Abstract
Rufinamide (RUF) is a structurally unique anti-epileptic drug, but its protective mechanism against brain injury remains unclear. In the present study, we validated how the RUF protected mice with kainic acid (KA)-induced neuronal damage. To achieve that, a mouse epilepsy model was established by KA intraperitoneal injection. After Nissl staining, although there was a significant reduction in Nissl bodies in mice treated with KA, 40, 80, and 120 mg/kg, RUF significantly reduced KA-induced neuronal damage, in a dose-dependent manner. Among them, 120 mg/kg RUF was most pronounced. Immunohistochemistry (IHC) and western blot analysis showed that RUF inhibited the IBA-1 overexpression caused by KA to block microglia cell overactivation. Further, RUF treatment partially reversed neuroinflammatory cytokine (IL-1β, TNFα, HMGB1, and NLRP3) overexpression in mRNA and protein levels in KA mice. Moreover, although KA stimulation inhibited the expression of tight junctions, RUF treatment significantly upregulated expression of tight junction proteins (occludin and claudin 5) in both mRNA and protein levels in the brain tissues of KA mice. RUF inhibited the overactivation of microglia, suppressed the neuroinflammatory response, and reduced the destruction of blood–brain barrier, thereby alleviating the excitatory nerve damage of the KA-mice.
1 Introduction
Epilepsy, one of the most common severe brain diseases afflicting 70 million people worldwide, has a bimodal incidence, with infants and the elderly at the highest risk [1]. The common cause of epilepsy are excessive depolarization and increased excitability of neurons in the brain [2]. Glutamate is the primary excitatory neurotransmitter in the mammalian brain. Its overproduction can lead to excitatory toxicity and central neuron death, which are closely related to the onset of epilepsy [3]. Kainic acid (KA) is a glutamic acid analogue of excitatory toxicity, which can be used to simulate excitatory toxicity caused by over-activated glutamate [4]. Thus, KA is often used to induce recurrent animal models of spontaneous epilepsy. In addition, since the subzone of the hippocampal area is vulnerable to damage induced by KA, the KA-induced disease model is widely applied in the related scientific research of neurodegenerative diseases, such as epilepsy [5,6].
The occurrence of excitatory neurotoxicity is often accompanied by abnormal activation of microglia cells, which induces the release of a large number of pro-inflammatory factors. The neuroinflammatory response triggered by excitatory toxicity results in damage to hippocampal neurons [7]. Further, increased pro-inflammatory cytokines may aggravate neuron injury. The long-term activation of microglial cells caused by excitatory toxicity and subsequent secretion of inflammatory factors would amplify the inflammatory response in the central nervous system, increasing the risk of epilepsy [8–10]. In addition, long-term activation of microglia cells contributes to damage of the blood–brain barrier, allowing serum proteins to insinuate into the brain, which also increases the release of inflammatory cytokines. Correspondingly, the structure and foundation of the blood–brain barrier are disrupted, leading to more severe damage to the hippocampus [11,12]. By regulating the activation of microglia and maintaining the integrity of the blood–brain barrier, it may be a feasible method to reduce brain damage caused by epilepsy.
Rufinamide (RUF) is a uniquely structured anti-epileptic drug (AED) and blocks voltage-gated sodium channels (VGSCs). Based on its efficacy and behavioral toxicity profiles in animal seizure models, compared with other AEDs, RUF successfully treats generalized and partial seizures [13]. For example, in the occurrence of Lennox–Gastaut syndrome, RUF rapidly binds with inactivated sodium channels to inhibit spike and wave discharges, thereby inhibiting the seizure of such atypical epilepsy [14]. In addition, some previous studies have already reported the antioxidant and anti-inflammatory effects of RUF in various rodent seizure models [15]. Nevertheless, most of the research on RUF so far has focused on its effect on the frequency of seizures and the duration of seizure-like events [16]. The protective mechanism of RUF against brain injury induced by excitotoxicity remains unclear. This study intends to establish a mouse epilepsy model to evaluate the effects of RUF on microglia activation and BBB integrity in epileptic mice and to explore the mechanism of RUF on excitatory toxic brain injury.
2 Materials and methods
2.1 Establishment of the epilepsy model and experimental groups
All 30 male ICR mice (8 weeks old) were purchased from Guangdong Medical Laboratory Animal Center (Guangdong, China). The animals were housed in a conventional state under adequate temperature (23 ± 3°C) and relative humidity (55 ± 5%) control with a 12 h light/12 h dark cycle and provided free access to food and water. All animals were bred adaptively for one week before the experiment. A mice model of brain injury was established based on the previous study [3]. In short, KA (Sigma-Aldrich Company, CAS: 58002-62-3) was dissolved in sterile saline at 1 mg/mL, and 40 mg/kg KA was applied in the peritoneum of the model mice and the control mice were given sterile saline of the same volume. If the experimental animal dies after KA injection, the same number of experimental animals should be added.
Animals were divided into five groups (n = 6 in each group); [1] control group (sterile normal saline; 0.9% w/v NaCl), [2] KA-treated group (KA-group), [3] 40 mg/kg RUF-treated group (KA + low-RUF group), [4] 80 mg/kg RUF-treated group (KA + medium-RUF group), and [5] 120 mg/kg RUF-treated group (KA + high-RUF group). During the experiment, one mouse died after KA injection. RUF was administered intraperitoneally once daily for 3 days before KA injection, and the last administration of vehicle or RUF was performed 1 h before KA injection. The mice were euthanized 24 h after KA injection.
-
Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals and was approved by the Ethics Committee of the Fourth Hospital of Changsha (approval number: CSSDSYY-LLSC-KYXM-2018-01-06).
2.2 Tissue sections
After mice were anesthetized, the thoracic cavity was opened to expose the heart, and then cardiac perfusion was performed with 100 mL of normal saline. When the lungs on both sides and the liver of the mice were obviously whitened, the brain tissues of the mice were taken and continuously fixed in 4% paraformaldehyde for 24 h, followed by gradient dehydration with 20 and 30% sucrose solutions, respectively. The brain tissue of the mice was sectioned, dehydrated, and embedded in paraffin. Finally, the tissue sections were placed on the slides and dried at 60°C for 2 h [17].
2.3 Nissl stain
Nissl staining was performed as previously described [17]. The sections were dewaxed and hydrated, and the sections were first placed in xylene 2 times (10 min/time). Then, 100, 95, 85, and 75% ethanol were placed at each stage for 5 min. Subsequently, the sections were soaked in distilled water for 5 min and then put into 0.1% toluidine blue solution (Amresco, Solon, OH, USA) staining solution for 5 min. After washing with distilled water, the sections were placed in ethanol at different concentration gradients (70% for 2 min; 90% for 5 min) until the nucleus and cell granules were transparent and the background became colorless. Then, the slides were immersed in xylene twice (10 min/time), sealed with neutral gum, and observed under a microscope (Motic, China). Brain slices from the control group of mice (CA1 region) were used as a positive control. The number of Nissl bodies was calculated by IPP (image-pro-Plus, Media Cybernetics, USA) software.
2.4 Immunohistochemistry
IHC assay was performed as described previously [4]. First, brain slices (CA1 region) were placed in xylene 3 times (20 min/time). Then, the slices were sequentially placed in 100, 95, 85, and 75% ethanol at each stage for 5 min. Afterward, 1% periodate was added to inactivate endogenous enzymes at room temperature for 10 min, and rinsed with PBS 3 times (3 min/time). Then, the primary antibody IBA-1 (1:200, Proteintech, USA) was incubated overnight at 4°C, and the secondary antibody IgG antibody-HRP polymer was incubated for 30 min at 37°C. Diaminobenzidine (DAB, ZSBG-BIO, China) was used to visualize the slices. After dehydration, the slices were sealed with neutral balsam and observed under a microscope (Motic, Guangzhou, China). The brain tissue slices from the control group of mice (CA1 region) were used as a positive control. Finally, IPP (image-pro-Plus, Media Cybernetics, USA) software was used for image analysis.
2.5 Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
RT-qPCR was performed in accordance with a previous report [18]. Trizol reagent (Thermo, USA) was used to extract total RNA from fresh mice hippocampal tissues in each treatment group according to the instructions. The remaining tissue samples were stored at −80°C for subsequent research. The first-strand cDNA was synthesized from 500 ng of RNA using the HiFiScript cDNA Short Kit (Cowin Biosciences, China) for qPCR. All primers in this study were synthesized by Sangon Biotech Company (Shanghai, China). The reaction conditions were 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 60°C for 30 s. The normalization of the target genes used β-actin as the internal control. The 2−ΔΔCt method was utilized to calculate the relative expression of the mRNA [19]. The primers for IL-1β, HMGB1, NLRP3, occludin, TNF-α, claudin5, and β-actin are listed in Table 1.
The primer sequence of gene
| Gene | Primer sequence (5′ → 3′) |
|---|---|
| IL-1β | FOR: TGTGATGTTCCCATTAGAC |
| REV: AATACCACTTGTTGGCTTA | |
| HMGB1 | FOR: GGCGGCTGTTTTGTTGACAT |
| REV: ACCCAAAATGGGCAAAAGCA | |
| NLRP3 | FOR: CACCTCTTCTCTGCCTACCTG |
| REV: AGCTGTAAAATCTCTCGCAGT | |
| Occludin | FOR: CCCAGACCACTATGAAACCGACT |
| REV: CAGCCATGTACTCTTCGCTCT | |
| TNF-α | FOR: CCCCTCTATTTATAATTGCACCT |
| REV: CTGGTAGTTTAGCTCCGTTT | |
| Claudin5 | FOR: TGGCACTCTTTGTTACCTTGACC |
| REV: ACCGTTGGATCATAGAACTCCC | |
| β-Actin | FOR: ACATCCGTAAAGACCTCTATGCC |
| REV: TACTCCTGCTTGCTGATCCAC |
2.6 Western blot
The fresh hippocampal tissues of mice from different treatment groups were cleaved with RIPA lysis buffer and centrifuged at 12,000 rpm at 4°C for 15 min to obtain the sample proteins. The remaining tissue samples were stored at −80°C. Then, a BCA protein assay kit (Beyotime Biotechnology, China) was used to determine the concentration of proteins. Aliquots of 20 μg of protein of each sample were isolated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The separated proteins were transferred to a polyvinylidene fluoride membrane activated by methanol, sealed by 5% skim milk, and dried at room temperature for at least 1 h. Afterward, it was incubated with the first antibody overnight at 4°C. The main incubated primary antibodies included anti-occludin (1:3,000, Proteintech, USA), anti-Claudin5 (1:750, Bioss Biotechnology Co., Ltd., Beijing, China), anti-IL-1B (1:500, Proteintech, USA), anti-TNFα (1:750, Proteintech, USA), anti-HMGB1 (1:750, Proteintech, USA), anti-NLRP3 (1:500, Proteintech, USA), and internal reference anti-β-actin (1:500, Proteintech, USA). The proteins were combined with secondary anti-IgG (1:5,000, 1:6,000, Proteintech, USA) and incubated at 37°C for 90 min, and later visualization was performed by the Millipore (USA) method, and imaging analysis was performed with ImageQuant TL software (GE Healthcare, Life Sciences, USA)[ 20].
2.7 CCK8
According to previous literature records, 0, 5, 10, and 20 μg/mL RUF were used to pretreat glial cells at 37°C and 5% CO2 for 24 h [21,22]. Cell Counting Kit-8 (Dojindo, Tokyo, Japan) was used to detect cell viability according to the manufacturer’s instructions.
2.8 Statistics
Graphpad Prism8.0 (GraphPad Software Inc., USA) was used for the statistical analysis of data in this study. Measurement data were expressed as mean ± standard deviation. Tests of normality and homogeneity of variance were first performed to verify that they were in accordance with normal distribution and homogeneity of variance. Non-paired t-test was used for inter-group comparison, one-way ANOVA was used for inter-group comparison, and Tukey’s was used for post-test. P < 0.05 indicated that the difference was statistically significant.
3 Results
3.1 RUF reduced hippocampal neuronal injury in the KA mice model
When neurons are damaged, the Nissl bodies would decrease, disintegrate, or even disappear [23]. Nissl staining analysis (Figure 1a) showed that the hippocampal neurons were tightly arranged in the control group, the cell structure was clear, and Nissl bodies were abundant in the cytoplasm. In the KA group, the hippocampal neurons were loosely arranged, with blurred cell contour and atrophy, and the number of Nissl bodies in the cytoplasm was significantly reduced. These results indicated that hippocampal neurons in the KA group were severely damaged. Further, in RUF treatment, we found that the status of hippocampal neurons was reversed markedly in a dose-dependent manner. The statistical results of the percentage of damaged neurons were consistent with the results of Nissl staining. As shown in Figure 1b, with the induction of KA, the proportion of injured neurons increased. In the RUF treatment group, the proportion of damaged cells was significantly reduced in a dose-dependent manner. The data illustrated that RUF could alleviate KA-induced neuronal injury. Since the best effect was displayed by the high-dose RUF (120 mg/kg RUF) group, it was selected for the subsequent experimental study.

RUF reduced hippocampal neuronal injury in the KA mice model. (a) Nissl staining was used to analyze the distribution of hippocampal neurons damage in mice. (b) The percentage of damaged hippocampal neurons was analyzed with Nissl staining. *Compared with control group, P < 0.05. #Compared with the KA group, P < 0.05. &Compared with KA + low-RUF group, P < 0.05. %Compared with KA + medium RUF group, P < 0.05.
3.2 RUF suppressed microglial activation in the KA mice model
Excitatory neurotoxicity is implicated in the abnormal activation of microglia. Thereby, we further analyzed the expression of IBA-1, a microglial marker in the central nervous system, by immunohistochemistry. In Figure 2a and b, the results showed that compared with the control group, the IBA-1 IOD/area in the brain of the KA group was significantly increased. Compared with the KA group, the IBA-1 IOD/area in the KA model mice was significantly reduced after RUF intervention. It was also confirmed by western blot analysis. From Figure 2c, the relative expression level of IBA-1 protein in the brain tissue of the KA group was significantly higher than that of the control group. Compared with the KA group, the relative expression of IBA-1 protein in the KA model mice was significantly reduced after RUF intervention. In order to investigate whether RUF had an effect on microglial cell viability, we treated microglia cells with 5, 10, and 20 μg/mL RUF for 24 h. There was no significant difference in microglia viability between the RUF treatment group and the control group (P < 0.05) (Figure 2d). The above results indicated that RUF could inhibit the excessive activation of microglia cells in the KA-induced mice rather than inhibiting cell proliferation.

Expression of microglia marker IBA-1 protein in mice. (a) IHC analysis of the expression of IBA-1 protein in mouse brain. (b) IHC analysis of the IOD/area of IBA-1 protein in mouse brain. (c) Western blot analysis of the relative expression of IBA-1 protein in mouse brain. (d) Cell viability was analyzed by CCK8. *Compared with control group, P < 0.05. #Compared with the KA group, P < 0.05. IOD: integrated optical density (brown = immunostaining, blue = nucleus).
3.3 RUF inhibited the expression of inflammatory factors in the KA mice model
In order to study the effect of RUF on neuroinflammation caused by KA-induced brain injury, we performed a western blot to detect the expression of neuroinflammation-related factors in the brain tissue of mice at the protein level. The results in Figure 3a–d showed that compared with the control group, the expression of IL-1β, TNFα, HMGB1, and NLRP3 in the brain tissues of mice in the KA group were significantly increased. However, this state in neuroinflammatory cytokines was partially reversed due to the treatment of RUF. Consistent with protein levels, these inflammatory cytokines, which were highly expressed at the mRNA transcription level due to KA stimulation, were down-regulated with RUF intervention (Figure 4a–d). Herein, the findings revealed that RUF has a certain positive effect on inhibiting KA-induced neuroinflammation in mice.

Western blot analysis of IL-1β, TNFα, HMGB1, and NLRP3 in mice. (a) Western blot bands about IL-1β, TNFα, HMGB1, and NLRP3. (b) The relative expression of IL-1β/β-actin at the protein level. (c) The relative expression of TNFα/β-actin at the protein level. (d) The relative expression of HMGB1/β-actin at the protein level. (e) The relative expression of NLRP3/β-actin at the protein level. *Compared with control group, P < 0.05. #Compared with the KA group, P < 0.05.

RT-qPCR analysis of IL-1β, TNFα, HMGB1, and NLRP3 in mice. (a) The relative expression of IL-1β mRNA in different groups. (b) The relative expression of TNFα mRNA in different groups. (c) The relative expression of HMGB1 mRNA in different groups. (d) The relative expression of NLRP3 mRNA in different groups. *Compared with control group, P < 0.05. #Compared with the KA group, P < 0.05.
3.4 RUF attenuated the blood–brain barrier injury in the KA mice model
The rupture of the blood–brain barrier is a sign of central nervous system dysfunction. To investigate whether RUF could protect the blood–brain barrier from KA-induced damage, we performed western blot to measure the protein expression of tight junction proteins occludin and claudin 5 in the brain tissue of mice. As shown in Figure 5a, compared with the control group, the 5 bands of occludin and claudin 5 in the KA group developed weaker. In contrast, the development of both bands increased significantly in the RUF group. The quantitative analysis of western blot results showed that RUF significantly increased the expression of occludin and claudin 5 at the protein level (Figure 5b and c). The results of RT-PCR also agree with this result. At the mRNA level, RUF treatment reversed the low expression of occludin and claudin 5 induced by KA stimulation (Figure 5d and e). From above, it is suggested that RUF has the potential to protect KA-mice against blood–brain barrier injury.

Western blot and RT-qPCR analysis occludin and claudin 5 protein in mice. (a) Western blot bands about occludin and claudin 5 in mice brain. (b) The relative expression of the occludin/β-actin protein in mice brain. (c) The relative expression of claudin 5/β-actin protein in mice brain. (d) The relative expression of occludin mRNA in mice brain. (e) The relative expression of claudin 5 mRNA in mice brain. *Compared with control group, P < 0.05. #Compared with the KA group, P < 0.05.
4 Discussion
Neurotoxicity, neuronal cell death, neuroinflammation, oxidative stress, gliosis, and BBB dysfunction are all common causes of epilepsy [24]. In recent years, the treatment of epilepsy is still based on drug therapy, such as RUF [25]. RUF is a triazole derivative whose main mechanism of action is considered the regulation of sodium channel activity, especially the prolongation of sodium channel inactivation, which can be used in the adjuvant treatment for patients with epilepsy [26]. Many studies have shown that RUF is well tolerated and safe. For example, RUF effectively suppressed tonic-clonic seizures caused by maximum electroshock in rodents, either orally or intraperitoneally [27]. As a marker of the functional state of neurons, Nissl bodies are often used to evaluate the changes of neurons [23]. In this study, we observed a dose-dependent reversal of the KA-stimulated reduction in the number of Nissl bodies after 40, 80, and 120 mg/kg RUF treatment. It implied RUF could effectively prevent KA-induced damage to mice hippocampus neurons. Herein, we further hypothesized that this condition might be associated with microglia activation.
Emerging evidence has suggested that KA can cause characteristic neuronal hippocampal subregion damage in young rats, accompanied by accumulation of microglia [28]. In our research, RUF showed an excellent inhibitory effect on the KA-induced overactivation of microglial cells, rather than inhibiting the cell viability of microglia. Over the past decade, various experimental studies have shown that glial cells activated by various lesions play an essential role in the mechanism of epileptic seizure and relapse [29]. Pro-inflammatory molecules alter neuronal excitability and glial cell physiological function through paracrine or autocrine function, which would contribute to a disturbance in glial neuron communication or even recurrent ischemic attacks [30]. Other reports have shown that microglia act as innate immune effector cells in the central nervous system and secrete inflammatory factors to amplify the inflammatory response [31]. Microglia may be one of the sources of this secretion, which needs further research and analysis. As this is not the focus of the current study, we will explore this topic in future work.
After a seizure, inflammatory mediators released by brain cells and peripheral immune cells may cause various seizures and persistent seizures [32,33], such as IL-1β, TNFα, HMGB1, IL6, IL8, NLRP3 and other related factors [34,35]. Therefore, we speculate that RUF may also play a positive role in controlling inflammation in epileptic animals. We found that inflammatory cytokines expressions were all increased significantly with the overactivation of microglial cells in KA mice. In this study, the inhibitory rates of RUF on the inflammatory proteins IL-1β, TNF-α, HMGB1, and NLRP3 were 29.9, 24.0, 52.4, and 43.8%, respectively. The inflammatory response of KA + RUF group mice was effectively alleviated. It is suggested the RUF has a certain positive effect on inhibiting KA-induced neuroinflammation in mice. This view is also supported by another study [4]. Microglia, a neuroinflammatory effector in the brain, belongs to the central nervous system and is regulated by the vagus nerve to modulate its inflammatory state [36]. Further, we hypothesized that RUF might exert anti-inflammatory effects through some central nervous or autonomic nervous functions. In the next step, we will compare the anti-inflammatory effects of RUF with classic anti-inflammatory compounds and explore its specific mechanisms.
The integrity of BBB maintains the optimal microenvironment for brain function [37]. BBB dysfunction has been identified as a critical factor in several neurological diseases, including epilepsy and stroke. In Alzheimer’s disease, Avarol derivatives (such as thiosalycil-prenyl-hydroquinones) act as competitive acetylcholinesterase (AChE) inhibitors and show good neuroprotection [38,39]. Such inhibitors reduce the consumption of acetylcholine by AChE, which may reduce BBB promiscuity [40]. As far as we know, RUF does not interact with acetylcholine. In our study, although tight junction proteins (occludin and claudin 5) expression were blocked in the brain tissue of KA-mice, RUF restored both partly. It manifested that RUF has a protective effect on the integrity of BBB. The preservation of BBB integrity may be the main reason for its neuroprotective effect. Tight junction proteins bind endothelial cells to each other, resulting in a barrier that prevents most molecules from penetrating through the cross-cellular pathway [41]. Perampanel, an AED similar to RUF, acts as a non-competitive AMPA receptor antagonist and provides a protective effect against ischemic stroke through claudin 5-mediated permeability regulation of BBB [42]. On the other hand, the considerable accumulation of inflammatory factors is also a major cause of BBB destruction. Novel research found that Escin reduced BBB damage by inhibiting systemic inflammatory response in mice with cerebral hemorrhage, which led to improved neurological function [43]. Therefore, we supposed that the inhibitory effect of RUF on neuroinflammation in KA mice might protect BBB from damage to a certain extent. In addition, it is worth noting that overexpressed P-glycoprotein (PGP) exports AED in BBB may be one of the causes of AED resistance. Although RUF is not the substrate of PGP that cannot penetrate the BBB [44], RUF may activate the transcriptional levels of both through specific mechanisms or pathways, thus increasing the mRNA expressions of occludin and Claudin5. Furthermore, mRNAs were translated into the corresponding proteins, so as our results showed, occludin and claudin5 also appeared corresponding changes in protein levels. This pharmacological feature may reduce its role in the destruction of BBB and may be related to its long-term efficacy. However, this characteristic may also be a disadvantage of RUF treatment.
However, we must admit that this study has some limitations. Due to our current experimental conditions and funding constraints, the sample size used in this study is small, which leads to an insufficient exploration of some findings. In terms of controlling inflammation, we found that RUF has a positive effect on inhibiting inflammation. This interesting phenomenon aroused our interest. We plan to explore the possible mechanism of this phenomenon in the next research. At the same time, based on the protective effect of RUF on the integrity of BBB, we plan to conduct in-depth research on the mechanism of this process from the perspective of cell or blood metabolism.
5 Conclusion
In conclusion, our current study demonstrates that RUF could inhibit the overactivation of microglial cells. It also has a positive effect on preventing the overexpression of inflammatory cytokines. At the same time, RUF reduces the damage of BBB integrity caused by KA. These may be essential pathways by which RUF protects KA mice from excitatory nerve damage. These may be connected with the neuroprotective effect of RUF. Our study may provide insights better to understand the regulatory mechanism of RUF on brain injury.
Acknowledgements
The authors would like to thank Changsha Hospital of Hunan Normal University (the Fourth Hospital of Changsha) and ZhuJiang Hospital of Southern Medical University for their technical support.
-
Funding information: This study was supported by Hunan Provincial Natural Science Foundation of China (2018JJ6067).
-
Author contributions: B.H. and H.Y. designed the study, X.H. performed the research, T.Y. analyzed the data, and B.H. and H.Y. wrote the paper.
-
Conflict of interest: The authors state no conflict of interests.
-
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
[1] Thijs RD, Surges R, O’Brien TJ, Sander JW. Epilepsy in adults. Lancet. 2019;393(10172):689–701.10.1016/S0140-6736(18)32596-0Search in Google Scholar
[2] Mantegazza M, Curia G, Biagini G, Ragsdale DS, Avoli M. Voltage-gated sodium channels as therapeutic targets in epilepsy and other neurological disorders. Lancet Neurol. 2010;9(4):413–24.10.1016/S1474-4422(10)70059-4Search in Google Scholar
[3] Chiu KM, Lin TY, Lee MY, Lu CW, Wang MJ, Wang SJ. Dexmedetomidine protects neurons from kainic acid-induced excitotoxicity by activating BDNF signaling. Neurochem Int. 2019;129:104493.10.1016/j.neuint.2019.104493Search in Google Scholar PubMed
[4] Park JA, Lee CH. Effect of Rufinamide on the kainic acid-induced excitotoxic neuronal death in the mouse hippocampus. Arch Pharm Res. 2018;41(7):776–83.10.1007/s12272-018-1043-1Search in Google Scholar PubMed
[5] Owen B, Bichler E, Benveniste M. Excitatory synaptic transmission in hippocampal area CA1 is enhanced then reduced as chronic epilepsy progresses. Neurobiol Dis. 2021;154:105343.10.1016/j.nbd.2021.105343Search in Google Scholar PubMed PubMed Central
[6] Salaka RJ, Nair KP, Annamalai K, Srikumar BN, Kutty BM, Shankaranarayana Rao BS. Enriched environment ameliorates chronic temporal lobe epilepsy-induced behavioral hyperexcitability and restores synaptic plasticity in CA3-CA1 synapses in male Wistar rats. J Neurosci Res. 2021;99:1646–65.10.1002/jnr.24823Search in Google Scholar PubMed
[7] Zhu H, Wang Z, Yu J, Yang X, He F, Liu Z, et al. Role and mechanisms of cytokines in the secondary brain injury after intracerebral hemorrhage. Prog Neurobiol. 2019;178:101610.10.1016/j.pneurobio.2019.03.003Search in Google Scholar PubMed
[8] Fox P, Mithal DS, Somogyi JR, Vien AC, Koh S. Dexamethasone after early-life seizures attenuates increased susceptibility to seizures, seizure-induced microglia activation and neuronal injury later in life. Neurosci Lett. 2020;728:134953.10.1016/j.neulet.2020.134953Search in Google Scholar PubMed
[9] Andoh M, Ikegaya Y, Koyama R. Synaptic pruning by microglia in epilepsy. J Clin Med. 2019;8:12.10.3390/jcm8122170Search in Google Scholar PubMed PubMed Central
[10] Dokalis N, Prinz M. Resolution of neuroinflammation: mechanisms and potential therapeutic option. Semin Immunopathol. 2019;41(6):699–709.10.1007/s00281-019-00764-1Search in Google Scholar PubMed
[11] Tian J, Shi R, Liu T, She R, Wu Q, An J, et al. Brain infection by hepatitis E virus probably via damage of the blood-brain barrier due to alterations of tight junction proteins. Front Cell Infect Microbiol. 2019;9:52.10.3389/fcimb.2019.00052Search in Google Scholar PubMed PubMed Central
[12] Walker MC. Pathophysiology of status epilepticus. Neurosci Lett. 2018;667:84–91.10.1016/j.neulet.2016.12.044Search in Google Scholar PubMed
[13] Gilchrist J, Dutton S, Diaz-Bustamante M, Mcpherson A, Olivares N, Kalia J, et al. Nav1.1 modulation by a novel triazole compound attenuates epileptic seizures in rodents. ACS Chem Biol. 2014;9(5):1204–12.10.1021/cb500108pSearch in Google Scholar PubMed PubMed Central
[14] Lin YC, Lai YC, Chou P, Hsueh SW, Lin TH, Huang CS, et al. How can a Na(+) channel inhibitor ameliorate seizures in Lennox-Gastaut syndrome? Ann Neurol. 2021;89:1099–113.10.1002/ana.26068Search in Google Scholar PubMed
[15] Park CW, Lee TK, Cho JH, Kim IH, Lee JC, Shin BN, et al. Rufinamide pretreatment attenuates ischemia-reperfusion injury in the gerbil hippocampus. Neurol Res. 2017;39(11):941–52.10.1080/01616412.2017.1362189Search in Google Scholar PubMed
[16] Gáll Z, Orbán-Kis K, Szilágyi T. Differential effects of sodium channel blockers on in vitro induced epileptiform activities. Arch Pharm Res. 2017;40(1):112–21.10.1007/s12272-015-0676-6Search in Google Scholar PubMed
[17] Feng J, Feng L, Zhang G. Mitochondrial damage in hippocampal neurons of rats with epileptic protein expression of Fas and caspase-3. Exp Ther Med. 2018;16(3):2483–9.10.3892/etm.2018.6439Search in Google Scholar PubMed PubMed Central
[18] Zhang J, Han Y, Zhao Y, Li Q, Jin H, Qin J. Inhibition of TRIB3 protects against neurotoxic injury induced by kainic acid in rats. Front Pharmacol. 2019;10:585.10.3389/fphar.2019.00585Search in Google Scholar PubMed PubMed Central
[19] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25(4):402–8.10.1006/meth.2001.1262Search in Google Scholar PubMed
[20] Reyes-Mendoza J, Morales T. Prolactin treatment reduces kainic acid-induced gliosis in the hippocampus of ovariectomized female rats. Brain Res. 2020;1746:147014.10.1016/j.brainres.2020.147014Search in Google Scholar PubMed
[21] Dambach H, Hinkerohe D, Prochnow N, Stienen MN, Moinfar Z, Haase CG, et al. Glia and epilepsy: experimental investigation of antiepileptic drugs in an astroglia/microglia co‐culture model of inflammation. Epilepsia. 2014;55(1):184–92.10.1111/epi.12473Search in Google Scholar PubMed
[22] Chan PS, Zhang C, Zuo Z, Kwan P, Baum L. In vitro transport assays of rufinamide, pregabalin, and zonisamide by human P-glycoprotein. Epilepsy Res. 2014;108(3):359–66.10.1016/j.eplepsyres.2014.01.011Search in Google Scholar PubMed
[23] Yu X, Zhou T, Yu H, Chang LY, Wei LL. Corilagin reduces the frequency of seizures and improves cognitive function in a rat model of chronic epilepsy. Med Sci Monit. 2018;24:2832–40.10.12659/MSM.906509Search in Google Scholar PubMed PubMed Central
[24] Krasniqi S, Daci A. Role of the angiotensin pathway and its target therapy in epilepsy management. Int J Mol Sci. 2019;20:3.10.3390/ijms20030726Search in Google Scholar PubMed PubMed Central
[25] Deeks ED, Scott LJ. Rufinamide. CNS Drugs. 2006;20(9):751–60.10.2165/00023210-200620090-00007Search in Google Scholar PubMed
[26] Striano P, McMurray R, Santamarina E, Falip M. Rufinamide for the treatment of Lennox-Gastaut syndrome: evidence from clinical trials and clinical practice. Epileptic Disord. 2018;20(1):13–29.10.1684/epd.2017.0950Search in Google Scholar PubMed
[27] Arroyo S. Rufinamide. Neurotherapeutics. 2007;4(1):155–62.10.1016/j.nurt.2006.11.006Search in Google Scholar PubMed PubMed Central
[28] Park SH, Sim YB, Lee JK, Lee JY, Suh HW. Characterization of temporal expressions of FOXO and pFOXO proteins in the hippocampus by kainic acid in mice: involvement of NMDA and non-NMDA receptors. Arch Pharm Res. 2016;39(5):660–7.10.1007/s12272-016-0733-9Search in Google Scholar PubMed
[29] Eyo UB, Murugan M, Wu LJ. Microglia-neuron communication in epilepsy. Glia. 2017;65(1):5–18.10.1002/glia.23006Search in Google Scholar PubMed PubMed Central
[30] Vezzani A, Aronica E, Mazarati A, Pittman QJ. Epilepsy and brain inflammation. Exp Neurol. 2013;244(SI):11–21.10.1016/j.expneurol.2011.09.033Search in Google Scholar PubMed
[31] Hoogland IC, Houbolt C, van Westerloo DJ, van Gool WA, van de Beek D. Systemic inflammation and microglial activation: systematic review of animal experiments. J Neuroinflamm. 2015;12:114.10.1186/s12974-015-0332-6Search in Google Scholar PubMed PubMed Central
[32] Vezzani A, French J, Bartfai T, Baram TZ. The role of inflammation in epilepsy. Nat Rev Neurol. 2011;7(1):31–40.10.1038/nrneurol.2010.178Search in Google Scholar PubMed PubMed Central
[33] Rana A, Musto AE. The role of inflammation in the development of epilepsy. J Neuroinflamm. 2018;15(1):144.10.1186/s12974-018-1192-7Search in Google Scholar PubMed PubMed Central
[34] Ambrogini P, Albertini MC, Betti M, Galati C, Lattanzi D, Savelli D, et al. Neurobiological correlates of alpha-tocopherol antiepileptogenic effects and microRNA expression modulation in a rat model of kainate-induced seizures. Mol Neurobiol. 2018;55(10):7822–38.10.1007/s12035-018-0946-7Search in Google Scholar PubMed PubMed Central
[35] Xu X, Yin D, Ren H, Gao W, Li F, Sun D, et al. Selective NLRP3 inflammasome inhibitor reduces neuroinflammation and improves long-term neurological outcomes in a murine model of traumatic brain injury. Neurobiol Dis. 2018;117:15–27.10.1016/j.nbd.2018.05.016Search in Google Scholar PubMed
[36] Kakinuma Y. Significance of vagus nerve function in terms of pathogenesis of psychosocial disorders. Neurochem Int. 2020;143:104934.10.1016/j.neuint.2020.104934Search in Google Scholar PubMed
[37] Profaci CP, Munji RN, Pulido RS, Daneman R. The blood-brain barrier in health and disease: important unanswered questions. J Exp Med. 2020;217:4.10.1084/jem.20190062Search in Google Scholar PubMed PubMed Central
[38] Tommonaro G, García-Font N, Vitale RM, Pejin B, Iodice C, Cañadas S, et al. Avarol derivatives as competitive AChE inhibitors, non hepatotoxic and neuroprotective agents for Alzheimer’s disease. Eur J Med Chem. 2016;122:326–38.10.1016/j.ejmech.2016.06.036Search in Google Scholar PubMed
[39] Pejin B, Iodice C, Tommonaro G, De Rosa S. Synthesis and biological activities of thio-avarol derivatives. J Nat Prod. 2008;71(11):1850–3.10.1021/np800318mSearch in Google Scholar PubMed
[40] Kim SY, Buckwalter M, Soreq H, Vezzani A, Kaufer D. Blood-brain barrier dysfunction-induced inflammatory signaling in brain pathology and epileptogenesis. Epilepsia. 2012;53(Suppl 6):37–44.10.1111/j.1528-1167.2012.03701.xSearch in Google Scholar PubMed PubMed Central
[41] Castañeda-Cabral JL, Colunga-Durán A, Ureña-Guerrero ME, Beas-Zárate C, Nuñez-Lumbreras MLA, Orozco-Suárez S, et al. Expression of VEGF- and tight junction-related proteins in the neocortical microvasculature of patients with drug-resistant temporal lobe epilepsy. Microvasc Res. 2020;132:104059.10.1016/j.mvr.2020.104059Search in Google Scholar PubMed
[42] Lv JM, Guo XM, Chen B, Lei Q, Pan YJ, Yang Q. The Noncompetitive AMPAR antagonist perampanel abrogates brain endothelial cell permeability in response to ischemia: involvement of claudin-5. Cell Mol Neurobiol. 2016;36(5):745–53.10.1007/s10571-015-0257-8Search in Google Scholar PubMed
[43] Ding YX, Eerduna GW, Duan SJ, Li T, Liu RX, Zhang LM, et al. Escin ameliorates the impairments of neurological function and blood brain barrier by inhibiting systemic inflammation in intracerebral hemorrhagic mice. Exp Neurol. 2020;337:113554.10.1016/j.expneurol.2020.113554Search in Google Scholar PubMed
[44] Chan PS, Zhang C, Zuo Z, Kwan P, Baum L. In vitro transport assays of rufinamide, pregabalin, and zonisamide by human P-glycoprotein. Epilepsy Res. 2014;108(3):359–66.10.1016/j.eplepsyres.2014.01.011Search in Google Scholar PubMed
© 2021 Huaxu Yu et al., published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Biomedical Sciences
- Research progress on the mechanism of orexin in pain regulation in different brain regions
- Adriamycin-resistant cells are significantly less fit than adriamycin-sensitive cells in cervical cancer
- Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
- Iris metastasis of diffuse large B-cell lymphoma misdiagnosed as primary angle-closure glaucoma: A case report and review of the literature
- LncRNA PVT1 promotes cervical cancer progression by sponging miR-503 to upregulate ARL2 expression
- Two new inflammatory markers related to the CURB-65 score for disease severity in patients with community-acquired pneumonia: The hypersensitive C-reactive protein to albumin ratio and fibrinogen to albumin ratio
- Circ_0091579 enhances the malignancy of hepatocellular carcinoma via miR-1287/PDK2 axis
- Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-κB signaling pathway
- Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats
- ABCB1 polymorphism in clopidogrel-treated Montenegrin patients
- Metabolic profiling of fatty acids in Tripterygium wilfordii multiglucoside- and triptolide-induced liver-injured rats
- miR-338-3p inhibits cell growth, invasion, and EMT process in neuroblastoma through targeting MMP-2
- Verification of neuroprotective effects of alpha-lipoic acid on chronic neuropathic pain in a chronic constriction injury rat model
- Circ_WWC3 overexpression decelerates the progression of osteosarcoma by regulating miR-421/PDE7B axis
- Knockdown of TUG1 rescues cardiomyocyte hypertrophy through targeting the miR-497/MEF2C axis
- MiR-146b-3p protects against AR42J cell injury in cerulein-induced acute pancreatitis model through targeting Anxa2
- miR-299-3p suppresses cell progression and induces apoptosis by downregulating PAX3 in gastric cancer
- Diabetes and COVID-19
- Discovery of novel potential KIT inhibitors for the treatment of gastrointestinal stromal tumor
- TEAD4 is a novel independent predictor of prognosis in LGG patients with IDH mutation
- circTLK1 facilitates the proliferation and metastasis of renal cell carcinoma by regulating miR-495-3p/CBL axis
- microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury
- Long noncoding RNA TUG1 regulates degradation of chondrocyte extracellular matrix via miR-320c/MMP-13 axis in osteoarthritis
- Duodenal adenocarcinoma with skin metastasis as initial manifestation: A case report
- Effects of Loofah cylindrica extract on learning and memory ability, brain tissue morphology, and immune function of aging mice
- Recombinant Bacteroides fragilis enterotoxin-1 (rBFT-1) promotes proliferation of colorectal cancer via CCL3-related molecular pathways
- Blocking circ_UBR4 suppressed proliferation, migration, and cell cycle progression of human vascular smooth muscle cells in atherosclerosis
- Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
- Downregulation of circ_0037655 impedes glioma formation and metastasis via the regulation of miR-1229-3p/ITGB8 axis
- Vitamin D deficiency and cardiovascular risk in type 2 diabetes population
- Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis
- Mechanisms of circular RNA circ_0066147 on pancreatic cancer progression
- lncRNA myocardial infarction-associated transcript (MIAT) knockdown alleviates LPS-induced chondrocytes inflammatory injury via regulating miR-488-3p/sex determining region Y-related HMG-box 11 (SOX11) axis
- Identification of circRNA circ-CSPP1 as a potent driver of colorectal cancer by directly targeting the miR-431/LASP1 axis
- Hyperhomocysteinemia exacerbates ischemia-reperfusion injury-induced acute kidney injury by mediating oxidative stress, DNA damage, JNK pathway, and apoptosis
- Potential prognostic markers and significant lncRNA–mRNA co-expression pairs in laryngeal squamous cell carcinoma
- Gamma irradiation-mediated inactivation of enveloped viruses with conservation of genome integrity: Potential application for SARS-CoV-2 inactivated vaccine development
- ADHFE1 is a correlative factor of patient survival in cancer
- The association of transcription factor Prox1 with the proliferation, migration, and invasion of lung cancer
- Is there a relationship between the prevalence of autoimmune thyroid disease and diabetic kidney disease?
- Immunoregulatory function of Dictyophora echinovolvata spore polysaccharides in immunocompromised mice induced by cyclophosphamide
- T cell epitopes of SARS-CoV-2 spike protein and conserved surface protein of Plasmodium malariae share sequence homology
- Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
- Long noncoding RNA HULC contributes to paclitaxel resistance in ovarian cancer via miR-137/ITGB8 axis
- Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
- Prognostic value of the neutrophil-to-lymphocyte ratio in acute organophosphorus pesticide poisoning
- Gastroprotective effects of diosgenin against HCl/ethanol-induced gastric mucosal injury through suppression of NF-κβ and myeloperoxidase activities
- Silencing of LINC00707 suppresses cell proliferation, migration, and invasion of osteosarcoma cells by modulating miR-338-3p/AHSA1 axis
- Successful extracorporeal membrane oxygenation resuscitation of patient with cardiogenic shock induced by phaeochromocytoma crisis mimicking hyperthyroidism: A case report
- Effects of miR-185-5p on replication of hepatitis C virus
- Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis
- Primary localized cutaneous nodular amyloidosis presenting as lymphatic malformation: A case report
- Multimodal magnetic resonance imaging analysis in the characteristics of Wilson’s disease: A case report and literature review
- Therapeutic potential of anticoagulant therapy in association with cytokine storm inhibition in severe cases of COVID-19: A case report
- Neoadjuvant immunotherapy combined with chemotherapy for locally advanced squamous cell lung carcinoma: A case report and literature review
- Rufinamide (RUF) suppresses inflammation and maintains the integrity of the blood–brain barrier during kainic acid-induced brain damage
- Inhibition of ADAM10 ameliorates doxorubicin-induced cardiac remodeling by suppressing N-cadherin cleavage
- Invasive ductal carcinoma and small lymphocytic lymphoma/chronic lymphocytic leukemia manifesting as a collision breast tumor: A case report and literature review
- Clonal diversity of the B cell receptor repertoire in patients with coronary in-stent restenosis and type 2 diabetes
- CTLA-4 promotes lymphoma progression through tumor stem cell enrichment and immunosuppression
- WDR74 promotes proliferation and metastasis in colorectal cancer cells through regulating the Wnt/β-catenin signaling pathway
- Down-regulation of IGHG1 enhances Protoporphyrin IX accumulation and inhibits hemin biosynthesis in colorectal cancer by suppressing the MEK-FECH axis
- Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
- Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway
- lncRNA NEAT1 regulates CYP1A2 and influences steroid-induced necrosis
- A two-microRNA signature predicts the progression of male thyroid cancer
- Isolation of microglia from retinas of chronic ocular hypertensive rats
- Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study
- Calcineurin Aβ gene knockdown inhibits transient outward potassium current ion channel remodeling in hypertrophic ventricular myocyte
- Aberrant expression of PI3K/AKT signaling is involved in apoptosis resistance of hepatocellular carcinoma
- Clinical significance of activated Wnt/β-catenin signaling in apoptosis inhibition of oral cancer
- circ_CHFR regulates ox-LDL-mediated cell proliferation, apoptosis, and EndoMT by miR-15a-5p/EGFR axis in human brain microvessel endothelial cells
- Resveratrol pretreatment mitigates LPS-induced acute lung injury by regulating conventional dendritic cells’ maturation and function
- Ubiquitin-conjugating enzyme E2T promotes tumor stem cell characteristics and migration of cervical cancer cells by regulating the GRP78/FAK pathway
- Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
- Protective effect of Lactobacillus-containing probiotics on intestinal mucosa of rats experiencing traumatic hemorrhagic shock
- Glucocorticoids induce osteonecrosis of the femoral head through the Hippo signaling pathway
- Endothelial cell-derived SSAO can increase MLC20 phosphorylation in VSMCs
- Downregulation of STOX1 is a novel prognostic biomarker for glioma patients
- miR-378a-3p regulates glioma cell chemosensitivity to cisplatin through IGF1R
- The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats
- TGF-β1-overexpressing mesenchymal stem cells reciprocally regulate Th17/Treg cells by regulating the expression of IFN-γ
- The influence of MTHFR genetic polymorphisms on methotrexate therapy in pediatric acute lymphoblastic leukemia
- Red blood cell distribution width-standard deviation but not red blood cell distribution width-coefficient of variation as a potential index for the diagnosis of iron-deficiency anemia in mid-pregnancy women
- Small cell neuroendocrine carcinoma expressing alpha fetoprotein in the endometrium
- Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers
- Molecular characterization and phylogenetic studies of Echinococcus granulosus and Taenia multiceps coenurus cysts in slaughtered sheep in Saudi Arabia
- ITGB5 mutation discovered in a Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
- ACTB and GAPDH appear at multiple SDS-PAGE positions, thus not suitable as reference genes for determining protein loading in techniques like Western blotting
- Facilitation of mouse skin-derived precursor growth and yield by optimizing plating density
- 3,4-Dihydroxyphenylethanol ameliorates lipopolysaccharide-induced septic cardiac injury in a murine model
- Downregulation of PITX2 inhibits the proliferation and migration of liver cancer cells and induces cell apoptosis
- Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B
- Novel predictor of the occurrence of DKA in T1DM patients without infection: A combination of neutrophil/lymphocyte ratio and white blood cells
- Investigation of molecular regulation mechanism under the pathophysiology of subarachnoid hemorrhage
- miR-25-3p protects renal tubular epithelial cells from apoptosis induced by renal IRI by targeting DKK3
- Bioengineering and Biotechnology
- Green fabrication of Co and Co3O4 nanoparticles and their biomedical applications: A review
- Agriculture
- Effects of inorganic and organic selenium sources on the growth performance of broilers in China: A meta-analysis
- Crop-livestock integration practices, knowledge, and attitudes among smallholder farmers: Hedging against climate change-induced shocks in semi-arid Zimbabwe
- Food Science and Nutrition
- Effect of food processing on the antioxidant activity of flavones from Polygonatum odoratum (Mill.) Druce
- Vitamin D and iodine status was associated with the risk and complication of type 2 diabetes mellitus in China
- Diversity of microbiota in Slovak summer ewes’ cheese “Bryndza”
- Comparison between voltammetric detection methods for abalone-flavoring liquid
- Composition of low-molecular-weight glutenin subunits in common wheat (Triticum aestivum L.) and their effects on the rheological properties of dough
- Application of culture, PCR, and PacBio sequencing for determination of microbial composition of milk from subclinical mastitis dairy cows of smallholder farms
- Investigating microplastics and potentially toxic elements contamination in canned Tuna, Salmon, and Sardine fishes from Taif markets, KSA
- From bench to bar side: Evaluating the red wine storage lesion
- Establishment of an iodine model for prevention of iodine-excess-induced thyroid dysfunction in pregnant women
- Plant Sciences
- Characterization of GMPP from Dendrobium huoshanense yielding GDP-D-mannose
- Comparative analysis of the SPL gene family in five Rosaceae species: Fragaria vesca, Malus domestica, Prunus persica, Rubus occidentalis, and Pyrus pyrifolia
- Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR
- Investigation of bioactivities of Taxus chinensis, Taxus cuspidata, and Taxus × media by gas chromatography-mass spectrometry
- Morphological structures and histochemistry of roots and shoots in Myricaria laxiflora (Tamaricaceae)
- Transcriptome analysis of resistance mechanism to potato wart disease
- In silico analysis of glycosyltransferase 2 family genes in duckweed (Spirodela polyrhiza) and its role in salt stress tolerance
- Comparative study on growth traits and ions regulation of zoysiagrasses under varied salinity treatments
- Role of MS1 homolog Ntms1 gene of tobacco infertility
- Biological characteristics and fungicide sensitivity of Pyricularia variabilis
- In silico/computational analysis of mevalonate pyrophosphate decarboxylase gene families in Campanulids
- Identification of novel drought-responsive miRNA regulatory network of drought stress response in common vetch (Vicia sativa)
- How photoautotrophy, photomixotrophy, and ventilation affect the stomata and fluorescence emission of pistachios rootstock?
- Apoplastic histochemical features of plant root walls that may facilitate ion uptake and retention
- Ecology and Environmental Sciences
- The impact of sewage sludge on the fungal communities in the rhizosphere and roots of barley and on barley yield
- Domestication of wild animals may provide a springboard for rapid variation of coronavirus
- Response of benthic invertebrate assemblages to seasonal and habitat condition in the Wewe River, Ashanti region (Ghana)
- Molecular record for the first authentication of Isaria cicadae from Vietnam
- Twig biomass allocation of Betula platyphylla in different habitats in Wudalianchi Volcano, northeast China
- Animal Sciences
- Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens
- Predators of the giant pine scale, Marchalina hellenica (Gennadius 1883; Hemiptera: Marchalinidae), out of its natural range in Turkey
- Honey in wound healing: An updated review
- NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block
- Radiotherapy for the treatment of pulmonary hydatidosis in sheep
- Retraction
- Retraction of “Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating microRNA-34a-5p/NOTCH1 signaling pathway”
- Special Issue on Reuse of Agro-Industrial By-Products
- An effect of positional isomerism of benzoic acid derivatives on antibacterial activity against Escherichia coli
- Special Issue on Computing and Artificial Techniques for Life Science Applications - Part II
- Relationship of Gensini score with retinal vessel diameter and arteriovenous ratio in senile CHD
- Effects of different enantiomers of amlodipine on lipid profiles and vasomotor factors in atherosclerotic rabbits
- Establishment of the New Zealand white rabbit animal model of fatty keratopathy associated with corneal neovascularization
- lncRNA MALAT1/miR-143 axis is a potential biomarker for in-stent restenosis and is involved in the multiplication of vascular smooth muscle cells
Articles in the same Issue
- Biomedical Sciences
- Research progress on the mechanism of orexin in pain regulation in different brain regions
- Adriamycin-resistant cells are significantly less fit than adriamycin-sensitive cells in cervical cancer
- Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
- Iris metastasis of diffuse large B-cell lymphoma misdiagnosed as primary angle-closure glaucoma: A case report and review of the literature
- LncRNA PVT1 promotes cervical cancer progression by sponging miR-503 to upregulate ARL2 expression
- Two new inflammatory markers related to the CURB-65 score for disease severity in patients with community-acquired pneumonia: The hypersensitive C-reactive protein to albumin ratio and fibrinogen to albumin ratio
- Circ_0091579 enhances the malignancy of hepatocellular carcinoma via miR-1287/PDK2 axis
- Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-κB signaling pathway
- Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats
- ABCB1 polymorphism in clopidogrel-treated Montenegrin patients
- Metabolic profiling of fatty acids in Tripterygium wilfordii multiglucoside- and triptolide-induced liver-injured rats
- miR-338-3p inhibits cell growth, invasion, and EMT process in neuroblastoma through targeting MMP-2
- Verification of neuroprotective effects of alpha-lipoic acid on chronic neuropathic pain in a chronic constriction injury rat model
- Circ_WWC3 overexpression decelerates the progression of osteosarcoma by regulating miR-421/PDE7B axis
- Knockdown of TUG1 rescues cardiomyocyte hypertrophy through targeting the miR-497/MEF2C axis
- MiR-146b-3p protects against AR42J cell injury in cerulein-induced acute pancreatitis model through targeting Anxa2
- miR-299-3p suppresses cell progression and induces apoptosis by downregulating PAX3 in gastric cancer
- Diabetes and COVID-19
- Discovery of novel potential KIT inhibitors for the treatment of gastrointestinal stromal tumor
- TEAD4 is a novel independent predictor of prognosis in LGG patients with IDH mutation
- circTLK1 facilitates the proliferation and metastasis of renal cell carcinoma by regulating miR-495-3p/CBL axis
- microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury
- Long noncoding RNA TUG1 regulates degradation of chondrocyte extracellular matrix via miR-320c/MMP-13 axis in osteoarthritis
- Duodenal adenocarcinoma with skin metastasis as initial manifestation: A case report
- Effects of Loofah cylindrica extract on learning and memory ability, brain tissue morphology, and immune function of aging mice
- Recombinant Bacteroides fragilis enterotoxin-1 (rBFT-1) promotes proliferation of colorectal cancer via CCL3-related molecular pathways
- Blocking circ_UBR4 suppressed proliferation, migration, and cell cycle progression of human vascular smooth muscle cells in atherosclerosis
- Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
- Downregulation of circ_0037655 impedes glioma formation and metastasis via the regulation of miR-1229-3p/ITGB8 axis
- Vitamin D deficiency and cardiovascular risk in type 2 diabetes population
- Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis
- Mechanisms of circular RNA circ_0066147 on pancreatic cancer progression
- lncRNA myocardial infarction-associated transcript (MIAT) knockdown alleviates LPS-induced chondrocytes inflammatory injury via regulating miR-488-3p/sex determining region Y-related HMG-box 11 (SOX11) axis
- Identification of circRNA circ-CSPP1 as a potent driver of colorectal cancer by directly targeting the miR-431/LASP1 axis
- Hyperhomocysteinemia exacerbates ischemia-reperfusion injury-induced acute kidney injury by mediating oxidative stress, DNA damage, JNK pathway, and apoptosis
- Potential prognostic markers and significant lncRNA–mRNA co-expression pairs in laryngeal squamous cell carcinoma
- Gamma irradiation-mediated inactivation of enveloped viruses with conservation of genome integrity: Potential application for SARS-CoV-2 inactivated vaccine development
- ADHFE1 is a correlative factor of patient survival in cancer
- The association of transcription factor Prox1 with the proliferation, migration, and invasion of lung cancer
- Is there a relationship between the prevalence of autoimmune thyroid disease and diabetic kidney disease?
- Immunoregulatory function of Dictyophora echinovolvata spore polysaccharides in immunocompromised mice induced by cyclophosphamide
- T cell epitopes of SARS-CoV-2 spike protein and conserved surface protein of Plasmodium malariae share sequence homology
- Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
- Long noncoding RNA HULC contributes to paclitaxel resistance in ovarian cancer via miR-137/ITGB8 axis
- Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
- Prognostic value of the neutrophil-to-lymphocyte ratio in acute organophosphorus pesticide poisoning
- Gastroprotective effects of diosgenin against HCl/ethanol-induced gastric mucosal injury through suppression of NF-κβ and myeloperoxidase activities
- Silencing of LINC00707 suppresses cell proliferation, migration, and invasion of osteosarcoma cells by modulating miR-338-3p/AHSA1 axis
- Successful extracorporeal membrane oxygenation resuscitation of patient with cardiogenic shock induced by phaeochromocytoma crisis mimicking hyperthyroidism: A case report
- Effects of miR-185-5p on replication of hepatitis C virus
- Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis
- Primary localized cutaneous nodular amyloidosis presenting as lymphatic malformation: A case report
- Multimodal magnetic resonance imaging analysis in the characteristics of Wilson’s disease: A case report and literature review
- Therapeutic potential of anticoagulant therapy in association with cytokine storm inhibition in severe cases of COVID-19: A case report
- Neoadjuvant immunotherapy combined with chemotherapy for locally advanced squamous cell lung carcinoma: A case report and literature review
- Rufinamide (RUF) suppresses inflammation and maintains the integrity of the blood–brain barrier during kainic acid-induced brain damage
- Inhibition of ADAM10 ameliorates doxorubicin-induced cardiac remodeling by suppressing N-cadherin cleavage
- Invasive ductal carcinoma and small lymphocytic lymphoma/chronic lymphocytic leukemia manifesting as a collision breast tumor: A case report and literature review
- Clonal diversity of the B cell receptor repertoire in patients with coronary in-stent restenosis and type 2 diabetes
- CTLA-4 promotes lymphoma progression through tumor stem cell enrichment and immunosuppression
- WDR74 promotes proliferation and metastasis in colorectal cancer cells through regulating the Wnt/β-catenin signaling pathway
- Down-regulation of IGHG1 enhances Protoporphyrin IX accumulation and inhibits hemin biosynthesis in colorectal cancer by suppressing the MEK-FECH axis
- Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
- Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway
- lncRNA NEAT1 regulates CYP1A2 and influences steroid-induced necrosis
- A two-microRNA signature predicts the progression of male thyroid cancer
- Isolation of microglia from retinas of chronic ocular hypertensive rats
- Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study
- Calcineurin Aβ gene knockdown inhibits transient outward potassium current ion channel remodeling in hypertrophic ventricular myocyte
- Aberrant expression of PI3K/AKT signaling is involved in apoptosis resistance of hepatocellular carcinoma
- Clinical significance of activated Wnt/β-catenin signaling in apoptosis inhibition of oral cancer
- circ_CHFR regulates ox-LDL-mediated cell proliferation, apoptosis, and EndoMT by miR-15a-5p/EGFR axis in human brain microvessel endothelial cells
- Resveratrol pretreatment mitigates LPS-induced acute lung injury by regulating conventional dendritic cells’ maturation and function
- Ubiquitin-conjugating enzyme E2T promotes tumor stem cell characteristics and migration of cervical cancer cells by regulating the GRP78/FAK pathway
- Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
- Protective effect of Lactobacillus-containing probiotics on intestinal mucosa of rats experiencing traumatic hemorrhagic shock
- Glucocorticoids induce osteonecrosis of the femoral head through the Hippo signaling pathway
- Endothelial cell-derived SSAO can increase MLC20 phosphorylation in VSMCs
- Downregulation of STOX1 is a novel prognostic biomarker for glioma patients
- miR-378a-3p regulates glioma cell chemosensitivity to cisplatin through IGF1R
- The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats
- TGF-β1-overexpressing mesenchymal stem cells reciprocally regulate Th17/Treg cells by regulating the expression of IFN-γ
- The influence of MTHFR genetic polymorphisms on methotrexate therapy in pediatric acute lymphoblastic leukemia
- Red blood cell distribution width-standard deviation but not red blood cell distribution width-coefficient of variation as a potential index for the diagnosis of iron-deficiency anemia in mid-pregnancy women
- Small cell neuroendocrine carcinoma expressing alpha fetoprotein in the endometrium
- Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers
- Molecular characterization and phylogenetic studies of Echinococcus granulosus and Taenia multiceps coenurus cysts in slaughtered sheep in Saudi Arabia
- ITGB5 mutation discovered in a Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
- ACTB and GAPDH appear at multiple SDS-PAGE positions, thus not suitable as reference genes for determining protein loading in techniques like Western blotting
- Facilitation of mouse skin-derived precursor growth and yield by optimizing plating density
- 3,4-Dihydroxyphenylethanol ameliorates lipopolysaccharide-induced septic cardiac injury in a murine model
- Downregulation of PITX2 inhibits the proliferation and migration of liver cancer cells and induces cell apoptosis
- Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B
- Novel predictor of the occurrence of DKA in T1DM patients without infection: A combination of neutrophil/lymphocyte ratio and white blood cells
- Investigation of molecular regulation mechanism under the pathophysiology of subarachnoid hemorrhage
- miR-25-3p protects renal tubular epithelial cells from apoptosis induced by renal IRI by targeting DKK3
- Bioengineering and Biotechnology
- Green fabrication of Co and Co3O4 nanoparticles and their biomedical applications: A review
- Agriculture
- Effects of inorganic and organic selenium sources on the growth performance of broilers in China: A meta-analysis
- Crop-livestock integration practices, knowledge, and attitudes among smallholder farmers: Hedging against climate change-induced shocks in semi-arid Zimbabwe
- Food Science and Nutrition
- Effect of food processing on the antioxidant activity of flavones from Polygonatum odoratum (Mill.) Druce
- Vitamin D and iodine status was associated with the risk and complication of type 2 diabetes mellitus in China
- Diversity of microbiota in Slovak summer ewes’ cheese “Bryndza”
- Comparison between voltammetric detection methods for abalone-flavoring liquid
- Composition of low-molecular-weight glutenin subunits in common wheat (Triticum aestivum L.) and their effects on the rheological properties of dough
- Application of culture, PCR, and PacBio sequencing for determination of microbial composition of milk from subclinical mastitis dairy cows of smallholder farms
- Investigating microplastics and potentially toxic elements contamination in canned Tuna, Salmon, and Sardine fishes from Taif markets, KSA
- From bench to bar side: Evaluating the red wine storage lesion
- Establishment of an iodine model for prevention of iodine-excess-induced thyroid dysfunction in pregnant women
- Plant Sciences
- Characterization of GMPP from Dendrobium huoshanense yielding GDP-D-mannose
- Comparative analysis of the SPL gene family in five Rosaceae species: Fragaria vesca, Malus domestica, Prunus persica, Rubus occidentalis, and Pyrus pyrifolia
- Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR
- Investigation of bioactivities of Taxus chinensis, Taxus cuspidata, and Taxus × media by gas chromatography-mass spectrometry
- Morphological structures and histochemistry of roots and shoots in Myricaria laxiflora (Tamaricaceae)
- Transcriptome analysis of resistance mechanism to potato wart disease
- In silico analysis of glycosyltransferase 2 family genes in duckweed (Spirodela polyrhiza) and its role in salt stress tolerance
- Comparative study on growth traits and ions regulation of zoysiagrasses under varied salinity treatments
- Role of MS1 homolog Ntms1 gene of tobacco infertility
- Biological characteristics and fungicide sensitivity of Pyricularia variabilis
- In silico/computational analysis of mevalonate pyrophosphate decarboxylase gene families in Campanulids
- Identification of novel drought-responsive miRNA regulatory network of drought stress response in common vetch (Vicia sativa)
- How photoautotrophy, photomixotrophy, and ventilation affect the stomata and fluorescence emission of pistachios rootstock?
- Apoplastic histochemical features of plant root walls that may facilitate ion uptake and retention
- Ecology and Environmental Sciences
- The impact of sewage sludge on the fungal communities in the rhizosphere and roots of barley and on barley yield
- Domestication of wild animals may provide a springboard for rapid variation of coronavirus
- Response of benthic invertebrate assemblages to seasonal and habitat condition in the Wewe River, Ashanti region (Ghana)
- Molecular record for the first authentication of Isaria cicadae from Vietnam
- Twig biomass allocation of Betula platyphylla in different habitats in Wudalianchi Volcano, northeast China
- Animal Sciences
- Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens
- Predators of the giant pine scale, Marchalina hellenica (Gennadius 1883; Hemiptera: Marchalinidae), out of its natural range in Turkey
- Honey in wound healing: An updated review
- NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block
- Radiotherapy for the treatment of pulmonary hydatidosis in sheep
- Retraction
- Retraction of “Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating microRNA-34a-5p/NOTCH1 signaling pathway”
- Special Issue on Reuse of Agro-Industrial By-Products
- An effect of positional isomerism of benzoic acid derivatives on antibacterial activity against Escherichia coli
- Special Issue on Computing and Artificial Techniques for Life Science Applications - Part II
- Relationship of Gensini score with retinal vessel diameter and arteriovenous ratio in senile CHD
- Effects of different enantiomers of amlodipine on lipid profiles and vasomotor factors in atherosclerotic rabbits
- Establishment of the New Zealand white rabbit animal model of fatty keratopathy associated with corneal neovascularization
- lncRNA MALAT1/miR-143 axis is a potential biomarker for in-stent restenosis and is involved in the multiplication of vascular smooth muscle cells