Abstract
Hydatidosis is an endemic disease causing a severe threat to public health. Drugs and surgery have been utilized for treatment, but their efficiency is not adequate. Therefore, new methods are required for treating such diseases. In this study, we attempt to evaluate the efficiency of radiotherapy for hydatidosis in sheep. The sheep naturally infected with pulmonary hydatid were randomly divided into four groups, including the control group subjected to no irradiation and the other three groups subjected to 30, 45, and 60 Gy irradiation, respectively. Gene expression of caspase-3 and gadd45a and protein expression of BCL-2 and BAX in the lung tissues were evaluated after treatment. Our data showed that the irradiation with a dose of 30, 45, and 60 Gy significantly induced the expression of caspase-3 and gadd45a. Immunohistochemical staining showed that the BCL-2 protein was downregulated after exposure to 45 Gy of irradiation, whereas the BAX expression was downregulated after irradiation at a dose of 45 and 60 Gy, respectively. On this basis, we speculated that 45 Gy might be a safe and effective dose for treating pulmonary hydatidosis in sheep, which induced lower expression of caspase-3 and gadd45a in the cyst and a downregulation of BCL-2 and BAX in the adjacent lung tissues.
1 Introduction
Hydatidosis is an endemic disease in many countries, including South America, New Zealand, Canada, as well as Western China. At the adult stage, the Echinococcus granulosus lives in the intestine of carnivores, and the eggs are discarded in their feces. The eggs can survive for at least 1 year and could be infectious upon ingesting by an intermediate host such as sheep, goats, horses, or pigs, which finally grow into larvae within the bodies of these animals [1].
Lung is one of the most frequently involved organs by E. granulosus with an incidence of 10–40%, followed by the liver [2]. Patients newly infected by E. granulosus usually show small cysts and generally have no obvious symptoms. They are diagnosed occasionally during physical examination or chest X-ray scans. With the disease progression, some patients may present cough, sputum, chest pain, and hemoptysis combined with the enlargement of the cyst, causing compression, or inflammation [3].
The diagnosis of hydatidosis is mainly based on ultrasonography, X-rays, magnetic resonance imaging, and computed tomography (CT), as well as immunodiagnostic tests [4]. For the treatment of hydatidosis, patients are recommended to undergo surgery, chemotherapy, or observation. In a multicenter clinical study coordinated by the World Health Organization, benzimidazoles (BZD) such as albendazole and mebendazole are considered to be effective for treating hydatidosis [5]. To date, BZD and praziquantel are the major agents for antihydatid therapy. However, the response rates after administration of these agents are still not good due to a low blood drug concentration. In addition, there might be a high possibility of pulmonary hydatid rupture after chemotherapy [6]. It has been well acknowledged that surgery is still the main therapeutic approach for treating hydatidosis [7,8]. Nonetheless, many patients present recurrence after treatment.
Recently, our team has focused on the treatment of pulmonary hydatid infection using radiotherapy [9]. Our earlier studies indicated that radiotherapy contributed to the improvement of symptoms in those infected by pulmonary hydatid [10,11,12,13]. To date, there is still a lack of studies focusing on the molecular mechanisms of improvement of hydatidosis conditions after radiotherapy. In this study, we determined the gene expression of caspase-3 and gadd45a that were tightly associated with apoptosis and cell death. Also, we determined the expression of BCL-2 and BAX serving as two important proteins involved in cell death and necrosis [14].
2 Materials and methods
2.1 Animals and study design
Twenty female sheep (3–5 years; body weight, 45 ± 10 kg) naturally infected with pulmonary hydatid confirmed by ultrasonography obtained from pastoral areas of Xinjiang autonomous region were reared in the experimental animal center of our hospital. The animals were fed in a temperature of 18–22°C and relative humidity of 40–60%. After CT confirmation, the animals were kept in the animal room for 1 week. All animals used in this study were euthanized using pentobarbital (85.8 mg/kg) and phenytoin (11 mg/kg) through intravenous injection. Death was declared with the presence of apnea and absence of audible heartbeat or corneal reflex as previously described [15].
Twenty sheep were randomly divided into the following groups: (i–iii) irradiation groups, subject to irradiation of 30 Gy (n = 5), 45 Gy (n = 5), and 60 Gy (n = 5), respectively, and (iv) control group received the same treatment except for irradiation.
-
Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals. All study protocols were performed in line with the Ethics Committee of the First Affiliated Hospital of Xinjiang Medical University (approval No. IACUC-2014021002).
2.2 CT scan
After anesthesia, the sheep were fixed on an operating table using a thermoplastic membrane. Then CT scan was given using Big Bore Helical CT scanner (general electric). An experienced radiologist was responsible for depicting the irradiation area, and then the radiotherapy was performed by a professional radiotherapist. The radiotherapy was divided into three fractions with an interval of 2 days, and the predetermined dose was reached within 7 days. After radiotherapy, the cysts and the lung tissues adjacent to the endocyst were collected by biopsy for further detection.
2.3 Reverse-transcription quantitative PCR
Total RNA from endocyst was isolated using TRIzol (Takara Biotech, Dalian, China). The mRNA was reverse transcribed into cDNA by using a reverse transcriptase kit (Vazyme, China) according to the manufacturer’s protocols. Reverse transcript quantitative PCR (RT-qPCR) was performed on an Eppendorf MasterCycler platform (Wesseling-Berzdorf, Germany) using the SYBR Green system (Vazyme, China), and the gene transcription was normalized by β-actin. The relative expression level of each gene was calculated according to 2−ΔΔCt method. The primers are listed in Table 1.
Primers for RT-qPCR
Name | Sequence (5′–3′) |
---|---|
GADD45A F | TCGCTACATGGATCAGTGGG |
GADD45A R | GTTGAACTCACTCAGCCCCT |
caspase3 F | ATCCAGTCTTCCCTCCTT |
caspase3 R | AGCACCGTTGTTTAGCAC |
β-actin-F | CGCAAGTACTCCGTGTGGAT |
β-actin-R | TAACGCAGCTAACAGTCCGC |
2.4 Immunohistochemical analysis of lung tissue
The slices were deparaffinized with xylene and hydrated through a graded ethanol series (95, 90, 80, 70%, and pure water). After blocking with endogenous peroxidase, antigen retrieval was performed with sodium citrate. The sections were incubated with primary anti-Bax (1:50, Category No.: A7626, Bioss, China) and anti-BCL-2 antibody (1:400, Category No.: MG53719-CH, Bioss, China) at 4°C for overnight. Then the sections were incubated with an horseradish peroxidases-conjugated secondary antibody for 20 min at room temperature. After washing with phosphate buffer saline, the sections were incubated with 3,3′-diaminobenzidine, counterstained with hematoxylin, and promoted blue with blue liquid, followed by dehydration. Finally, the sections were cover-slipped with neutral plastic and observed under a microscope.
2.5 Statistical analysis
Data analysis was performed by one-way analysis of variance followed by Tukey’s multiple comparison tests using a GraphPad Prism 7 software (GraphPad Corporation). A P value of <0.05 was considered to be statistically significant.
3 Result
3.1 Conditions of hydatid cyst
The hydatid cysts in the lung tissues of sheep were multiple cysts of various sizes. The majority of lung tissues showed the presence of protoscoleces in the cysts (Figure 1). After radiation, the size showed a decline to some extent.

Morphology of cyst in the lung tissues in (a) control group and (b) radiation group.
3.2 Irradiation induced the expression of caspase-3 and gadd45a in the hydatid cyst
To investigate the effects of irradiation on hydatid cysts, the expression levels of two key genes (caspase-3 and gadd45a) involved in apoptosis and cell death were evaluated using RT-qPCR. The relative expression of gadd45a mRNA in the 30 Gy group was about 2.4-fold higher than in the control group. In addition, the expression of gadd45a mRNA in the 45 and 60 Gy groups was about 2.1–2.2 fold higher than that of the control group (Figure 2). For the expression of Caspase-3 mRNA, its expression in the 30 Gy group was nearly 3.0-fold compared with that of the control, whereas the expression of Caspase-3 mRNA in 45 and 60 Gy groups was 2.0-fold and 2.2-fold compared with that of the control group (Figure 2). All these indicated that irradiation caused apoptosis and necrosis in cystic cells.

Effect of irradiation on the expression of caspase-3 and gadd45a. The mRNA level of gadd45a and caspase-3 was evaluated by using RT-qPCR (n = 5 in each group). The presented values are the means ± standard error mean. *P < 0.05, compared with control group.
3.3 Irradiation reduced the expression of BCL-2 and BAX in lung tissue involved by the cyst
With the continuous growth of E. granulosus, the surrounding organs and tissues were compressed, resulting in cell death and tissue atrophy or necrosis, as well as final dysfunction [16]. In the present study, we detected the expression levels of BCL-2 and BAX in the lung tissue using immunohistochemistry, which showed no significant difference in the expression of BCL-2 after exposure to irradiation with a dose of 30 and 60 Gy, respectively. In contrast, the expression level of BCL-2 was significantly downregulated after exposure to a dose of 45 Gy (Figure 3). This indicated recovery from cell death induced by the cyst. BAX expression was significantly downregulated in the cyst after exposure to a dose of 45 and 60 Gy, rather than that of 30 Gy (Figure 4), indicating 45 and 60 Gy of irradiation reversed the cell death induced by the cyst.

Effects of irradiation on the expression of BCL-2. The protein level of BCL-2 was detected by using immunohistochemistry under a magnification of 40×, 100×, 200×, and 400×, respectively.

Effects of irradiation on the expression of BAX. The protein level of BAX was detected by using immunohistochemistry under a magnification of 40×, 100×, 200×, and 400×, respectively.
4 Discussion
Hydatid disease is a serious zoonosis caused by Echinococcus hydatid parasitism in animal hosts, with a strong infectious potency to human individuals [17]. Hydatid disease has been considered to be an epidemic in the world. In recent years, extensive studies have been conducted to investigate the ecology and biological features of hydatid disease, and a comprehensive prevention system has been established [18,19,20]. This, to some extent, greatly promotes clinical diagnosis and treatment [21].
The progression of hydatid disease is prolonged, and some patients are asymptomatic for several years. The larva of hydatid acts as tumors that are slowly growing and gradually invading the organ. The severity of the disease may be closely related to the marked fibrosis of the tissue around the cysts. Due to hematogenous spread, it will gradually extend to the adjacent tissues and distant organs [22]. To date, the treatment of hydatid disease is still mainly reliant on the surgery and administration of agents (e.g., BZD). Recently, few studies have been available to focus on utilizing irradiation for treating such disease. In an earlier study, Zhao et al. indicated that heavy-ion radiation could induce the extinction of hydatid cysts in vitro [23]. However, rarely studies have been focused on the roles of radiation in hydatid disease under in vivo conditions [24].
The caspase family is a key element in the process of cell apoptosis. Its activation and overexpression could regulate cell apoptosis through interacting with multiple protein factors [25]. Caspase-3 is the main effector in the process of apoptosis [26]. At present, a large number of patients may present recurrence after surgery, administration of drugs, and other methods. To our best knowledge, irradiation can effectively kill the hydatid, causing relatively low injuries to normal tissues, which may serve as a safe and effective option for treating hydatidosis. In this study, we investigated the efficacy of radiation therapy for hydatidosis through detecting the apoptosis and cell death-related genes and proteins in the cyst and the adjacent lung tissue, respectively. Our data showed that irradiation could significantly induce the expression of caspase-3 and gadd45a, serving as two important genes involved in apoptosis and cell death. This indicated that the irradiation could effectively kill the hydatid in the lung tissues of sheep.
The immunohistochemical staining showed that 30 Gy irradiation triggered no reduction in the expression of BCL-2 and BAX. However, a dose of 45 Gy significantly suppressed the expression of BCL-2 and BAX in the lung tissues involved by the cyst, suggesting beneficial effects on the host. Interestingly, 60 Gy irradiation did not reduce the protein level of BCL-2. This may be related to the fact that excessive irradiation causes injuries to the lung tissue, which indicates that the irradiation dose should be within the tolerance of normal tissues. Irradiation significantly enhanced the protein expression of BAX and BCL-2. This indicated that the killing effects of radiation on the hydatid disease were associated with the activation of the apoptosis pathway. Similarly, in an earlier study, irradiation could induce cell death by facilitating apoptosis [27].
There are limited reports about the treatment of hydatidosis based on irradiation, as most of the studies were carried out under in vitro conditions [28]. This is the first study to report the treatment of pulmonary hydatidosis in sheep by using irradiation, and we hope this may provide some insight for the clinical treatment. However, there are some limitations to this study. We only investigated the efficiency of radiation on treating hydatidosis through determining the expression of apoptosis-related markers. Little is known about the potential mechanism in it. Besides, the sample size is not large due to difficulty in sampling.
Three irradiation doses were used in this experiment, and the results showed that 45 Gy might be safe and effective for treating pulmonary hydatidosis in sheep. This was supported by an induction of caspase-3 and gadd45a expression in the cyst and a downregulation of BCL-2 and BAX in the adjacent lung tissues.
-
Funding information: This study was supported by the National Natural Science Foundation (No. 81860556 and 81860360) and the State Key Laboratory and the High Incidence Disease of Central Asia (SKL-HIDCA-2019-29).
-
Author contribution: Z.Y.F. and L.P.F. wrote the manuscript, M.R. and B.Y.X. revised the manuscript, Q.H.Z. did the data analysis, and W.G. did the data collection. The authors read and approved the final manuscript.
-
Conflict of interest: The authors state no conflict of interest.
-
Data availability statements: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
[1] Santivanez S, Garcia HH. Pulmonary cystic echinococcosis. Curr Opin Pulm Med. 2010;16(3):257–61.10.1097/MCP.0b013e3283386282Search in Google Scholar PubMed PubMed Central
[2] Lashkarizadeh MR, Hooshmand N, Nasibi S, Mohammadi MA, Shamsaddini S, Kamyabi H, et al. Genetic profile of hydatid cysts in patients with multi-organ involvement: mixed infections by different strains. Vector Borne Zoonotic Dis. 2019;19(10):724–30.10.1089/vbz.2018.2427Search in Google Scholar PubMed
[3] Butt A, Khan JA. Cystic echinococcosis: a 10-year experience from a middle-income country. Trop Doct. 2020;50(2):117–21.10.1177/0049475519891338Search in Google Scholar PubMed
[4] Turgut AT, Altinok T, Topçu S, Koşar U. Local complications of hydatid disease involving thoracic cavity: imaging findings. Eur J Radiol. 2009;70(1):49–56.10.1016/j.ejrad.2008.01.002Search in Google Scholar PubMed
[5] Bartels M, Schmidt T, Lübbert C. Successful surgical management of hepatic alveolar echinococcosis by inductive therapy with albendazole – a case report. Z Gastroenterol. 2020;58(1):63–7.10.1055/a-1039-1755Search in Google Scholar PubMed
[6] Hasdıraz L, Onal O, Oguzkaya F. Bilateral staged thoracotomy for multiple lung hydatidosis. J Cardiothorac Surg. 2013;8:121.10.1186/1749-8090-8-121Search in Google Scholar PubMed PubMed Central
[7] Brunetti E, Kern P, Vuitton DA. Expert consensus for the diagnosis and treatment of cystic and alveolar echinococcosis in humans. Acta Trop. 2010;114(1):1–16.10.1016/j.actatropica.2009.11.001Search in Google Scholar PubMed
[8] Tatar D, Senol G, Gunes E, Unsal S, Perim G. Diagnosis and treatment of pulmonary cystic hydatidosis. Indian J Pediatr. 2008;75(10):1003–7.10.1007/s12098-008-0165-8Search in Google Scholar PubMed
[9] Rui M, Ge W, Hui W, Lu P, Zhang W. Effects of X-ray on the metacestodes of Echinococcus granulosus in vitro. BMC Infect Dis. 2017;17(1):636.10.1186/s12879-017-2741-xSearch in Google Scholar PubMed PubMed Central
[10] Deng C, Li J, Li L, Sun F, Xie J. Effects of hypoxia ischemia on caspase-3 expression and neuronal apoptosis in the brain of neonatal mice. Exp Ther Med. 2019;17(6):4517–21.10.3892/etm.2019.7487Search in Google Scholar PubMed PubMed Central
[11] Liu PF, Hu YC, Kang BH, Tseng YK, Wu PC, Liang CC, et al. Expression levels of cleaved caspase-3 and caspase-3 in tumorigenesis and prognosis of oral tongue squamous cell carcinoma. PLoS One. 2017;12(7):e0180620.10.1371/journal.pone.0180620Search in Google Scholar PubMed PubMed Central
[12] Liu J, Jiang G, Mao P, Zhang J, Zhang L, Liu L, et al. Down-regulation of GADD45A enhances chemosensitivity in melanoma. Sci Rep. 2018;8(1):4111.10.1038/s41598-018-22484-6Search in Google Scholar PubMed PubMed Central
[13] Li FH, Han N, Wang Y, Xu Q. Gadd45a knockdown alleviates oxidative stress through suppressing the p38 MAPK signaling pathway in the pathogenesis of preeclampsia. Placenta. 2018;65:20–8.10.1016/j.placenta.2018.03.007Search in Google Scholar PubMed
[14] Dong D, Dong Y, Fu J, Lu S, Yuan C, Xia M, et al. Bcl2 inhibitor ABT737 reverses the Warburg effect via the Sirt3-HIF1α axis to promote oxidative stress-induced apoptosis in ovarian cancer cells. Life Sci. 2020;255:117846.10.1016/j.lfs.2020.117846Search in Google Scholar PubMed
[15] Barletta M, Hofmeister EH, Peroni JF, Thoresen M, Scharf AM, Quandt JE. Influence of sedation on onset and quality of euthanasia in sheep. Res Vet Sci. 2018;117:57–9.10.1016/j.rvsc.2017.11.012Search in Google Scholar PubMed
[16] Lamonaca V, Virga A, Minervini MI, Di Stefano R, Provenzani A, Tagliareni P, et al. Cystic echinococcosis of the liver and lung treated by radiofrequency thermal ablation: an ex-vivo pilot experimental study in animal models. World J Gastroenterol. 2009;15(26):3232–9.10.3748/wjg.15.3232Search in Google Scholar PubMed PubMed Central
[17] Kotoulas S, Grapatsas K, Leivaditis V, Panagiotou I, Spiridakis E, Le UT, et al. Massive pulmonary embolism due to hydatid cysts: a rare postoperative complication of liver echinococcosis. Respir Med Case Rep. 2020;30:101054.10.1016/j.rmcr.2020.101054Search in Google Scholar PubMed PubMed Central
[18] Padayachy LC, Dattatraya M. Hydatid disease (Echinococcus) of the central nervous system. Childs Nerv Syst. 2018;34(10):1967–71.10.1007/s00381-018-3883-xSearch in Google Scholar PubMed
[19] Khuroo MS. Hydatid disease. Indian J Gastroenterol. 2001;20(Suppl 1):C39–43.Search in Google Scholar
[20] Araj GF, Mourad Y. Hydatid disease: the Lebanese contribution. J Med Liban. 2014;62(4):217–26.10.12816/0008291Search in Google Scholar PubMed
[21] Falagas ME, Bliziotis IA. Albendazole for the treatment of human echinococcosis: a review of comparative clinical trials. Am J Med Sci. 2007;334(3):171–9.10.1097/MAJ.0b013e31814252f8Search in Google Scholar PubMed
[22] Bresson-Hadni S, Miguet JP, Mantion G, Giraudoux P, Vuitton DA. Alveolar echinococcosis: a disease comparable to a slow growing cancer. Bull Acad Natl Med. 2008;192(6):1131–8. Discussion 9.10.1016/S0001-4079(19)32712-8Search in Google Scholar
[23] Zhao Y, Gui W, Zhang Y, Mo G, Li D, Chong S. Inhibitory effect of ionizing radiation on echinococcus granulosus hydatid cyst. Diseases. 2019;7(1):23.10.3390/diseases7010023Search in Google Scholar PubMed PubMed Central
[24] Ma C, Luo X, Mahan W, Tang Y, Xie Z. Outcomes of radiotherapy for osseous echinococcosis of meriones meridianus. BioMed Res Int. 2020;2020(7):1–8.10.1155/2020/6457419Search in Google Scholar PubMed PubMed Central
[25] Aljuhani N, Ismail RS, El-Awady MS, Hassan MH. Modulatory effects of perindopril on cisplatin-induced nephrotoxicity in mice: Implication of inflammatory cytokines and caspase-3 mediated apoptosis. Acta Pharm. 2020;70(4):515–25.10.2478/acph-2020-0033Search in Google Scholar PubMed
[26] Fan R, Wang H, Zhang L, Ma T, Tian Y, Li H. Nanocrystallized oleanolic acid better inhibits proliferation, migration and invasion in intracranial glioma via Caspase-3 pathway. J Cancer. 2020;11(7):1949–58.10.7150/jca.38847Search in Google Scholar PubMed PubMed Central
[27] Teraoka S, Kakei Y, Akashi M, Iwata E, Hasegawa T, Miyawaki D, et al. Gold nanoparticles enhance X-ray irradiation-induced apoptosis in head and neck squamous cell carcinoma in vitro. Biomed Rep. 2018;9(5):415–20.10.3892/br.2018.1142Search in Google Scholar PubMed PubMed Central
[28] Zhang YF, Xie ZR, Ni YQ, Mao R, Qi HZ, Yang YG, et al. Curative effect of radiotherapy at various doses on subcutaneous alveolar echinococcosis in rats. Chin Med J (Engl). 2011;124(18):2845–8.Search in Google Scholar
© 2021 Yuefen Zhang et al., published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Biomedical Sciences
- Research progress on the mechanism of orexin in pain regulation in different brain regions
- Adriamycin-resistant cells are significantly less fit than adriamycin-sensitive cells in cervical cancer
- Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
- Iris metastasis of diffuse large B-cell lymphoma misdiagnosed as primary angle-closure glaucoma: A case report and review of the literature
- LncRNA PVT1 promotes cervical cancer progression by sponging miR-503 to upregulate ARL2 expression
- Two new inflammatory markers related to the CURB-65 score for disease severity in patients with community-acquired pneumonia: The hypersensitive C-reactive protein to albumin ratio and fibrinogen to albumin ratio
- Circ_0091579 enhances the malignancy of hepatocellular carcinoma via miR-1287/PDK2 axis
- Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-κB signaling pathway
- Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats
- ABCB1 polymorphism in clopidogrel-treated Montenegrin patients
- Metabolic profiling of fatty acids in Tripterygium wilfordii multiglucoside- and triptolide-induced liver-injured rats
- miR-338-3p inhibits cell growth, invasion, and EMT process in neuroblastoma through targeting MMP-2
- Verification of neuroprotective effects of alpha-lipoic acid on chronic neuropathic pain in a chronic constriction injury rat model
- Circ_WWC3 overexpression decelerates the progression of osteosarcoma by regulating miR-421/PDE7B axis
- Knockdown of TUG1 rescues cardiomyocyte hypertrophy through targeting the miR-497/MEF2C axis
- MiR-146b-3p protects against AR42J cell injury in cerulein-induced acute pancreatitis model through targeting Anxa2
- miR-299-3p suppresses cell progression and induces apoptosis by downregulating PAX3 in gastric cancer
- Diabetes and COVID-19
- Discovery of novel potential KIT inhibitors for the treatment of gastrointestinal stromal tumor
- TEAD4 is a novel independent predictor of prognosis in LGG patients with IDH mutation
- circTLK1 facilitates the proliferation and metastasis of renal cell carcinoma by regulating miR-495-3p/CBL axis
- microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury
- Long noncoding RNA TUG1 regulates degradation of chondrocyte extracellular matrix via miR-320c/MMP-13 axis in osteoarthritis
- Duodenal adenocarcinoma with skin metastasis as initial manifestation: A case report
- Effects of Loofah cylindrica extract on learning and memory ability, brain tissue morphology, and immune function of aging mice
- Recombinant Bacteroides fragilis enterotoxin-1 (rBFT-1) promotes proliferation of colorectal cancer via CCL3-related molecular pathways
- Blocking circ_UBR4 suppressed proliferation, migration, and cell cycle progression of human vascular smooth muscle cells in atherosclerosis
- Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
- Downregulation of circ_0037655 impedes glioma formation and metastasis via the regulation of miR-1229-3p/ITGB8 axis
- Vitamin D deficiency and cardiovascular risk in type 2 diabetes population
- Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis
- Mechanisms of circular RNA circ_0066147 on pancreatic cancer progression
- lncRNA myocardial infarction-associated transcript (MIAT) knockdown alleviates LPS-induced chondrocytes inflammatory injury via regulating miR-488-3p/sex determining region Y-related HMG-box 11 (SOX11) axis
- Identification of circRNA circ-CSPP1 as a potent driver of colorectal cancer by directly targeting the miR-431/LASP1 axis
- Hyperhomocysteinemia exacerbates ischemia-reperfusion injury-induced acute kidney injury by mediating oxidative stress, DNA damage, JNK pathway, and apoptosis
- Potential prognostic markers and significant lncRNA–mRNA co-expression pairs in laryngeal squamous cell carcinoma
- Gamma irradiation-mediated inactivation of enveloped viruses with conservation of genome integrity: Potential application for SARS-CoV-2 inactivated vaccine development
- ADHFE1 is a correlative factor of patient survival in cancer
- The association of transcription factor Prox1 with the proliferation, migration, and invasion of lung cancer
- Is there a relationship between the prevalence of autoimmune thyroid disease and diabetic kidney disease?
- Immunoregulatory function of Dictyophora echinovolvata spore polysaccharides in immunocompromised mice induced by cyclophosphamide
- T cell epitopes of SARS-CoV-2 spike protein and conserved surface protein of Plasmodium malariae share sequence homology
- Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
- Long noncoding RNA HULC contributes to paclitaxel resistance in ovarian cancer via miR-137/ITGB8 axis
- Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
- Prognostic value of the neutrophil-to-lymphocyte ratio in acute organophosphorus pesticide poisoning
- Gastroprotective effects of diosgenin against HCl/ethanol-induced gastric mucosal injury through suppression of NF-κβ and myeloperoxidase activities
- Silencing of LINC00707 suppresses cell proliferation, migration, and invasion of osteosarcoma cells by modulating miR-338-3p/AHSA1 axis
- Successful extracorporeal membrane oxygenation resuscitation of patient with cardiogenic shock induced by phaeochromocytoma crisis mimicking hyperthyroidism: A case report
- Effects of miR-185-5p on replication of hepatitis C virus
- Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis
- Primary localized cutaneous nodular amyloidosis presenting as lymphatic malformation: A case report
- Multimodal magnetic resonance imaging analysis in the characteristics of Wilson’s disease: A case report and literature review
- Therapeutic potential of anticoagulant therapy in association with cytokine storm inhibition in severe cases of COVID-19: A case report
- Neoadjuvant immunotherapy combined with chemotherapy for locally advanced squamous cell lung carcinoma: A case report and literature review
- Rufinamide (RUF) suppresses inflammation and maintains the integrity of the blood–brain barrier during kainic acid-induced brain damage
- Inhibition of ADAM10 ameliorates doxorubicin-induced cardiac remodeling by suppressing N-cadherin cleavage
- Invasive ductal carcinoma and small lymphocytic lymphoma/chronic lymphocytic leukemia manifesting as a collision breast tumor: A case report and literature review
- Clonal diversity of the B cell receptor repertoire in patients with coronary in-stent restenosis and type 2 diabetes
- CTLA-4 promotes lymphoma progression through tumor stem cell enrichment and immunosuppression
- WDR74 promotes proliferation and metastasis in colorectal cancer cells through regulating the Wnt/β-catenin signaling pathway
- Down-regulation of IGHG1 enhances Protoporphyrin IX accumulation and inhibits hemin biosynthesis in colorectal cancer by suppressing the MEK-FECH axis
- Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
- Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway
- lncRNA NEAT1 regulates CYP1A2 and influences steroid-induced necrosis
- A two-microRNA signature predicts the progression of male thyroid cancer
- Isolation of microglia from retinas of chronic ocular hypertensive rats
- Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study
- Calcineurin Aβ gene knockdown inhibits transient outward potassium current ion channel remodeling in hypertrophic ventricular myocyte
- Aberrant expression of PI3K/AKT signaling is involved in apoptosis resistance of hepatocellular carcinoma
- Clinical significance of activated Wnt/β-catenin signaling in apoptosis inhibition of oral cancer
- circ_CHFR regulates ox-LDL-mediated cell proliferation, apoptosis, and EndoMT by miR-15a-5p/EGFR axis in human brain microvessel endothelial cells
- Resveratrol pretreatment mitigates LPS-induced acute lung injury by regulating conventional dendritic cells’ maturation and function
- Ubiquitin-conjugating enzyme E2T promotes tumor stem cell characteristics and migration of cervical cancer cells by regulating the GRP78/FAK pathway
- Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
- Protective effect of Lactobacillus-containing probiotics on intestinal mucosa of rats experiencing traumatic hemorrhagic shock
- Glucocorticoids induce osteonecrosis of the femoral head through the Hippo signaling pathway
- Endothelial cell-derived SSAO can increase MLC20 phosphorylation in VSMCs
- Downregulation of STOX1 is a novel prognostic biomarker for glioma patients
- miR-378a-3p regulates glioma cell chemosensitivity to cisplatin through IGF1R
- The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats
- TGF-β1-overexpressing mesenchymal stem cells reciprocally regulate Th17/Treg cells by regulating the expression of IFN-γ
- The influence of MTHFR genetic polymorphisms on methotrexate therapy in pediatric acute lymphoblastic leukemia
- Red blood cell distribution width-standard deviation but not red blood cell distribution width-coefficient of variation as a potential index for the diagnosis of iron-deficiency anemia in mid-pregnancy women
- Small cell neuroendocrine carcinoma expressing alpha fetoprotein in the endometrium
- Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers
- Molecular characterization and phylogenetic studies of Echinococcus granulosus and Taenia multiceps coenurus cysts in slaughtered sheep in Saudi Arabia
- ITGB5 mutation discovered in a Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
- ACTB and GAPDH appear at multiple SDS-PAGE positions, thus not suitable as reference genes for determining protein loading in techniques like Western blotting
- Facilitation of mouse skin-derived precursor growth and yield by optimizing plating density
- 3,4-Dihydroxyphenylethanol ameliorates lipopolysaccharide-induced septic cardiac injury in a murine model
- Downregulation of PITX2 inhibits the proliferation and migration of liver cancer cells and induces cell apoptosis
- Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B
- Novel predictor of the occurrence of DKA in T1DM patients without infection: A combination of neutrophil/lymphocyte ratio and white blood cells
- Investigation of molecular regulation mechanism under the pathophysiology of subarachnoid hemorrhage
- miR-25-3p protects renal tubular epithelial cells from apoptosis induced by renal IRI by targeting DKK3
- Bioengineering and Biotechnology
- Green fabrication of Co and Co3O4 nanoparticles and their biomedical applications: A review
- Agriculture
- Effects of inorganic and organic selenium sources on the growth performance of broilers in China: A meta-analysis
- Crop-livestock integration practices, knowledge, and attitudes among smallholder farmers: Hedging against climate change-induced shocks in semi-arid Zimbabwe
- Food Science and Nutrition
- Effect of food processing on the antioxidant activity of flavones from Polygonatum odoratum (Mill.) Druce
- Vitamin D and iodine status was associated with the risk and complication of type 2 diabetes mellitus in China
- Diversity of microbiota in Slovak summer ewes’ cheese “Bryndza”
- Comparison between voltammetric detection methods for abalone-flavoring liquid
- Composition of low-molecular-weight glutenin subunits in common wheat (Triticum aestivum L.) and their effects on the rheological properties of dough
- Application of culture, PCR, and PacBio sequencing for determination of microbial composition of milk from subclinical mastitis dairy cows of smallholder farms
- Investigating microplastics and potentially toxic elements contamination in canned Tuna, Salmon, and Sardine fishes from Taif markets, KSA
- From bench to bar side: Evaluating the red wine storage lesion
- Establishment of an iodine model for prevention of iodine-excess-induced thyroid dysfunction in pregnant women
- Plant Sciences
- Characterization of GMPP from Dendrobium huoshanense yielding GDP-D-mannose
- Comparative analysis of the SPL gene family in five Rosaceae species: Fragaria vesca, Malus domestica, Prunus persica, Rubus occidentalis, and Pyrus pyrifolia
- Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR
- Investigation of bioactivities of Taxus chinensis, Taxus cuspidata, and Taxus × media by gas chromatography-mass spectrometry
- Morphological structures and histochemistry of roots and shoots in Myricaria laxiflora (Tamaricaceae)
- Transcriptome analysis of resistance mechanism to potato wart disease
- In silico analysis of glycosyltransferase 2 family genes in duckweed (Spirodela polyrhiza) and its role in salt stress tolerance
- Comparative study on growth traits and ions regulation of zoysiagrasses under varied salinity treatments
- Role of MS1 homolog Ntms1 gene of tobacco infertility
- Biological characteristics and fungicide sensitivity of Pyricularia variabilis
- In silico/computational analysis of mevalonate pyrophosphate decarboxylase gene families in Campanulids
- Identification of novel drought-responsive miRNA regulatory network of drought stress response in common vetch (Vicia sativa)
- How photoautotrophy, photomixotrophy, and ventilation affect the stomata and fluorescence emission of pistachios rootstock?
- Apoplastic histochemical features of plant root walls that may facilitate ion uptake and retention
- Ecology and Environmental Sciences
- The impact of sewage sludge on the fungal communities in the rhizosphere and roots of barley and on barley yield
- Domestication of wild animals may provide a springboard for rapid variation of coronavirus
- Response of benthic invertebrate assemblages to seasonal and habitat condition in the Wewe River, Ashanti region (Ghana)
- Molecular record for the first authentication of Isaria cicadae from Vietnam
- Twig biomass allocation of Betula platyphylla in different habitats in Wudalianchi Volcano, northeast China
- Animal Sciences
- Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens
- Predators of the giant pine scale, Marchalina hellenica (Gennadius 1883; Hemiptera: Marchalinidae), out of its natural range in Turkey
- Honey in wound healing: An updated review
- NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block
- Radiotherapy for the treatment of pulmonary hydatidosis in sheep
- Retraction
- Retraction of “Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating microRNA-34a-5p/NOTCH1 signaling pathway”
- Special Issue on Reuse of Agro-Industrial By-Products
- An effect of positional isomerism of benzoic acid derivatives on antibacterial activity against Escherichia coli
- Special Issue on Computing and Artificial Techniques for Life Science Applications - Part II
- Relationship of Gensini score with retinal vessel diameter and arteriovenous ratio in senile CHD
- Effects of different enantiomers of amlodipine on lipid profiles and vasomotor factors in atherosclerotic rabbits
- Establishment of the New Zealand white rabbit animal model of fatty keratopathy associated with corneal neovascularization
- lncRNA MALAT1/miR-143 axis is a potential biomarker for in-stent restenosis and is involved in the multiplication of vascular smooth muscle cells
Articles in the same Issue
- Biomedical Sciences
- Research progress on the mechanism of orexin in pain regulation in different brain regions
- Adriamycin-resistant cells are significantly less fit than adriamycin-sensitive cells in cervical cancer
- Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
- Iris metastasis of diffuse large B-cell lymphoma misdiagnosed as primary angle-closure glaucoma: A case report and review of the literature
- LncRNA PVT1 promotes cervical cancer progression by sponging miR-503 to upregulate ARL2 expression
- Two new inflammatory markers related to the CURB-65 score for disease severity in patients with community-acquired pneumonia: The hypersensitive C-reactive protein to albumin ratio and fibrinogen to albumin ratio
- Circ_0091579 enhances the malignancy of hepatocellular carcinoma via miR-1287/PDK2 axis
- Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-κB signaling pathway
- Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats
- ABCB1 polymorphism in clopidogrel-treated Montenegrin patients
- Metabolic profiling of fatty acids in Tripterygium wilfordii multiglucoside- and triptolide-induced liver-injured rats
- miR-338-3p inhibits cell growth, invasion, and EMT process in neuroblastoma through targeting MMP-2
- Verification of neuroprotective effects of alpha-lipoic acid on chronic neuropathic pain in a chronic constriction injury rat model
- Circ_WWC3 overexpression decelerates the progression of osteosarcoma by regulating miR-421/PDE7B axis
- Knockdown of TUG1 rescues cardiomyocyte hypertrophy through targeting the miR-497/MEF2C axis
- MiR-146b-3p protects against AR42J cell injury in cerulein-induced acute pancreatitis model through targeting Anxa2
- miR-299-3p suppresses cell progression and induces apoptosis by downregulating PAX3 in gastric cancer
- Diabetes and COVID-19
- Discovery of novel potential KIT inhibitors for the treatment of gastrointestinal stromal tumor
- TEAD4 is a novel independent predictor of prognosis in LGG patients with IDH mutation
- circTLK1 facilitates the proliferation and metastasis of renal cell carcinoma by regulating miR-495-3p/CBL axis
- microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury
- Long noncoding RNA TUG1 regulates degradation of chondrocyte extracellular matrix via miR-320c/MMP-13 axis in osteoarthritis
- Duodenal adenocarcinoma with skin metastasis as initial manifestation: A case report
- Effects of Loofah cylindrica extract on learning and memory ability, brain tissue morphology, and immune function of aging mice
- Recombinant Bacteroides fragilis enterotoxin-1 (rBFT-1) promotes proliferation of colorectal cancer via CCL3-related molecular pathways
- Blocking circ_UBR4 suppressed proliferation, migration, and cell cycle progression of human vascular smooth muscle cells in atherosclerosis
- Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
- Downregulation of circ_0037655 impedes glioma formation and metastasis via the regulation of miR-1229-3p/ITGB8 axis
- Vitamin D deficiency and cardiovascular risk in type 2 diabetes population
- Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis
- Mechanisms of circular RNA circ_0066147 on pancreatic cancer progression
- lncRNA myocardial infarction-associated transcript (MIAT) knockdown alleviates LPS-induced chondrocytes inflammatory injury via regulating miR-488-3p/sex determining region Y-related HMG-box 11 (SOX11) axis
- Identification of circRNA circ-CSPP1 as a potent driver of colorectal cancer by directly targeting the miR-431/LASP1 axis
- Hyperhomocysteinemia exacerbates ischemia-reperfusion injury-induced acute kidney injury by mediating oxidative stress, DNA damage, JNK pathway, and apoptosis
- Potential prognostic markers and significant lncRNA–mRNA co-expression pairs in laryngeal squamous cell carcinoma
- Gamma irradiation-mediated inactivation of enveloped viruses with conservation of genome integrity: Potential application for SARS-CoV-2 inactivated vaccine development
- ADHFE1 is a correlative factor of patient survival in cancer
- The association of transcription factor Prox1 with the proliferation, migration, and invasion of lung cancer
- Is there a relationship between the prevalence of autoimmune thyroid disease and diabetic kidney disease?
- Immunoregulatory function of Dictyophora echinovolvata spore polysaccharides in immunocompromised mice induced by cyclophosphamide
- T cell epitopes of SARS-CoV-2 spike protein and conserved surface protein of Plasmodium malariae share sequence homology
- Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
- Long noncoding RNA HULC contributes to paclitaxel resistance in ovarian cancer via miR-137/ITGB8 axis
- Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
- Prognostic value of the neutrophil-to-lymphocyte ratio in acute organophosphorus pesticide poisoning
- Gastroprotective effects of diosgenin against HCl/ethanol-induced gastric mucosal injury through suppression of NF-κβ and myeloperoxidase activities
- Silencing of LINC00707 suppresses cell proliferation, migration, and invasion of osteosarcoma cells by modulating miR-338-3p/AHSA1 axis
- Successful extracorporeal membrane oxygenation resuscitation of patient with cardiogenic shock induced by phaeochromocytoma crisis mimicking hyperthyroidism: A case report
- Effects of miR-185-5p on replication of hepatitis C virus
- Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis
- Primary localized cutaneous nodular amyloidosis presenting as lymphatic malformation: A case report
- Multimodal magnetic resonance imaging analysis in the characteristics of Wilson’s disease: A case report and literature review
- Therapeutic potential of anticoagulant therapy in association with cytokine storm inhibition in severe cases of COVID-19: A case report
- Neoadjuvant immunotherapy combined with chemotherapy for locally advanced squamous cell lung carcinoma: A case report and literature review
- Rufinamide (RUF) suppresses inflammation and maintains the integrity of the blood–brain barrier during kainic acid-induced brain damage
- Inhibition of ADAM10 ameliorates doxorubicin-induced cardiac remodeling by suppressing N-cadherin cleavage
- Invasive ductal carcinoma and small lymphocytic lymphoma/chronic lymphocytic leukemia manifesting as a collision breast tumor: A case report and literature review
- Clonal diversity of the B cell receptor repertoire in patients with coronary in-stent restenosis and type 2 diabetes
- CTLA-4 promotes lymphoma progression through tumor stem cell enrichment and immunosuppression
- WDR74 promotes proliferation and metastasis in colorectal cancer cells through regulating the Wnt/β-catenin signaling pathway
- Down-regulation of IGHG1 enhances Protoporphyrin IX accumulation and inhibits hemin biosynthesis in colorectal cancer by suppressing the MEK-FECH axis
- Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
- Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway
- lncRNA NEAT1 regulates CYP1A2 and influences steroid-induced necrosis
- A two-microRNA signature predicts the progression of male thyroid cancer
- Isolation of microglia from retinas of chronic ocular hypertensive rats
- Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study
- Calcineurin Aβ gene knockdown inhibits transient outward potassium current ion channel remodeling in hypertrophic ventricular myocyte
- Aberrant expression of PI3K/AKT signaling is involved in apoptosis resistance of hepatocellular carcinoma
- Clinical significance of activated Wnt/β-catenin signaling in apoptosis inhibition of oral cancer
- circ_CHFR regulates ox-LDL-mediated cell proliferation, apoptosis, and EndoMT by miR-15a-5p/EGFR axis in human brain microvessel endothelial cells
- Resveratrol pretreatment mitigates LPS-induced acute lung injury by regulating conventional dendritic cells’ maturation and function
- Ubiquitin-conjugating enzyme E2T promotes tumor stem cell characteristics and migration of cervical cancer cells by regulating the GRP78/FAK pathway
- Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
- Protective effect of Lactobacillus-containing probiotics on intestinal mucosa of rats experiencing traumatic hemorrhagic shock
- Glucocorticoids induce osteonecrosis of the femoral head through the Hippo signaling pathway
- Endothelial cell-derived SSAO can increase MLC20 phosphorylation in VSMCs
- Downregulation of STOX1 is a novel prognostic biomarker for glioma patients
- miR-378a-3p regulates glioma cell chemosensitivity to cisplatin through IGF1R
- The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats
- TGF-β1-overexpressing mesenchymal stem cells reciprocally regulate Th17/Treg cells by regulating the expression of IFN-γ
- The influence of MTHFR genetic polymorphisms on methotrexate therapy in pediatric acute lymphoblastic leukemia
- Red blood cell distribution width-standard deviation but not red blood cell distribution width-coefficient of variation as a potential index for the diagnosis of iron-deficiency anemia in mid-pregnancy women
- Small cell neuroendocrine carcinoma expressing alpha fetoprotein in the endometrium
- Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers
- Molecular characterization and phylogenetic studies of Echinococcus granulosus and Taenia multiceps coenurus cysts in slaughtered sheep in Saudi Arabia
- ITGB5 mutation discovered in a Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
- ACTB and GAPDH appear at multiple SDS-PAGE positions, thus not suitable as reference genes for determining protein loading in techniques like Western blotting
- Facilitation of mouse skin-derived precursor growth and yield by optimizing plating density
- 3,4-Dihydroxyphenylethanol ameliorates lipopolysaccharide-induced septic cardiac injury in a murine model
- Downregulation of PITX2 inhibits the proliferation and migration of liver cancer cells and induces cell apoptosis
- Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B
- Novel predictor of the occurrence of DKA in T1DM patients without infection: A combination of neutrophil/lymphocyte ratio and white blood cells
- Investigation of molecular regulation mechanism under the pathophysiology of subarachnoid hemorrhage
- miR-25-3p protects renal tubular epithelial cells from apoptosis induced by renal IRI by targeting DKK3
- Bioengineering and Biotechnology
- Green fabrication of Co and Co3O4 nanoparticles and their biomedical applications: A review
- Agriculture
- Effects of inorganic and organic selenium sources on the growth performance of broilers in China: A meta-analysis
- Crop-livestock integration practices, knowledge, and attitudes among smallholder farmers: Hedging against climate change-induced shocks in semi-arid Zimbabwe
- Food Science and Nutrition
- Effect of food processing on the antioxidant activity of flavones from Polygonatum odoratum (Mill.) Druce
- Vitamin D and iodine status was associated with the risk and complication of type 2 diabetes mellitus in China
- Diversity of microbiota in Slovak summer ewes’ cheese “Bryndza”
- Comparison between voltammetric detection methods for abalone-flavoring liquid
- Composition of low-molecular-weight glutenin subunits in common wheat (Triticum aestivum L.) and their effects on the rheological properties of dough
- Application of culture, PCR, and PacBio sequencing for determination of microbial composition of milk from subclinical mastitis dairy cows of smallholder farms
- Investigating microplastics and potentially toxic elements contamination in canned Tuna, Salmon, and Sardine fishes from Taif markets, KSA
- From bench to bar side: Evaluating the red wine storage lesion
- Establishment of an iodine model for prevention of iodine-excess-induced thyroid dysfunction in pregnant women
- Plant Sciences
- Characterization of GMPP from Dendrobium huoshanense yielding GDP-D-mannose
- Comparative analysis of the SPL gene family in five Rosaceae species: Fragaria vesca, Malus domestica, Prunus persica, Rubus occidentalis, and Pyrus pyrifolia
- Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR
- Investigation of bioactivities of Taxus chinensis, Taxus cuspidata, and Taxus × media by gas chromatography-mass spectrometry
- Morphological structures and histochemistry of roots and shoots in Myricaria laxiflora (Tamaricaceae)
- Transcriptome analysis of resistance mechanism to potato wart disease
- In silico analysis of glycosyltransferase 2 family genes in duckweed (Spirodela polyrhiza) and its role in salt stress tolerance
- Comparative study on growth traits and ions regulation of zoysiagrasses under varied salinity treatments
- Role of MS1 homolog Ntms1 gene of tobacco infertility
- Biological characteristics and fungicide sensitivity of Pyricularia variabilis
- In silico/computational analysis of mevalonate pyrophosphate decarboxylase gene families in Campanulids
- Identification of novel drought-responsive miRNA regulatory network of drought stress response in common vetch (Vicia sativa)
- How photoautotrophy, photomixotrophy, and ventilation affect the stomata and fluorescence emission of pistachios rootstock?
- Apoplastic histochemical features of plant root walls that may facilitate ion uptake and retention
- Ecology and Environmental Sciences
- The impact of sewage sludge on the fungal communities in the rhizosphere and roots of barley and on barley yield
- Domestication of wild animals may provide a springboard for rapid variation of coronavirus
- Response of benthic invertebrate assemblages to seasonal and habitat condition in the Wewe River, Ashanti region (Ghana)
- Molecular record for the first authentication of Isaria cicadae from Vietnam
- Twig biomass allocation of Betula platyphylla in different habitats in Wudalianchi Volcano, northeast China
- Animal Sciences
- Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens
- Predators of the giant pine scale, Marchalina hellenica (Gennadius 1883; Hemiptera: Marchalinidae), out of its natural range in Turkey
- Honey in wound healing: An updated review
- NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block
- Radiotherapy for the treatment of pulmonary hydatidosis in sheep
- Retraction
- Retraction of “Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating microRNA-34a-5p/NOTCH1 signaling pathway”
- Special Issue on Reuse of Agro-Industrial By-Products
- An effect of positional isomerism of benzoic acid derivatives on antibacterial activity against Escherichia coli
- Special Issue on Computing and Artificial Techniques for Life Science Applications - Part II
- Relationship of Gensini score with retinal vessel diameter and arteriovenous ratio in senile CHD
- Effects of different enantiomers of amlodipine on lipid profiles and vasomotor factors in atherosclerotic rabbits
- Establishment of the New Zealand white rabbit animal model of fatty keratopathy associated with corneal neovascularization
- lncRNA MALAT1/miR-143 axis is a potential biomarker for in-stent restenosis and is involved in the multiplication of vascular smooth muscle cells