Home Life Sciences Role of MS1 homolog Ntms1 gene of tobacco infertility
Article Open Access

Role of MS1 homolog Ntms1 gene of tobacco infertility

  • Qian Chen , Tingting Zhao , Lili Duan , Zejun Mo , Maozhu Tian , Zhenhua Li , Yang Liu and Renxiang Liu EMAIL logo
Published/Copyright: August 24, 2021
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 16 Issue 1

Abstract

The sterile line is the basis of crop heterosis utilization. To broaden the sources of male sterility in tobacco, the Ntms1 (Nicotiana tabacum L. ms1) gene was cloned from the tobacco variety K326 by homologous cloning based on the Cams1 (Capsicum annuum L. ms1) gene sequence of male-sterility genes in pepper. The protein structure and physicochemical properties of the two genes were determined by bioinformatics analysis, and the function of the Ntms1 gene was verified by the CRISPR/Cas9 system. The results showed that the sequences of Ntms1 and Cams1 were 85.25% similar, and plant homeodomains were found in both genes; the physical and chemical properties were also very similar. It is speculated that the Ntms1 gene had the same function as the Cams1 gene in controlling male sterility. Compared to the wild-type plants, the filaments of the Ntms1 knockout mutant plants were shorter, and the stamen was shorter than the pistil. The anthers did not develop fully and had few viable pollen grains; the tapetum and the anther wall had developed abnormally, and the anther chamber was severely squeezed. The malondialdehyde content in the mutant plants was significantly higher than that in the wild-type plants, while self-fertility was significantly lower in the mutant plants. The results showed that the Ntms1 gene plays an important role in regulating fertility in tobacco.

Keywords: MS1 gene; tobacco; fertility; homologous cloning

1 Introduction

Male sterility is an important agronomic trait in studies of crop heterosis utilization. It is a genetic phenomenon defined by the inability of plants to produce normal anthers, pollens, or male gametes during sexual reproduction, while the pistil functions normally [1]. The sterile males are used to produce hybrids that can save artificial castration, reduce seed production costs, and improve seed purity. To date, 13 genes associated with male sterility have been cloned from Arabidopsis and maize. Among them, the MS1 gene, which has been proven to be a key gene regulating pollen formation, is mainly expressed when microspores are released from the tetrad and encodes a plant homeodomain (PHD)-containing nuclear protein [2]. PHD is closely related to the composition of the pollen wall and the tapetum development and does not affect other floral organs. They cause pollen abortion, and thus, can be used in production [3]. The PTC1 gene in rice was found to be homologous to the MS1 gene in Arabidopsis, which also encodes a PHD domain and shows similar functions in regulating the development of villus cells and the pollen wall [4]. The homologous Zmms1 gene in maize was cloned from the Osms1 gene in rice by homologous cloning, and the results of the bioinformatics analysis showed that both Zmms1 and Osms1 were very similar to the members of the PHD domain family. It is speculated that the Zmms1 gene, along with Osms1, may control fertility [5]. The CRISPR/Cas9 system was used to develop male-sterile lines without transgenic maize and obtain stable genetic lines [6]. Using the MS1 gene in Arabidopsis thaliana as a reference sequence, bioinformatic methods were applied to predict and analyze the amino acid sequences encoded by Brassica crops such as rape, Chinese cabbage, and cabbage. The results showed that the MS1 gene in Brassica crops belonged to the PHD finger family, and its highly conserved sequence was involved in the regulation of pollen development and maturation [7]. Using the CRISPR/Cas9 system to create targeted mutations in MS1, a double displacement code mutation was introduced into MS1, which resulted in complete male sterility in wheat varieties Fielder and Gladius [8]. Three homologous sequences of the MS1 gene modified by the CRISPR/Cas9 system could rapidly generate male-sterile wheat lines [9]. The CRISPR/Cas9 system was used to mediate the knockout of the MS1 gene, causing extremely low expression levels of this gene in the anther, which had missing spikelets; the self-fertilization rate was also significantly reduced [10]. The Cams1 gene in pepper is highly homologous to the MS1 gene in Arabidopsis thaliana. It contains the PHD domain and two low complexity domains, which control pollen fertility. When compared with fertile plants, the number of pollens in sterile pepper plants was significantly reduced [11]. In summary, the role of the MS1 gene in the regulation of fertility has been confirmed in major crops such as rice, maize, rape, wheat, and pepper. However, it has not yet been reported whether the MS1 gene regulates male sterility in tobacco.

The tobacco leaves are the most economically important part of the plant. For controlling the various layouts and areas of tobacco production, in addition to the direct use of sterile hybrids, pure line varieties bred by hybridization are often transformed into sterile lines for tobacco production. The proportion of sterile lines in tobacco production is as high as 80%. However, the sterile lines used in tobacco production are derived only from the cytoplasmic sterile genes of N. suaveolens, and there is a single source of sterility in genes; the cytoplasm is easily infected by pathogenic bacteria, which affects the production and application of tobacco hybrids and sterile lines [12,13]. Therefore, broadening the source of male sterility in tobacco is very important for stable tobacco production. While studying male sterility in tobacco, previous studies had mostly focused on cytoplasmic male sterility and found Atp6, Atp9, Arf25, and Arfb sterile cytoplasmic genes [14]. Tobacco and pepper belong to the Solanaceae family and have high homology. Therefore, in this study, the Ntms1 gene was cloned from tobacco by the homologous cloning method based on the Cams1 genome sequence of pepper, and the knockout vector was constructed by the CRISPR/Cas9 technology. The function of the Ntms1 gene was identified, and sterile tobacco plants were produced, which have immense scientific significance and practical value for broadening the source of male sterility in tobacco.

2 Materials and methods

2.1 Tobacco plant varieties

The tobacco variety used in the experiment was the main variety K326, usually used in tobacco production and preserved and provided by the Guizhou Tobacco Quality Key Research Laboratory.

2.2 Carriers and strains

Escherichia coli DH5α and Agrobacterium tumefaciens EHA105 were preserved and provided by the Guizhou Tobacco Quality Research Key Laboratory. The TA cloning vector pMD18-T was provided by the Shaanxi Border Biotechnology Co., Ltd. The target design and comparison of the CRISPR/Cas9 recombinant vector MSG2 were performed in the Guizhou Key Laboratory of Tobacco Quality Research, and the synthesis of the CRISPR/Cas9 recombinant vector was performed by Baige Gene Technology (Jiangsu Co., Ltd).

2.3 Total RNA extraction and cDNA synthesis

Total RNA was extracted using the RNAiso Plus Tri Zol (Ta Ka Ra). The cDNA was synthesized using the Poly Attract® mRNA Isolation System III with Magnetic Stand kit from Promega, which was purchased from Bao Bioengineering (Dalian) Co., Ltd. The reverse transcription system and reaction procedure are listed in Table S2.

2.4 The creation of mutants

2.4.1 Cloning and vector construction of target genes

The amino acid sequence Cams1 (LOC107852993) of the MS1 protein in pepper was obtained from the NCBI website (https://www.ncbi.nlm.nih.gov/). The amino acid sequence was compared to that in common tobacco to find the protein that had the highest homology with MS1 (GenBank accession number: LOC107813657). The query coverage of the two sequences reached 100% (Figure S10). The specific primer 657 – F (ATGGTGGTAA TGAATGGAAGGCC)/657 – R (TCAGGCAGCA TTAGTCAAGC) was designed with this sequence using the Primer 5.0 software, cloned according to the method developed by Sun et al. [15], and sequenced in the Shaanxi Brad Biotechnology Co., Ltd.; the sequence was called Ntms1. The Ntms1 gene (the PHD finger protein) was constructed by the CRISPR/Cas9 vector. Initially, the target genes were sequenced to eliminate SNP interference, thus ensuring highly accurate targeted editing, and then gRNA was constructed according to the methods developed by Okada et al. [8] (See Appendix for the construction process and procedures of CRISPR/Cas9 vector).

2.4.2 Bioinformatics analysis

The ORF finder (https://www.ncbi.nlm.nih.gov/orffinder/) in NCBI was used to identify the open reading frames of the Cams1 gene in pepper and the Ntms1 gene in tobacco. The ProtParam system (https://web.expasy.org/protparam/) in the ExPASy database was used to analyze the physical and chemical properties of the isoelectric point (PI) and the extinction and instability coefficients of proteins. The ProtScale online software (https://web.expasy.org/protscale/) was used to estimate the hydrophilicity of the proteins. The InterPro online software (http://www.ebi.ac.uk/interpro/) was used for analyzing the protein domain. The NetPhos 3.1 online website (http://www.cbs.dtu.dk/services/NetPhos/) was used to analyze the protein phosphorylation sites. The SOPMA and Phyre2 were used online to analyze and predict the secondary and tertiary structures of the proteins, respectively. The TMHMM online software (http://www.cbs.dtu.dk/services/TMHMM/) was used to analyze the transmembrane domains in proteins. The Signal P4.1 online software was used to determine whether the proteins contained signal peptides. The DNAMAN software was used to perform multiple alignments of protein sequences and observe the similarity between them. The MEGA7.0 software was used to construct a molecular evolutionary phylogenetic tree for the species selected from the NCBI database, and the phylogenetic relationship between species was observed using the evolutionary tree.

2.4.3 Genetic transformation and screening for positive strains

The genetic transformation technique was applied based on the CRISPR/Cas9 gene-editing technology established by Tian [16]. The identification of positive mutants was based on the screening method developed by Chen et al. [17].

2.4.4 Gene expression analysis of the Ntms1 gene in mutant plants

The RT-PCR primers PHD_F (ATGTTGGCTTGTGATGTCTG)/PHD_R (TTCCCGCTTGTATTTGTAGTC) were designed based on the Ntms1 sequence, and the expression of the Ntms1 gene was analyzed using the tobacco Actin internal reference gene primers, Actin-F (CATGAAGATTAAAGGCGGAGTG)/Actin-R (AACAGTTTGGTTGGAGTTCTGG).

2.5 Analysis of the fertility of the mutants

2.5.1 Observation of the floral organ in mutant strains

Wild-type tobacco plants were considered as control. The upcoming opening buds were taken; the anther fullness, stigma, and filament length were observed, and photographs were taken.

2.5.2 Identification of mutant strains associated with drug development

The flower buds of the mutant strains were fixed in a formalin-acetic acid-alcohol solution, and the drug delivery sections were observed according to the method developed by Wang et al. [18].

2.5.3 Identification of pollen grains in mutant plants

At the full bloom stage, plants were cut using a dissecting needle to remove the anther wall before it cracked. All the pollens were picked up after dyeing and mixed in a 200 µL I-KI staining solution. The pollen morphology was observed under the microscope (XHC-L2, 40×) after dyeing. Five fields were randomly selected for each plant, and the number of dyed pollen grains was calculated. The active pollens were the fully developed jacinth, while the inactive and less active pollens were buff.

2.5.4 Detection of the MDA content in mutant strains

The mature leaves from the first (bottom) to the 14th leaf (top) in each mutant were transferred to the laboratory in a wet gauze and measured by the methods developed by Zhang et al. [19].

2.5.5 The estimation of self-fertility rate in mutant strains

After the central flower in the mutant plants opened, ten flowers with slightly red corollas that had been bagged and self-pollinated were randomly selected from each mutant; the seeds were harvested at maturity, and the fruit rate was recorded. The number of seeds per fruit was then calculated, and the relative seed setting rate of the mutant plants was estimated.

2.6 Statistical analysis

The Excel 2013 (Microsoft, USA), DPS 14.10 (Hangzhou Ruifeng Information Technology Co., Ltd., China), and Origin (OriginLab, the US) software were used for statistical data analysis. All the data used were the average of three biological replicates; the error bar represents standard deviation (±SD). A “*” sign represents P < 0.05, with significant difference; a “**” sign represents P < 0.01, with highly significant difference.

3 Results

3.1 The function of the Ntms1 gene in controlling fertility

The Ntms1 gene, which was obtained by homologous cloning of the Cams1 gene, controls fertility. The results of the bioinformatics analysis showed that the start codon of Ntms1 is located at the 36th nucleotide, and the stop codon is located at the 2,174th nucleotide, which encodes a total of 712 amino acids. The number of exons is 2,137 bp, and the number of introns is 817 bp. The start codon of Cams1 is located at the first nucleotide, and the stop codon is located at the 2,100th nucleotide. It encodes a total of 699 amino acids; the number of exons is 2,111 bp, and the number of introns is 584 bp. The coding regions of the two genes overlap, and the difference in the number of encoded amino acids is very small, indicating that the proteins encoded by the two genes are not significantly different (Figure S1). The similarity between Ntms1 and Cams1 proteins was 85.25%. Both were non-secretory and non-transmembrane proteins, and their receptors had protein kinase activity (Figures S2–S6). The hydrophilicity indices of these two proteins were −0.238 and −0.299, respectively, which made them hydrophilic proteins. Additionally, the physical and chemical properties such as molecular weight, isoelectric point, and the number of positively and negatively charged amino acids were very similar (Table 1), and they all had the same PHD domain (Figure S5). The spatial similarity of the secondary structure was also very high (Table S1), and the result of the phylogenetic tree analysis (Figure S8) showed that the homology between the two was 100%. It is speculated that the Ntms1 gene has the same function as Cams1 in controlling fertility.

Table 1

Physical and chemical properties of Cams1/Ntms1 protein

Protein Molecular weight (kDa) Isoelectric point Negatively charged amino acid (Asp + Glu) Positively charged amino acid (Arg + Lsy) Unstable coefficient Hydrophilic index
Cams1 78.16 8.22 81 87 37.95 −0.238
Ntms1 79.62 8.48 82 91 35.25 −0.299

3.2 The effect of the transformant Ntms1 gene editing

The results showed that the Cas9 gene could be detected by the CRISPR/Cas9 gene-editing technology in six genetically transformed plants (Figure S7), and 4–6 base substitutions occurred at the targeted gene sites of the transformed plants (Figure 1). The expression of the Ntms1 gene in the six mutant strains was significantly lower (48–69%) than that in the wild-type plants (Figure 2). The results showed that the CRISPR/Cas9 vector played an important role in editing the target gene in the transformed strain, resulting in significant changes in the sequence and expression level of the target gene. The target gene of the transformed strain was mutated.

Figure 1 Sequencing results of mutant strains. Blue represents the target site, red represents the mutated base, and yellow represents the PAM site. All of the six strains had multiple base mutations.
Figure 1

Sequencing results of mutant strains. Blue represents the target site, red represents the mutated base, and yellow represents the PAM site. All of the six strains had multiple base mutations.

Figure 2 Relative expression of Ntms1 gene in mutant. Note: All data are the average of three biological repetitions, a “**” sign represents P < 0.01, with highly significant difference.
Figure 2

Relative expression of Ntms1 gene in mutant. Note: All data are the average of three biological repetitions, a “**” sign represents P < 0.01, with highly significant difference.

3.3 Significant changes in fertility-related traits of Ntms1 knockout mutants

3.3.1 Changes in the structure of floral organs in mutant strains

Observations of the morphology of the floral organ of the mutant and wild-type plants (Figure 3) showed that although both the plants could flower normally, the anther and filament length of the mutant plants changed significantly when compared with those of the wild-type plants. The anthers of the wild-type plants were full and larger than the stigma, and pollen grains were scattered on the surface of the hair. However, the filaments of the mutant were shorter, the anther height was lower than that of the stigma, and self-pollination could not be performed. The anthers were shrunk, and there were few mature pollen grains. The knockout of the Ntms1 gene led to the shortening of the filament and pollen abortion.

Figure 3 Observation on flower morphology of the mutants and WT. (a) On the left is the wild type, the anther is higher than the stigma. On the right is the mutant, the anther is lower than the stigma. (b and c) Mutant, anther atrophy, growth short and below the stigma.
Figure 3

Observation on flower morphology of the mutants and WT. (a) On the left is the wild type, the anther is higher than the stigma. On the right is the mutant, the anther is lower than the stigma. (b and c) Mutant, anther atrophy, growth short and below the stigma.

3.3.2 Abnormal development of the anther wall and tapetum in mutant strains

Observations of the anther slices (Figure 4) showed that the edges of the anther wall of the wild-type tobacco were clear, and multiple, nearly spherical pollen grains were evenly distributed in the anther chamber. The anthers in the mutant plants developed abnormally, and the chambers were severely squeezed; death of the tapetum occurred, and the pollen grains were abnormal. This indicates that the deletion of the Ntms1 gene resulted in the abnormal development of the tapetum, which could not provide the necessary nutrients for microspore development.

Figure 4 Paraffin section observation of pollen. (a, c, and e) WT. (b, d, and f) Mutant. Msp, microspores. T, tapetum. (a and b), Bars = 200 μm. (c–f), Bars = 20 μm.
Figure 4

Paraffin section observation of pollen. (a, c, and e) WT. (b, d, and f) Mutant. Msp, microspores. T, tapetum. (a and b), Bars = 200 μm. (c–f), Bars = 20 μm.

3.3.3 Membrane damage in mutants

In a study on male sterility in cotton, a high MDA content caused abnormal metabolism, accumulation and peroxidation of membrane lipids, and pollen abortion [20]. Figure 5 shows that the MDA content of the mutant plants was significantly higher than that of the wild-type plants, indicating that the knockout of the Ntms1 gene had caused a certain degree of damage to the membrane system, which might have led to infertility.

Figure 5 The detection of MDA content. Note: All data are the average of three biological repetitions, a “**” sign represents P < 0.01, with highly significant difference.
Figure 5

The detection of MDA content. Note: All data are the average of three biological repetitions, a “**” sign represents P < 0.01, with highly significant difference.

3.3.4 A significant decrease in the number of viable pollen grains

The number of viable pollen grains and pollen viability was the most direct indicators of fertility. The results of the determination of the number of pollen grains and pollen viability in the mutant plants (Table 2, Figure 6) showed that viable pollen grains accounted for 6.4–10.8% of the total pollen grains and were significantly lower than that in the wild-type plants. The color of the viable pollen grains in the mutant plants was pale yellow after staining, which was lighter than that in the wild-type plants, indicating that the vitality of viable pollen grains in the mutant plants was lower than that in the wild-type plants. The knockout of the Ntms1 gene resulted in a significant reduction in the number of viable pollen grains and pollen viability.

Table 2

Variance analysis table for pollen grains staining

Lines Mean (a) Significant level (5%) Extremely significant level (1%)
WT 56.6 **
C129 10.8 * **
C60 9.8 * **
B23 9.4 * **
B34 9.4 * **
B21 7.6 * **
C125 6.4 * **

Note: All data are the average of three biological repetitions, a “*” sign represents P < 0.05, with a significant difference; a “**” sign represents P < 0.01, with a highly significant difference.

Figure 6 Determination of pollen vigor of mutant and wild-type (upper row: mutant; bottom row: wild type). The number of viable pollen grains in the mutant strain was significantly lower than that of the wild type.
Figure 6

Determination of pollen vigor of mutant and wild-type (upper row: mutant; bottom row: wild type). The number of viable pollen grains in the mutant strain was significantly lower than that of the wild type.

3.3.5 A significant decrease in self-pollinated mutants

Self-pollination is the most direct indicator of fertility. The results of the effect of self-pollination on each parameter (Table 3) showed that the yield rate, seed number per fruit, and relative seed setting rate of the mutant plants were significantly lower than those of the wild-type plants; the relative seed setting rate was only 22.03–42.90% of that of the wild-type control. A possible reason is the smaller number of fertile pollen grains in the mutant plants, indicating that the knockout of the Ntms1 gene led to a decrease in the number of fertile pollen grains and a significant reduction in the self-pollination rate.

Table 3

Statistics of self-fertilization of mutants

Lines Fruit rate (%) Number of seeds per fruit (seeds) Relative seed setting rate (%)
WT 100 3074.30 100.00
C129 80** 1319.00** 42.90**
C60 80** 1170.20** 38.06**
B23 70** 1015.50** 33.03**
B34 70** 885.50** 28.80**
B21 70** 770.60** 25.07**
C125 60** 677.30** 22.03**

Note: All data are the average of three biological repetitions, a “*” sign represents P < 0.05, with a significant difference; a “**” sign represents P < 0.01, with a highly significant difference.

4 Discussion

Bioinformatic methods were used to analyze genomic sequences and explore genetic information, predict biological functions of genes, and improve the efficiency of the identification of gene functions [21]. The homologous gene Zmms1 in maize was cloned by the homologous cloning of Osms1 in rice. Bioinformatics analysis showed that both Zmms1 and Osms1 were very similar and members of the PHD domain family. It is speculated that Zmms1 may have the same function as Osms1 in controlling fertility [5], and stable male-sterile lines in maize were obtained by the CRISPR/Cas9 system [6]. In this study, the open reading frame (ORF) of the Cams1 gene in pepper and the Ntms1 gene in tobacco were identified using the ORF from the NCBI database. Due to similar physicochemical properties such as the protein isoelectric point, protein domain, and extinction and instability coefficients, it was predicted that the Ntms1 gene might have the same function as the Cams1 gene in controlling fertility. The results of the CRISPR/Cas9 gene-editing technology showed that the bioinformatics analysis was a reliable method for predicting the function of homologous genes and can also improve the efficiency of the identification of gene functions.

The MS1 gene was proven to be a key regulator of pollen development in major crops such as rice, maize, rape, wheat, and pepper. Studies have found that the MS1 gene encodes a PHD-containing nuclear protein [2]. PHD was closely related to pollen wall composition and tapetum development and did not affect other floral organs but caused pollen abortion [3]. The knockout of the MS1 gene resulted in atrophy of the anther in rice, lowering the number of anthers compared to the stigma, thus preventing self-pollination [22]. The MS1 gene knockout also caused the pollen number and pollen viability in Cucurbita pepo to decrease [23]. Additionally, due to the knockout, anthers were found to be missing, and pollen sac cells in maize flowers remained undifferentiated [24]. Moreover, the anthers of rice were white and short, with no mature pollen grains, and the seed setting rate decreased significantly [25]. The MDA content in cotton increased significantly, causing abnormal metabolism and accumulation and peroxidation of membrane lipids, thus resulting in pollen abortion [20]. In this study, the Ntms1 gene of the tobacco variety K326 was knocked out by the CRISPR/Cas9 gene-editing technology. It was found that the expression of the Ntms1 gene in mutant plants was significantly reduced. The filaments of the floral organs were shortened, and anthers had shrunk; the development of the pollen wall and tapetum were abnormal, and the chamber was severely squeezed. Moreover, the number of viable pollen grains was significantly reduced, and there was also a reduction in the pollen viability; the self-fertility rate was extremely low, and some mutant flowers were even self-infertile, indicating that the Ntms1 gene regulated fertility in tobacco.

The CRISPR/Cas9 gene-editing technology was used to identify the gene functions. If the gene affects quantitative traits, the T1 generation strain should be used, and the test should be performed according to the unique difference principle to obtain accurate identification results. In this study, since the fertility of tobacco plants was the research interest and self-sterility in pollen could not be achieved, the obtained T1 generation strain eliminated sterile pollen by natural selection, which no longer provided a strict random population sample. Therefore, the direct identification of sterile mutant traits by using mutant strains of the T0 generation was highly reliable in this study.

5 Conclusion

In this study, the Ntms1 gene was cloned from tobacco, and bioinformatics analysis was performed to determine whether the Ntms1 gene in tobacco and the sterile gene Cams1 in pepper control fertility similarly. Sterile mutant plants were obtained by the CRISPR/Cas9 gene-editing technology. It was found that the expression level of the mutant Ntms1 gene was significantly reduced. The filaments of the floral organ were shortened, the anthers were shrunk, and the development of the pollen wall and the tapetum was abnormal. Furthermore, the chamber was severely squeezed, there was a significant reduction in the number of viable pollen grains, and the pollen vitality was also reduced. The self-fertilization rate was extremely low, and some plants were even self-infertile, proving that the Ntms1 gene regulates fertility in tobacco plants. The results of this research have immense scientific significance and practical value as they provide a basis for further research on the mechanism of the induction and development of new sources of male sterility in tobacco.

Acknowledgments

This study was carried out in the Key Laboratory of Tobacco Quality of Guizhou University and the tobacco base of Guizhou University. We thank the editors and anonymous reviewers for their comments and suggestions, which significantly contributed to improving the quality of this article.

  1. Funding information: This research was funded by “100” level innovative talents training plan of Guizhou, China (NO. 20165663), Molecular mechanism of nicotine heterosis formation of Guizhou, China (NO. 20191405), and Key technology research of high-quality flue-cured tobacco variety breeding of Guizhou, China (NO. 201602).

  2. Author contributions: C.Q. and Z.T.T. performed bioinformatics analysis, cloning, and vector construction of the manuscript written by C.Q. C.Q. and T.M.Z. were genetically transformed. C.Q. performed phenotypic observation, pollen vigor measurement, M.D.A. content measurement, and paraffin section. L.R.X. designed and supervised the study, M.Z.J. and D.L.L. performed RNA extraction, and L.Z.H. and L.Y. performed expression data analysis. All authors read and approved the final manuscript.

  3. Conflict of interest: The authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Appendix: Construction of CRISPR/cas9 vector

  1. Select the target.

  2. Construction of intermediate vector gRNA. The gRNA fragments are obtained by the PCR reaction, and the reaction system and procedures are listed in Tables A1 and A2.

  3. Enzyme digestion connection, connection system, and reaction procedure are listed in Tables A3 and A4.

  4. The recombinant plasmid was transformed.

  5. The plasmid was extracted.

  6. Sequencing.

  7. The ligation system and reaction procedure are listed in Tables A5 and A6, respectively.

  8. The system of transformation and bacteria detection is listed in Tables A7 and A8.

  9. Pick out the correct clone, extract the plasmid and send it to the company for sequencing.

Table A1

gRNA reaction system

Composition of reaction solution Reaction liquid capacity (µL)
Forward primer 5
Reverse primer 5
ddH2O 40
Total volume 50
Table A2

Reaction procedure

Step Temperature (°C) Time (min)
Denaturation 95 10
Annealing 55 10
Cooling 14 5
Table A3

Enzyme digestion system

Composition of reaction solution Reaction liquid capacity (µL)
gRNA fragment 2
Empty carrier1 (pBWA(V)HS-zmpl) 1.5
ECO31I 0.5
T4-ligase 0.5
T4-buffer 1
ddH2O 4.5
Total volume 10
Table A4

Reaction procedure

Step Temperature (°C) Time (min)
Denaturation 95 10
Annealing 55 10
Cooling 14 5
Table A5

Double enzyme digestion system

Composition of reaction solution Reaction liquid capacity (µL)
Target 1 (plasmid) 1
Target 2 (plasmid) 1.5
LguI 0.5
T4-ligase 0.5
T4-buffer 1
ddH20 5.5
Total volume 10
Table A6

Reaction procedure

Step Temperature (°C) Time (min)
Denaturation 95 10
Annealing 55 10
Cooling 14 5
Table A7

Bacterial test system

Composition of reaction solution Reaction liquid capacity (µL)
2× Mix 10
M13F-chen (Forward detection primer) 1
zmpl-chen (Reverse detection primer) 1
ddH2O 8
Total volume 20
Table A8

Reaction procedure

Step Temperature (°C) Time (min)
Denaturation 95 10
Annealing 55 10
Cooling 14 5

References

[1] Kley FKVD. Male sterility and its importance in breeding heterosis varieties. Euphytica. 1954;3:117–24.10.1007/BF00029958Search in Google Scholar

[2] Yu S. Identification and characterisation of MS1 putative interacting proteins and regulatory targets in Arabidopsis. PhD thesis. Britain: University of Nottingham; 2015.Search in Google Scholar

[3] Zhang D, Wu S, An X, Xie K, Dong Z, Zhou Y, et al. Construction of a multicontrol sterility system for a maize male‐sterile line and hybrid seed production based on the ZmMs7 gene encoding a PHD‐finger transcription factor. Plant Biotechnol J. 2018;16:459–71.10.1111/pbi.12786Search in Google Scholar PubMed PubMed Central

[4] Chen J, Jiao Y, Laza H, Payton P, Xin Z. Identification of the first nuclear male sterility gene (male-sterile9) in Sorghum. Plant Genome. 2019;12:1–12.10.3835/plantgenome2019.03.0020Search in Google Scholar PubMed

[5] Qing-Xu L, Gao S, Sun L, Zhang ZJ, Zhang JX, Wang M, et al. Bioinformatics analysis of male sterile gene ms1 homologs in Maize. Maize Sci. 2018;26:44–52.Search in Google Scholar

[6] Chen R, Xu Q, Liu Y, Zhang J, Liu Y. Generation of transgene-free maize male sterile lines using the CRISPR/Cas9 system. Front Plant Sci. 2018;9:1180.10.3389/fpls.2018.01180Search in Google Scholar PubMed PubMed Central

[7] Tang WW, Wu XL, Li GH. Bioinformatics analysis of pollen development related gene MS1 in Brassica. Acta Sci Sin. 2017;48:2122–8.Search in Google Scholar

[8] Okada A, Arndell T, Borisjuk N, Sharma N, Watson-Haigh NS, Tucker EJ, et al. CRISPR/Cas9‐mediated knockout of Ms1 enables the rapid generation of male‐sterile hexaploid wheat lines for use in hybrid seed production. Plant Biotechnol J. 2019;17:1905–13.10.1111/pbi.13106Search in Google Scholar PubMed PubMed Central

[9] Singh M, Kumar M, Albertsen MC, Young JK, Cigan AM. Concurrent modifications in the three homeologs of Ms45 gene with CRISPR-Cas9 lead to rapid generation of male sterile bread wheat (Triticum aestivum L.). Plant Mol Biol. 2018;97:371–83.10.1007/s11103-018-0749-2Search in Google Scholar PubMed

[10] Liu H, Wang J, Li C, Qiao L, Wang X, Li J, et al. Phenotype characterisation and analysis of expression patterns of genes related mainly to carbohydrate metabolism and sporopollenin in male-sterile anthers induced by high temperature in wheat (Triticum aestivum). Crop Pasture Sci. 2018;69:469–78.10.1071/CP18034Search in Google Scholar

[11] Kyumi J, Doil C, Jundae L. Fine mapping of the genic male-sterile ms1 gene in Capsicum annuum L. Theor Appl Genet. 2018;131:183–91.10.1007/s00122-017-2995-0Search in Google Scholar PubMed

[12] Fitter JT, Thomas MR, Chen N, Rose RJ. Investigation of Nicotiana tabacum (plus) N suaveolens cybrids with carpelloid stamens | NOVA. The University of Newcastle’s digital repository. J Plant Physiol. 2005;162:225–35.10.1016/j.jplph.2004.02.006Search in Google Scholar PubMed

[13] Berbec A, Laskowska D. Agronomic performance of flue-cured tobacco F1 hybrids obtained with different sources of male sterile cytoplasm. Btrge Zur Tabakforschung. 2014;21:235–9.10.2478/cttr-2013-0785Search in Google Scholar

[14] Tao Y, Wang Y, Zhong SR, Wu LM, Xie LJ, Nie YP, et al. Tobacco ATP synthase F – analysis of transcriptional editing sites of four subunits in part 0. Acta Crops Sin. 2016;42:1743–53.10.3724/SP.J.1006.2016.01743Search in Google Scholar

[15] Sun GH, Yuan HH, Fan XC, Gu HK, Song MF, Xiao Y, et al. Cloning of Brassica oleracea phytochrome B gene and functional verification of heterologous transformation in Arabidopsis. Chin Agric Sci. 2015;48:4417–27.Search in Google Scholar

[16] Tian MZ. Study on directional mutation of tobacco cyp71d16 gene by CRISPR/cas9 technology. China: Guizhou University; 2019.Search in Google Scholar

[17] Chen HJ, Li F, Yan Y, Ji X, Sun HZ, Zhang J, et al. Using CRISPR/cas9 gene editing technology to create rice phytochrome phyB gene mutant. Mol Plant Breed. 2018;16:7667–75.Search in Google Scholar

[18] Wang XR, Hui ZM, Xu JF, Duan SG, Bian CS, Jin LP, et al. Histocytological study on potato shape development. Chin Veg. 2020;4:67–73.Search in Google Scholar

[19] Zhang QP, Wu XH, Zheng JH, Sun MW. Research progress of determination methods of malondialdehyde in biological samples. Phys Chem Exam (Chem). 2016;52:979–85.Search in Google Scholar

[20] Li YQ, Wang QL, Wei CY, Dong T, Chen JJ, Zhou RY. Study on morphological observation and physiological and biochemical characteristics of cytoplasmic male sterility in cotton. J Southwest Agric. 2020;33:58–63.Search in Google Scholar

[21] Mickael G, Hamish MW, Li W, Franck V, Silvano S, Juri P, et al. A new bioinformatics analysis tools framework at EMBL–EBI. Nucleic Acids Res. 2010;38(Web Server Issue):695–9.10.1093/nar/gkq313Search in Google Scholar PubMed PubMed Central

[22] Kusz K, Tomczyk L, Spik A, Latos‐Bielenska A, Jedrzejczak P, Pawelczyk L, et al. NANOS3 gene mutations in men with isolated sterility phenotype. Mol Reprod Dev. 2010;76:804.10.1002/mrd.21070Search in Google Scholar PubMed

[23] Shantasov AM, Sokolov SD, Bocharnikov AV, Maletina VA. Determination of fertility and pollen viability of breeding line of pattyupan squash with male sterility of functional type. Veg Crops of Russ. 2014;3:8–10.10.18619/2072-9146-2014-3-8-10Search in Google Scholar

[24] Rong L, Liu D, Pedersen EF, Zhang G. The effect of wind speed and direction and surrounding maize on hybrid ventilation in a dairy cow building in Denmark. Energy Build. 2015;86:25–34.10.1016/j.enbuild.2014.10.016Search in Google Scholar

[25] Yang Z. Map based cloning and functional analysis of rice male sterile gene TIP3 and molecular mechanism of its homologous gene osms1. China: Huazhong Agricultural University; 2019.Search in Google Scholar
Received: 2021-02-23
Revised: 2021-07-28
Accepted: 2021-07-29
Published Online: 2021-08-24

© 2021 Qian Chen et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Research progress on the mechanism of orexin in pain regulation in different brain regions
  3. Adriamycin-resistant cells are significantly less fit than adriamycin-sensitive cells in cervical cancer
  4. Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
  5. Iris metastasis of diffuse large B-cell lymphoma misdiagnosed as primary angle-closure glaucoma: A case report and review of the literature
  6. LncRNA PVT1 promotes cervical cancer progression by sponging miR-503 to upregulate ARL2 expression
  7. Two new inflammatory markers related to the CURB-65 score for disease severity in patients with community-acquired pneumonia: The hypersensitive C-reactive protein to albumin ratio and fibrinogen to albumin ratio
  8. Circ_0091579 enhances the malignancy of hepatocellular carcinoma via miR-1287/PDK2 axis
  9. Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-κB signaling pathway
  10. Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats
  11. ABCB1 polymorphism in clopidogrel-treated Montenegrin patients
  12. Metabolic profiling of fatty acids in Tripterygium wilfordii multiglucoside- and triptolide-induced liver-injured rats
  13. miR-338-3p inhibits cell growth, invasion, and EMT process in neuroblastoma through targeting MMP-2
  14. Verification of neuroprotective effects of alpha-lipoic acid on chronic neuropathic pain in a chronic constriction injury rat model
  15. Circ_WWC3 overexpression decelerates the progression of osteosarcoma by regulating miR-421/PDE7B axis
  16. Knockdown of TUG1 rescues cardiomyocyte hypertrophy through targeting the miR-497/MEF2C axis
  17. MiR-146b-3p protects against AR42J cell injury in cerulein-induced acute pancreatitis model through targeting Anxa2
  18. miR-299-3p suppresses cell progression and induces apoptosis by downregulating PAX3 in gastric cancer
  19. Diabetes and COVID-19
  20. Discovery of novel potential KIT inhibitors for the treatment of gastrointestinal stromal tumor
  21. TEAD4 is a novel independent predictor of prognosis in LGG patients with IDH mutation
  22. circTLK1 facilitates the proliferation and metastasis of renal cell carcinoma by regulating miR-495-3p/CBL axis
  23. microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury
  24. Long noncoding RNA TUG1 regulates degradation of chondrocyte extracellular matrix via miR-320c/MMP-13 axis in osteoarthritis
  25. Duodenal adenocarcinoma with skin metastasis as initial manifestation: A case report
  26. Effects of Loofah cylindrica extract on learning and memory ability, brain tissue morphology, and immune function of aging mice
  27. Recombinant Bacteroides fragilis enterotoxin-1 (rBFT-1) promotes proliferation of colorectal cancer via CCL3-related molecular pathways
  28. Blocking circ_UBR4 suppressed proliferation, migration, and cell cycle progression of human vascular smooth muscle cells in atherosclerosis
  29. Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
  30. Downregulation of circ_0037655 impedes glioma formation and metastasis via the regulation of miR-1229-3p/ITGB8 axis
  31. Vitamin D deficiency and cardiovascular risk in type 2 diabetes population
  32. Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis
  33. Mechanisms of circular RNA circ_0066147 on pancreatic cancer progression
  34. lncRNA myocardial infarction-associated transcript (MIAT) knockdown alleviates LPS-induced chondrocytes inflammatory injury via regulating miR-488-3p/sex determining region Y-related HMG-box 11 (SOX11) axis
  35. Identification of circRNA circ-CSPP1 as a potent driver of colorectal cancer by directly targeting the miR-431/LASP1 axis
  36. Hyperhomocysteinemia exacerbates ischemia-reperfusion injury-induced acute kidney injury by mediating oxidative stress, DNA damage, JNK pathway, and apoptosis
  37. Potential prognostic markers and significant lncRNA–mRNA co-expression pairs in laryngeal squamous cell carcinoma
  38. Gamma irradiation-mediated inactivation of enveloped viruses with conservation of genome integrity: Potential application for SARS-CoV-2 inactivated vaccine development
  39. ADHFE1 is a correlative factor of patient survival in cancer
  40. The association of transcription factor Prox1 with the proliferation, migration, and invasion of lung cancer
  41. Is there a relationship between the prevalence of autoimmune thyroid disease and diabetic kidney disease?
  42. Immunoregulatory function of Dictyophora echinovolvata spore polysaccharides in immunocompromised mice induced by cyclophosphamide
  43. T cell epitopes of SARS-CoV-2 spike protein and conserved surface protein of Plasmodium malariae share sequence homology
  44. Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
  45. Long noncoding RNA HULC contributes to paclitaxel resistance in ovarian cancer via miR-137/ITGB8 axis
  46. Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
  47. Prognostic value of the neutrophil-to-lymphocyte ratio in acute organophosphorus pesticide poisoning
  48. Gastroprotective effects of diosgenin against HCl/ethanol-induced gastric mucosal injury through suppression of NF-κβ and myeloperoxidase activities
  49. Silencing of LINC00707 suppresses cell proliferation, migration, and invasion of osteosarcoma cells by modulating miR-338-3p/AHSA1 axis
  50. Successful extracorporeal membrane oxygenation resuscitation of patient with cardiogenic shock induced by phaeochromocytoma crisis mimicking hyperthyroidism: A case report
  51. Effects of miR-185-5p on replication of hepatitis C virus
  52. Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis
  53. Primary localized cutaneous nodular amyloidosis presenting as lymphatic malformation: A case report
  54. Multimodal magnetic resonance imaging analysis in the characteristics of Wilson’s disease: A case report and literature review
  55. Therapeutic potential of anticoagulant therapy in association with cytokine storm inhibition in severe cases of COVID-19: A case report
  56. Neoadjuvant immunotherapy combined with chemotherapy for locally advanced squamous cell lung carcinoma: A case report and literature review
  57. Rufinamide (RUF) suppresses inflammation and maintains the integrity of the blood–brain barrier during kainic acid-induced brain damage
  58. Inhibition of ADAM10 ameliorates doxorubicin-induced cardiac remodeling by suppressing N-cadherin cleavage
  59. Invasive ductal carcinoma and small lymphocytic lymphoma/chronic lymphocytic leukemia manifesting as a collision breast tumor: A case report and literature review
  60. Clonal diversity of the B cell receptor repertoire in patients with coronary in-stent restenosis and type 2 diabetes
  61. CTLA-4 promotes lymphoma progression through tumor stem cell enrichment and immunosuppression
  62. WDR74 promotes proliferation and metastasis in colorectal cancer cells through regulating the Wnt/β-catenin signaling pathway
  63. Down-regulation of IGHG1 enhances Protoporphyrin IX accumulation and inhibits hemin biosynthesis in colorectal cancer by suppressing the MEK-FECH axis
  64. Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
  65. Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway
  66. lncRNA NEAT1 regulates CYP1A2 and influences steroid-induced necrosis
  67. A two-microRNA signature predicts the progression of male thyroid cancer
  68. Isolation of microglia from retinas of chronic ocular hypertensive rats
  69. Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study
  70. Calcineurin Aβ gene knockdown inhibits transient outward potassium current ion channel remodeling in hypertrophic ventricular myocyte
  71. Aberrant expression of PI3K/AKT signaling is involved in apoptosis resistance of hepatocellular carcinoma
  72. Clinical significance of activated Wnt/β-catenin signaling in apoptosis inhibition of oral cancer
  73. circ_CHFR regulates ox-LDL-mediated cell proliferation, apoptosis, and EndoMT by miR-15a-5p/EGFR axis in human brain microvessel endothelial cells
  74. Resveratrol pretreatment mitigates LPS-induced acute lung injury by regulating conventional dendritic cells’ maturation and function
  75. Ubiquitin-conjugating enzyme E2T promotes tumor stem cell characteristics and migration of cervical cancer cells by regulating the GRP78/FAK pathway
  76. Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
  77. Protective effect of Lactobacillus-containing probiotics on intestinal mucosa of rats experiencing traumatic hemorrhagic shock
  78. Glucocorticoids induce osteonecrosis of the femoral head through the Hippo signaling pathway
  79. Endothelial cell-derived SSAO can increase MLC20 phosphorylation in VSMCs
  80. Downregulation of STOX1 is a novel prognostic biomarker for glioma patients
  81. miR-378a-3p regulates glioma cell chemosensitivity to cisplatin through IGF1R
  82. The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats
  83. TGF-β1-overexpressing mesenchymal stem cells reciprocally regulate Th17/Treg cells by regulating the expression of IFN-γ
  84. The influence of MTHFR genetic polymorphisms on methotrexate therapy in pediatric acute lymphoblastic leukemia
  85. Red blood cell distribution width-standard deviation but not red blood cell distribution width-coefficient of variation as a potential index for the diagnosis of iron-deficiency anemia in mid-pregnancy women
  86. Small cell neuroendocrine carcinoma expressing alpha fetoprotein in the endometrium
  87. Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers
  88. Molecular characterization and phylogenetic studies of Echinococcus granulosus and Taenia multiceps coenurus cysts in slaughtered sheep in Saudi Arabia
  89. ITGB5 mutation discovered in a Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
  90. ACTB and GAPDH appear at multiple SDS-PAGE positions, thus not suitable as reference genes for determining protein loading in techniques like Western blotting
  91. Facilitation of mouse skin-derived precursor growth and yield by optimizing plating density
  92. 3,4-Dihydroxyphenylethanol ameliorates lipopolysaccharide-induced septic cardiac injury in a murine model
  93. Downregulation of PITX2 inhibits the proliferation and migration of liver cancer cells and induces cell apoptosis
  94. Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B
  95. Novel predictor of the occurrence of DKA in T1DM patients without infection: A combination of neutrophil/lymphocyte ratio and white blood cells
  96. Investigation of molecular regulation mechanism under the pathophysiology of subarachnoid hemorrhage
  97. miR-25-3p protects renal tubular epithelial cells from apoptosis induced by renal IRI by targeting DKK3
  98. Bioengineering and Biotechnology
  99. Green fabrication of Co and Co3O4 nanoparticles and their biomedical applications: A review
  100. Agriculture
  101. Effects of inorganic and organic selenium sources on the growth performance of broilers in China: A meta-analysis
  102. Crop-livestock integration practices, knowledge, and attitudes among smallholder farmers: Hedging against climate change-induced shocks in semi-arid Zimbabwe
  103. Food Science and Nutrition
  104. Effect of food processing on the antioxidant activity of flavones from Polygonatum odoratum (Mill.) Druce
  105. Vitamin D and iodine status was associated with the risk and complication of type 2 diabetes mellitus in China
  106. Diversity of microbiota in Slovak summer ewes’ cheese “Bryndza”
  107. Comparison between voltammetric detection methods for abalone-flavoring liquid
  108. Composition of low-molecular-weight glutenin subunits in common wheat (Triticum aestivum L.) and their effects on the rheological properties of dough
  109. Application of culture, PCR, and PacBio sequencing for determination of microbial composition of milk from subclinical mastitis dairy cows of smallholder farms
  110. Investigating microplastics and potentially toxic elements contamination in canned Tuna, Salmon, and Sardine fishes from Taif markets, KSA
  111. From bench to bar side: Evaluating the red wine storage lesion
  112. Establishment of an iodine model for prevention of iodine-excess-induced thyroid dysfunction in pregnant women
  113. Plant Sciences
  114. Characterization of GMPP from Dendrobium huoshanense yielding GDP-D-mannose
  115. Comparative analysis of the SPL gene family in five Rosaceae species: Fragaria vesca, Malus domestica, Prunus persica, Rubus occidentalis, and Pyrus pyrifolia
  116. Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR
  117. Investigation of bioactivities of Taxus chinensis, Taxus cuspidata, and Taxus × media by gas chromatography-mass spectrometry
  118. Morphological structures and histochemistry of roots and shoots in Myricaria laxiflora (Tamaricaceae)
  119. Transcriptome analysis of resistance mechanism to potato wart disease
  120. In silico analysis of glycosyltransferase 2 family genes in duckweed (Spirodela polyrhiza) and its role in salt stress tolerance
  121. Comparative study on growth traits and ions regulation of zoysiagrasses under varied salinity treatments
  122. Role of MS1 homolog Ntms1 gene of tobacco infertility
  123. Biological characteristics and fungicide sensitivity of Pyricularia variabilis
  124. In silico/computational analysis of mevalonate pyrophosphate decarboxylase gene families in Campanulids
  125. Identification of novel drought-responsive miRNA regulatory network of drought stress response in common vetch (Vicia sativa)
  126. How photoautotrophy, photomixotrophy, and ventilation affect the stomata and fluorescence emission of pistachios rootstock?
  127. Apoplastic histochemical features of plant root walls that may facilitate ion uptake and retention
  128. Ecology and Environmental Sciences
  129. The impact of sewage sludge on the fungal communities in the rhizosphere and roots of barley and on barley yield
  130. Domestication of wild animals may provide a springboard for rapid variation of coronavirus
  131. Response of benthic invertebrate assemblages to seasonal and habitat condition in the Wewe River, Ashanti region (Ghana)
  132. Molecular record for the first authentication of Isaria cicadae from Vietnam
  133. Twig biomass allocation of Betula platyphylla in different habitats in Wudalianchi Volcano, northeast China
  134. Animal Sciences
  135. Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens
  136. Predators of the giant pine scale, Marchalina hellenica (Gennadius 1883; Hemiptera: Marchalinidae), out of its natural range in Turkey
  137. Honey in wound healing: An updated review
  138. NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block
  139. Radiotherapy for the treatment of pulmonary hydatidosis in sheep
  140. Retraction
  141. Retraction of “Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating microRNA-34a-5p/NOTCH1 signaling pathway”
  142. Special Issue on Reuse of Agro-Industrial By-Products
  143. An effect of positional isomerism of benzoic acid derivatives on antibacterial activity against Escherichia coli
  144. Special Issue on Computing and Artificial Techniques for Life Science Applications - Part II
  145. Relationship of Gensini score with retinal vessel diameter and arteriovenous ratio in senile CHD
  146. Effects of different enantiomers of amlodipine on lipid profiles and vasomotor factors in atherosclerotic rabbits
  147. Establishment of the New Zealand white rabbit animal model of fatty keratopathy associated with corneal neovascularization
  148. lncRNA MALAT1/miR-143 axis is a potential biomarker for in-stent restenosis and is involved in the multiplication of vascular smooth muscle cells
https://doi.org/10.1515/biol-2021-0087
Keywords for this article
MS1 gene; tobacco; fertility; homologous cloning
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Research progress on the mechanism of orexin in pain regulation in different brain regions
  3. Adriamycin-resistant cells are significantly less fit than adriamycin-sensitive cells in cervical cancer
  4. Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
  5. Iris metastasis of diffuse large B-cell lymphoma misdiagnosed as primary angle-closure glaucoma: A case report and review of the literature
  6. LncRNA PVT1 promotes cervical cancer progression by sponging miR-503 to upregulate ARL2 expression
  7. Two new inflammatory markers related to the CURB-65 score for disease severity in patients with community-acquired pneumonia: The hypersensitive C-reactive protein to albumin ratio and fibrinogen to albumin ratio
  8. Circ_0091579 enhances the malignancy of hepatocellular carcinoma via miR-1287/PDK2 axis
  9. Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-κB signaling pathway
  10. Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats
  11. ABCB1 polymorphism in clopidogrel-treated Montenegrin patients
  12. Metabolic profiling of fatty acids in Tripterygium wilfordii multiglucoside- and triptolide-induced liver-injured rats
  13. miR-338-3p inhibits cell growth, invasion, and EMT process in neuroblastoma through targeting MMP-2
  14. Verification of neuroprotective effects of alpha-lipoic acid on chronic neuropathic pain in a chronic constriction injury rat model
  15. Circ_WWC3 overexpression decelerates the progression of osteosarcoma by regulating miR-421/PDE7B axis
  16. Knockdown of TUG1 rescues cardiomyocyte hypertrophy through targeting the miR-497/MEF2C axis
  17. MiR-146b-3p protects against AR42J cell injury in cerulein-induced acute pancreatitis model through targeting Anxa2
  18. miR-299-3p suppresses cell progression and induces apoptosis by downregulating PAX3 in gastric cancer
  19. Diabetes and COVID-19
  20. Discovery of novel potential KIT inhibitors for the treatment of gastrointestinal stromal tumor
  21. TEAD4 is a novel independent predictor of prognosis in LGG patients with IDH mutation
  22. circTLK1 facilitates the proliferation and metastasis of renal cell carcinoma by regulating miR-495-3p/CBL axis
  23. microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury
  24. Long noncoding RNA TUG1 regulates degradation of chondrocyte extracellular matrix via miR-320c/MMP-13 axis in osteoarthritis
  25. Duodenal adenocarcinoma with skin metastasis as initial manifestation: A case report
  26. Effects of Loofah cylindrica extract on learning and memory ability, brain tissue morphology, and immune function of aging mice
  27. Recombinant Bacteroides fragilis enterotoxin-1 (rBFT-1) promotes proliferation of colorectal cancer via CCL3-related molecular pathways
  28. Blocking circ_UBR4 suppressed proliferation, migration, and cell cycle progression of human vascular smooth muscle cells in atherosclerosis
  29. Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
  30. Downregulation of circ_0037655 impedes glioma formation and metastasis via the regulation of miR-1229-3p/ITGB8 axis
  31. Vitamin D deficiency and cardiovascular risk in type 2 diabetes population
  32. Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis
  33. Mechanisms of circular RNA circ_0066147 on pancreatic cancer progression
  34. lncRNA myocardial infarction-associated transcript (MIAT) knockdown alleviates LPS-induced chondrocytes inflammatory injury via regulating miR-488-3p/sex determining region Y-related HMG-box 11 (SOX11) axis
  35. Identification of circRNA circ-CSPP1 as a potent driver of colorectal cancer by directly targeting the miR-431/LASP1 axis
  36. Hyperhomocysteinemia exacerbates ischemia-reperfusion injury-induced acute kidney injury by mediating oxidative stress, DNA damage, JNK pathway, and apoptosis
  37. Potential prognostic markers and significant lncRNA–mRNA co-expression pairs in laryngeal squamous cell carcinoma
  38. Gamma irradiation-mediated inactivation of enveloped viruses with conservation of genome integrity: Potential application for SARS-CoV-2 inactivated vaccine development
  39. ADHFE1 is a correlative factor of patient survival in cancer
  40. The association of transcription factor Prox1 with the proliferation, migration, and invasion of lung cancer
  41. Is there a relationship between the prevalence of autoimmune thyroid disease and diabetic kidney disease?
  42. Immunoregulatory function of Dictyophora echinovolvata spore polysaccharides in immunocompromised mice induced by cyclophosphamide
  43. T cell epitopes of SARS-CoV-2 spike protein and conserved surface protein of Plasmodium malariae share sequence homology
  44. Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
  45. Long noncoding RNA HULC contributes to paclitaxel resistance in ovarian cancer via miR-137/ITGB8 axis
  46. Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
  47. Prognostic value of the neutrophil-to-lymphocyte ratio in acute organophosphorus pesticide poisoning
  48. Gastroprotective effects of diosgenin against HCl/ethanol-induced gastric mucosal injury through suppression of NF-κβ and myeloperoxidase activities
  49. Silencing of LINC00707 suppresses cell proliferation, migration, and invasion of osteosarcoma cells by modulating miR-338-3p/AHSA1 axis
  50. Successful extracorporeal membrane oxygenation resuscitation of patient with cardiogenic shock induced by phaeochromocytoma crisis mimicking hyperthyroidism: A case report
  51. Effects of miR-185-5p on replication of hepatitis C virus
  52. Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis
  53. Primary localized cutaneous nodular amyloidosis presenting as lymphatic malformation: A case report
  54. Multimodal magnetic resonance imaging analysis in the characteristics of Wilson’s disease: A case report and literature review
  55. Therapeutic potential of anticoagulant therapy in association with cytokine storm inhibition in severe cases of COVID-19: A case report
  56. Neoadjuvant immunotherapy combined with chemotherapy for locally advanced squamous cell lung carcinoma: A case report and literature review
  57. Rufinamide (RUF) suppresses inflammation and maintains the integrity of the blood–brain barrier during kainic acid-induced brain damage
  58. Inhibition of ADAM10 ameliorates doxorubicin-induced cardiac remodeling by suppressing N-cadherin cleavage
  59. Invasive ductal carcinoma and small lymphocytic lymphoma/chronic lymphocytic leukemia manifesting as a collision breast tumor: A case report and literature review
  60. Clonal diversity of the B cell receptor repertoire in patients with coronary in-stent restenosis and type 2 diabetes
  61. CTLA-4 promotes lymphoma progression through tumor stem cell enrichment and immunosuppression
  62. WDR74 promotes proliferation and metastasis in colorectal cancer cells through regulating the Wnt/β-catenin signaling pathway
  63. Down-regulation of IGHG1 enhances Protoporphyrin IX accumulation and inhibits hemin biosynthesis in colorectal cancer by suppressing the MEK-FECH axis
  64. Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
  65. Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway
  66. lncRNA NEAT1 regulates CYP1A2 and influences steroid-induced necrosis
  67. A two-microRNA signature predicts the progression of male thyroid cancer
  68. Isolation of microglia from retinas of chronic ocular hypertensive rats
  69. Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study
  70. Calcineurin Aβ gene knockdown inhibits transient outward potassium current ion channel remodeling in hypertrophic ventricular myocyte
  71. Aberrant expression of PI3K/AKT signaling is involved in apoptosis resistance of hepatocellular carcinoma
  72. Clinical significance of activated Wnt/β-catenin signaling in apoptosis inhibition of oral cancer
  73. circ_CHFR regulates ox-LDL-mediated cell proliferation, apoptosis, and EndoMT by miR-15a-5p/EGFR axis in human brain microvessel endothelial cells
  74. Resveratrol pretreatment mitigates LPS-induced acute lung injury by regulating conventional dendritic cells’ maturation and function
  75. Ubiquitin-conjugating enzyme E2T promotes tumor stem cell characteristics and migration of cervical cancer cells by regulating the GRP78/FAK pathway
  76. Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
  77. Protective effect of Lactobacillus-containing probiotics on intestinal mucosa of rats experiencing traumatic hemorrhagic shock
  78. Glucocorticoids induce osteonecrosis of the femoral head through the Hippo signaling pathway
  79. Endothelial cell-derived SSAO can increase MLC20 phosphorylation in VSMCs
  80. Downregulation of STOX1 is a novel prognostic biomarker for glioma patients
  81. miR-378a-3p regulates glioma cell chemosensitivity to cisplatin through IGF1R
  82. The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats
  83. TGF-β1-overexpressing mesenchymal stem cells reciprocally regulate Th17/Treg cells by regulating the expression of IFN-γ
  84. The influence of MTHFR genetic polymorphisms on methotrexate therapy in pediatric acute lymphoblastic leukemia
  85. Red blood cell distribution width-standard deviation but not red blood cell distribution width-coefficient of variation as a potential index for the diagnosis of iron-deficiency anemia in mid-pregnancy women
  86. Small cell neuroendocrine carcinoma expressing alpha fetoprotein in the endometrium
  87. Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers
  88. Molecular characterization and phylogenetic studies of Echinococcus granulosus and Taenia multiceps coenurus cysts in slaughtered sheep in Saudi Arabia
  89. ITGB5 mutation discovered in a Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
  90. ACTB and GAPDH appear at multiple SDS-PAGE positions, thus not suitable as reference genes for determining protein loading in techniques like Western blotting
  91. Facilitation of mouse skin-derived precursor growth and yield by optimizing plating density
  92. 3,4-Dihydroxyphenylethanol ameliorates lipopolysaccharide-induced septic cardiac injury in a murine model
  93. Downregulation of PITX2 inhibits the proliferation and migration of liver cancer cells and induces cell apoptosis
  94. Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B
  95. Novel predictor of the occurrence of DKA in T1DM patients without infection: A combination of neutrophil/lymphocyte ratio and white blood cells
  96. Investigation of molecular regulation mechanism under the pathophysiology of subarachnoid hemorrhage
  97. miR-25-3p protects renal tubular epithelial cells from apoptosis induced by renal IRI by targeting DKK3
  98. Bioengineering and Biotechnology
  99. Green fabrication of Co and Co3O4 nanoparticles and their biomedical applications: A review
  100. Agriculture
  101. Effects of inorganic and organic selenium sources on the growth performance of broilers in China: A meta-analysis
  102. Crop-livestock integration practices, knowledge, and attitudes among smallholder farmers: Hedging against climate change-induced shocks in semi-arid Zimbabwe
  103. Food Science and Nutrition
  104. Effect of food processing on the antioxidant activity of flavones from Polygonatum odoratum (Mill.) Druce
  105. Vitamin D and iodine status was associated with the risk and complication of type 2 diabetes mellitus in China
  106. Diversity of microbiota in Slovak summer ewes’ cheese “Bryndza”
  107. Comparison between voltammetric detection methods for abalone-flavoring liquid
  108. Composition of low-molecular-weight glutenin subunits in common wheat (Triticum aestivum L.) and their effects on the rheological properties of dough
  109. Application of culture, PCR, and PacBio sequencing for determination of microbial composition of milk from subclinical mastitis dairy cows of smallholder farms
  110. Investigating microplastics and potentially toxic elements contamination in canned Tuna, Salmon, and Sardine fishes from Taif markets, KSA
  111. From bench to bar side: Evaluating the red wine storage lesion
  112. Establishment of an iodine model for prevention of iodine-excess-induced thyroid dysfunction in pregnant women
  113. Plant Sciences
  114. Characterization of GMPP from Dendrobium huoshanense yielding GDP-D-mannose
  115. Comparative analysis of the SPL gene family in five Rosaceae species: Fragaria vesca, Malus domestica, Prunus persica, Rubus occidentalis, and Pyrus pyrifolia
  116. Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR
  117. Investigation of bioactivities of Taxus chinensis, Taxus cuspidata, and Taxus × media by gas chromatography-mass spectrometry
  118. Morphological structures and histochemistry of roots and shoots in Myricaria laxiflora (Tamaricaceae)
  119. Transcriptome analysis of resistance mechanism to potato wart disease
  120. In silico analysis of glycosyltransferase 2 family genes in duckweed (Spirodela polyrhiza) and its role in salt stress tolerance
  121. Comparative study on growth traits and ions regulation of zoysiagrasses under varied salinity treatments
  122. Role of MS1 homolog Ntms1 gene of tobacco infertility
  123. Biological characteristics and fungicide sensitivity of Pyricularia variabilis
  124. In silico/computational analysis of mevalonate pyrophosphate decarboxylase gene families in Campanulids
  125. Identification of novel drought-responsive miRNA regulatory network of drought stress response in common vetch (Vicia sativa)
  126. How photoautotrophy, photomixotrophy, and ventilation affect the stomata and fluorescence emission of pistachios rootstock?
  127. Apoplastic histochemical features of plant root walls that may facilitate ion uptake and retention
  128. Ecology and Environmental Sciences
  129. The impact of sewage sludge on the fungal communities in the rhizosphere and roots of barley and on barley yield
  130. Domestication of wild animals may provide a springboard for rapid variation of coronavirus
  131. Response of benthic invertebrate assemblages to seasonal and habitat condition in the Wewe River, Ashanti region (Ghana)
  132. Molecular record for the first authentication of Isaria cicadae from Vietnam
  133. Twig biomass allocation of Betula platyphylla in different habitats in Wudalianchi Volcano, northeast China
  134. Animal Sciences
  135. Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens
  136. Predators of the giant pine scale, Marchalina hellenica (Gennadius 1883; Hemiptera: Marchalinidae), out of its natural range in Turkey
  137. Honey in wound healing: An updated review
  138. NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block
  139. Radiotherapy for the treatment of pulmonary hydatidosis in sheep
  140. Retraction
  141. Retraction of “Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating microRNA-34a-5p/NOTCH1 signaling pathway”
  142. Special Issue on Reuse of Agro-Industrial By-Products
  143. An effect of positional isomerism of benzoic acid derivatives on antibacterial activity against Escherichia coli
  144. Special Issue on Computing and Artificial Techniques for Life Science Applications - Part II
  145. Relationship of Gensini score with retinal vessel diameter and arteriovenous ratio in senile CHD
  146. Effects of different enantiomers of amlodipine on lipid profiles and vasomotor factors in atherosclerotic rabbits
  147. Establishment of the New Zealand white rabbit animal model of fatty keratopathy associated with corneal neovascularization
  148. lncRNA MALAT1/miR-143 axis is a potential biomarker for in-stent restenosis and is involved in the multiplication of vascular smooth muscle cells
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Winner of the OpenAthens UX Award 2026
Winner of the OpenAthens UX Award 2026
Have an idea on how to improve our website?
Please write us.
© 2026 De Gruyter Brill
Downloaded on 11.3.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2021-0087/html
Scroll to top button