-box 11 (SOX11) axis
  35. Identification of circRNA circ-CSPP1 as a potent driver of colorectal cancer by directly targeting the miR-431/LASP1 axis
  36. Hyperhomocysteinemia exacerbates ischemia-reperfusion injury-induced acute kidney injury by mediating oxidative stress, DNA damage, JNK pathway, and apoptosis
  37. Potential prognostic markers and significant lncRNA–mRNA co-expression pairs in laryngeal squamous cell carcinoma
  38. Gamma irradiation-mediated inactivation of enveloped viruses with conservation of genome integrity: Potential application for SARS-CoV-2 inactivated vaccine development
  39. ADHFE1 is a correlative factor of patient survival in cancer
  40. The association of transcription factor Prox1 with the proliferation, migration, and invasion of lung cancer
  41. Is there a relationship between the prevalence of autoimmune thyroid disease and diabetic kidney disease?
  42. Immunoregulatory function of Dictyophora echinovolvata spore polysaccharides in immunocompromised mice induced by cyclophosphamide
  43. T cell epitopes of SARS-CoV-2 spike protein and conserved surface protein of Plasmodium malariae share sequence homology
  44. Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
  45. Long noncoding RNA HULC contributes to paclitaxel resistance in ovarian cancer via miR-137/ITGB8 axis
  46. Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
  47. Prognostic value of the neutrophil-to-lymphocyte ratio in acute organophosphorus pesticide poisoning
  48. Gastroprotective effects of diosgenin against HCl/ethanol-induced gastric mucosal injury through suppression of NF-κβ and myeloperoxidase activities
  49. Silencing of LINC00707 suppresses cell proliferation, migration, and invasion of osteosarcoma cells by modulating miR-338-3p/AHSA1 axis
  50. Successful extracorporeal membrane oxygenation resuscitation of patient with cardiogenic shock induced by phaeochromocytoma crisis mimicking hyperthyroidism: A case report
  51. Effects of miR-185-5p on replication of hepatitis C virus
  52. Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis
  53. Primary localized cutaneous nodular amyloidosis presenting as lymphatic malformation: A case report
  54. Multimodal magnetic resonance imaging analysis in the characteristics of Wilson’s disease: A case report and literature review
  55. Therapeutic potential of anticoagulant therapy in association with cytokine storm inhibition in severe cases of COVID-19: A case report
  56. Neoadjuvant immunotherapy combined with chemotherapy for locally advanced squamous cell lung carcinoma: A case report and literature review
  57. Rufinamide (RUF) suppresses inflammation and maintains the integrity of the blood–brain barrier during kainic acid-induced brain damage
  58. Inhibition of ADAM10 ameliorates doxorubicin-induced cardiac remodeling by suppressing N-cadherin cleavage
  59. Invasive ductal carcinoma and small lymphocytic lymphoma/chronic lymphocytic leukemia manifesting as a collision breast tumor: A case report and literature review
  60. Clonal diversity of the B cell receptor repertoire in patients with coronary in-stent restenosis and type 2 diabetes
  61. CTLA-4 promotes lymphoma progression through tumor stem cell enrichment and immunosuppression
  62. WDR74 promotes proliferation and metastasis in colorectal cancer cells through regulating the Wnt/β-catenin signaling pathway
  63. Down-regulation of IGHG1 enhances Protoporphyrin IX accumulation and inhibits hemin biosynthesis in colorectal cancer by suppressing the MEK-FECH axis
  64. Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
  65. Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway
  66. lncRNA NEAT1 regulates CYP1A2 and influences steroid-induced necrosis
  67. A two-microRNA signature predicts the progression of male thyroid cancer
  68. Isolation of microglia from retinas of chronic ocular hypertensive rats
  69. Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study
  70. Calcineurin Aβ gene knockdown inhibits transient outward potassium current ion channel remodeling in hypertrophic ventricular myocyte
  71. Aberrant expression of PI3K/AKT signaling is involved in apoptosis resistance of hepatocellular carcinoma
  72. Clinical significance of activated Wnt/β-catenin signaling in apoptosis inhibition of oral cancer
  73. circ_CHFR regulates ox-LDL-mediated cell proliferation, apoptosis, and EndoMT by miR-15a-5p/EGFR axis in human brain microvessel endothelial cells
  74. Resveratrol pretreatment mitigates LPS-induced acute lung injury by regulating conventional dendritic cells’ maturation and function
  75. Ubiquitin-conjugating enzyme E2T promotes tumor stem cell characteristics and migration of cervical cancer cells by regulating the GRP78/FAK pathway
  76. Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
  77. Protective effect of Lactobacillus-containing probiotics on intestinal mucosa of rats experiencing traumatic hemorrhagic shock
  78. Glucocorticoids induce osteonecrosis of the femoral head through the Hippo signaling pathway
  79. Endothelial cell-derived SSAO can increase MLC20 phosphorylation in VSMCs
  80. Downregulation of STOX1 is a novel prognostic biomarker for glioma patients
  81. miR-378a-3p regulates glioma cell chemosensitivity to cisplatin through IGF1R
  82. The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats
  83. TGF-β1-overexpressing mesenchymal stem cells reciprocally regulate Th17/Treg cells by regulating the expression of IFN-γ
  84. The influence of MTHFR genetic polymorphisms on methotrexate therapy in pediatric acute lymphoblastic leukemia
  85. Red blood cell distribution width-standard deviation but not red blood cell distribution width-coefficient of variation as a potential index for the diagnosis of iron-deficiency anemia in mid-pregnancy women
  86. Small cell neuroendocrine carcinoma expressing alpha fetoprotein in the endometrium
  87. Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers
  88. Molecular characterization and phylogenetic studies of Echinococcus granulosus and Taenia multiceps coenurus cysts in slaughtered sheep in Saudi Arabia
  89. ITGB5 mutation discovered in a Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
  90. ACTB and GAPDH appear at multiple SDS-PAGE positions, thus not suitable as reference genes for determining protein loading in techniques like Western blotting
  91. Facilitation of mouse skin-derived precursor growth and yield by optimizing plating density
  92. 3,4-Dihydroxyphenylethanol ameliorates lipopolysaccharide-induced septic cardiac injury in a murine model
  93. Downregulation of PITX2 inhibits the proliferation and migration of liver cancer cells and induces cell apoptosis
  94. Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B
  95. Novel predictor of the occurrence of DKA in T1DM patients without infection: A combination of neutrophil/lymphocyte ratio and white blood cells
  96. Investigation of molecular regulation mechanism under the pathophysiology of subarachnoid hemorrhage
  97. miR-25-3p protects renal tubular epithelial cells from apoptosis induced by renal IRI by targeting DKK3
  98. Bioengineering and Biotechnology
  99. Green fabrication of Co and Co3O4 nanoparticles and their biomedical applications: A review
  100. Agriculture
  101. Effects of inorganic and organic selenium sources on the growth performance of broilers in China: A meta-analysis
  102. Crop-livestock integration practices, knowledge, and attitudes among smallholder farmers: Hedging against climate change-induced shocks in semi-arid Zimbabwe
  103. Food Science and Nutrition
  104. Effect of food processing on the antioxidant activity of flavones from Polygonatum odoratum (Mill.) Druce
  105. Vitamin D and iodine status was associated with the risk and complication of type 2 diabetes mellitus in China
  106. Diversity of microbiota in Slovak summer ewes’ cheese “Bryndza”
  107. Comparison between voltammetric detection methods for abalone-flavoring liquid
  108. Composition of low-molecular-weight glutenin subunits in common wheat (Triticum aestivum L.) and their effects on the rheological properties of dough
  109. Application of culture, PCR, and PacBio sequencing for determination of microbial composition of milk from subclinical mastitis dairy cows of smallholder farms
  110. Investigating microplastics and potentially toxic elements contamination in canned Tuna, Salmon, and Sardine fishes from Taif markets, KSA
  111. From bench to bar side: Evaluating the red wine storage lesion
  112. Establishment of an iodine model for prevention of iodine-excess-induced thyroid dysfunction in pregnant women
  113. Plant Sciences
  114. Characterization of GMPP from Dendrobium huoshanense yielding GDP-D-mannose
  115. Comparative analysis of the SPL gene family in five Rosaceae species: Fragaria vesca, Malus domestica, Prunus persica, Rubus occidentalis, and Pyrus pyrifolia
  116. Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR
  117. Investigation of bioactivities of Taxus chinensis, Taxus cuspidata, and Taxus × media by gas chromatography-mass spectrometry
  118. Morphological structures and histochemistry of roots and shoots in Myricaria laxiflora (Tamaricaceae)
  119. Transcriptome analysis of resistance mechanism to potato wart disease
  120. In silico analysis of glycosyltransferase 2 family genes in duckweed (Spirodela polyrhiza) and its role in salt stress tolerance
  121. Comparative study on growth traits and ions regulation of zoysiagrasses under varied salinity treatments
  122. Role of MS1 homolog Ntms1 gene of tobacco infertility
  123. Biological characteristics and fungicide sensitivity of Pyricularia variabilis
  124. In silico/computational analysis of mevalonate pyrophosphate decarboxylase gene families in Campanulids
  125. Identification of novel drought-responsive miRNA regulatory network of drought stress response in common vetch (Vicia sativa)
  126. How photoautotrophy, photomixotrophy, and ventilation affect the stomata and fluorescence emission of pistachios rootstock?
  127. Apoplastic histochemical features of plant root walls that may facilitate ion uptake and retention
  128. Ecology and Environmental Sciences
  129. The impact of sewage sludge on the fungal communities in the rhizosphere and roots of barley and on barley yield
  130. Domestication of wild animals may provide a springboard for rapid variation of coronavirus
  131. Response of benthic invertebrate assemblages to seasonal and habitat condition in the Wewe River, Ashanti region (Ghana)
  132. Molecular record for the first authentication of Isaria cicadae from Vietnam
  133. Twig biomass allocation of Betula platyphylla in different habitats in Wudalianchi Volcano, northeast China
  134. Animal Sciences
  135. Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens
  136. Predators of the giant pine scale, Marchalina hellenica (Gennadius 1883; Hemiptera: Marchalinidae), out of its natural range in Turkey
  137. Honey in wound healing: An updated review
  138. NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block
  139. Radiotherapy for the treatment of pulmonary hydatidosis in sheep
  140. Retraction
  141. Retraction of “Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating microRNA-34a-5p/NOTCH1 signaling pathway”
  142. Special Issue on Reuse of Agro-Industrial By-Products
  143. An effect of positional isomerism of benzoic acid derivatives on antibacterial activity against Escherichia coli
  144. Special Issue on Computing and Artificial Techniques for Life Science Applications - Part II
  145. Relationship of Gensini score with retinal vessel diameter and arteriovenous ratio in senile CHD
  146. Effects of different enantiomers of amlodipine on lipid profiles and vasomotor factors in atherosclerotic rabbits
  147. Establishment of the New Zealand white rabbit animal model of fatty keratopathy associated with corneal neovascularization
  148. lncRNA MALAT1/miR-143 axis is a potential biomarker for in-stent restenosis and is involved in the multiplication of vascular smooth muscle cells
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 8.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2021-0006/html
Scroll to top button