Startseite Lebenswissenschaften Molecular record for the first authentication of Isaria cicadae from Vietnam
Artikel Open Access

Molecular record for the first authentication of Isaria cicadae from Vietnam

  • Thuan Duc Lao , Hanh Van Trinh , Loi Vuong , Luyen Tien Vu , Thuy Ai Huyen Le , Hiep Minh Dinh und Nguyen Binh Truong EMAIL logo
Veröffentlicht/Copyright: 15. Juli 2021

Abstract

The entomopathogenic fungus T011, parasitizing on nymph of Cicada, collected in the coffee garden in Dak Lak Province, Vietnam, was preliminarily morphologically identified as Isaria cicadae, belonged to order Hypocreales and family Clavicipitaceae. To ensure the authenticity of T011, phylogenetic analysis of the concatenated set of multiple genes including ITS, nrLSU, nrSSU, Rpb1, and Tef1 was applied to support the identification. Genomic DNA was isolated from dried sample T011. The PCR assay sequencing was applied to amplify ITS, nrLSU, nrSSU, Rpb1, and Tef1 gene. For phylogenetic analysis, the concatenated data of both target gens were constructed with MEGAX with a 1,000 replicate bootstrap based on the neighbor-joining, maximum likelihood, maximum parsimony method. As the result, the concatenated data containing 62 sequences belonged to order Hypocreales, families Clavicipitaceae, and 2 outgroup sequences belonged to order Hypocreales, genus Verticillium. The phylogenetic analysis results indicated that T011 was accepted at subclade Cordyceps and significantly formed the monophyletic group with referent Cordyceps cicadae (Telemorph of Isaria cicadae) with high bootstrap value. The phylogenetically analyzed result was strongly supported by our morphological analysis described as the Isaria cicadae. In summary, phylogenetic analyses based on the concatenated dataset were successfully applied to strengthen the identification of T011 as Isaria cicadae.

1 Introduction

Isaria cicadae Miq., Bull. Sci. phys. nat. néerl.: 86 (1838) (Mycobank: MB#204858), also known Cordyceps cicadae (Miq.) Massee (1895) (Mycobank: MB#311793), is the entomopathogenic fungi capable of parasitizing on cicada nymph, belongs to the order Hypocreales, and the family Clavicipitaceae [4,5]. C. cicadae usually distribute in many regions of the world with temperatures ranging from 18 to 24°C, relative humidity of >80°C, and grows vertically on the sunny slopes at an attitude of 700–950 m [3]. The distribution of C. cicadae is recorded in China (Province of Yunan, Sichuan, Guizhou, Jiangsu, Guangdong, Hunan, Hubei, etc.), Korea (Jeju Island), and Japan (South of Fukushima). Furthermore, C. cicadae is also seen in Thailand, North America, and Europe [3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24].

Due to their numerous bioactivities, I. cicadae, as well as C. cicadae, is considered the most valued traditional Chinese medicine. Its medicinal bioactive components, such as adenosine, cordycepin, ergosterol, etc., which have been used to relieve exhaustion remedy, treat numerous diseases, such as antitumor activities, and food source, have been recorded [3,19,20,21,22]. To obtain precious valued herbal medicine, the exploration and collection of local I. cicadae (C. cicadae) play an important role to apply for further medicinal applications. During our expedition to validate the fungal diversity in Ea Knop Town – Ea Kar District (Latitude: 12°34′26″N–13°02′09″N; Longitude: 108°22′08″E–108°43′2″E) located in Dak Lak Province, we collected the sample T011, parasitizing on the nymph of Cicada, which was classified and confirmed by the specialist on the entomologist, Faculty of Biotechnology, Ho Chi Minh City Open University, Ho Chi Minh City, Vietnam. In this paper, to ensure the origin and authenticity of T011 as I. cicadae, we conducted the morphology analysis and molecular phylogenetic analysis of the concatenated set genes including ITS, nrLSU, nrSSU, Rpb1, and Tef1.

2 Materials and methods

2.1 Sample collection

The specimen T011, parasitizing on the nymph of Cicada, was collected in the coffee garden in Ea Knop Town – Ea Kar District, Dak Lak Province on the morning of June 24, 2018. In the laboratory, the specimen was conditioned to be dried at 60°C and stored for further analysis.

2.2 Morphology analysis

Macroscopic characteristics of the fresh body were carefully observed in the many macroscopic characteristics. For the microscopic analysis, a bunch of conidiogenous cells was cut into small species, then, soaked in the water for about 3 min. A sample of the synemata containing the conidiogenous cells was immersed in distilled water for 3 min. Asexual spores were removed using a clean brush. The fertile part was then analyzed under a microscope. Conidia size was recorded. According to the identification of conidia, phialides, and colony coloration, the isolate cultures were grown on YMG media, composed of 4 g/L Yeast extract, 10 g/L Malt extract, 4 g/L Glucose, incubated at 20°C within a period of 20 days.

2.3 DNA extraction, PCR amplification, target gene sequencing

Genomic DNA was extracted from dried material by using the phenol/chloroform method (pH = 8). The dried material was added to a lysis buffer (2.0% SDS, Tris-HCl pH 8.0, 150 mM NaCl, 10 mM EDTA, 0.1 mg/mL Proteinase K). During the incubation at 65°C for overnight, it was mixed thoroughly by inverting the tube several times. Then, the supernatant was collected by centrifugation. About 700 μL of phenol/chloroform/isoamyl alcohol at a ratio of 25:24:1 was added and centrifuged. The upper solution was collected, precipitated with absolute ethanol, and washed with 70% ethanol. DNA concentration was identified by using OD260. Finally, isolated genomic DNA was stored in Tris-EDTA buffer at −20°C for further studies.

The primer pairs used to amplify ITS, nrLSU, nrSSU, Rpb1, and Tef1 region were shown in Table 1. The final volume for PCR was done in the total of 15 μL with the thermal program: 1 cycle for 95°C for 5 min; 40 cycles of 95°C for 30 s, X°C for 30 s, 72°C for 2 min; 1 cycle for 72°C for 5 min (Note: X°C is the annealing temperatures for each target gene, shown in Table 1). About 5 μL aliquots of amplification products were electrophoresed on a 2.0% agarose gel and visualized in a UV transilluminator. The amplified product was sequenced at Nam Khoa (Vietnam) company.

Table 1

The primers’ sequences used in this study

Target gene Primer Sequence (5′–3′) T a (°C) Reference
nrLSU LR0R (F) GTACCCGCTGAACTTAAGC 55 [18]
LR5 (R) ATCCTGAGGGAAACTTC
nrSSU NS1 (F) GTAGTCATATGCTTGTCTC 42.2 [20]
NS4 (R) CTTCCGTCAATTCCTTTAAG
ITS ITS1F CTTGGTCATTTAGAGGAAGTAA 55 [20]
ITS4 TCCTCCGCTTATTGATATGC
Rpb1 CRPB1 CCWGGYTTYATCAAGAARGT 46.3 [13]
RPB1Cr CCNGCDATNTCRTTRTCCATRTA
Tef1 983F GCYCCYGGHCAYCGTGAYTTYAT 55 [2]
2218R ATGACACCRACRGCRACRGTYTG

Note: F: forward primer; R: reverse primer; T a: annealing temperature.

2.4 Taxa and ITS, nrLSU, nrSSU, Rpb1, and Tef1 sequences collection, DNA proofreading, and phylogeny analysis

The data set of ITS, nrLSU, nrSSU, Rpb1, and Tef1 sequences were established by sequences downloaded from Genbank (NCBI) and based on the previous data published by Sung et al. (2007) [16]. The ITS, nrLSU, nrSSU, Rpb1, and Tef1 were noted with accession number, name of taxon, and locality. The multiple gene data used in the current study were established based on the combination of ITS, nrLSU, nrSSU, Rpb1, and Tef1 data. The amplified DNA sequences were proofread to remove ambiguous signals at both ends by different software, including Seaview 4.2.12 and Chromas Lite 2.1.1. The phylogenetic tree was constructed based on the neighbor-joining (NJ), maximum parsimony (MP), and maximum likelihood (ML) by using Molecular Evolutionary Genetics Analysis (MEGA) version X. Additionally, the best evolution model was predicted by using jModelTest.

3 Results

3.1 Morphology analysis

The sample of T011 was collected in the soil of the coffee garden on the morning of June 24, 2018. The synnemata were emerging from the soil, while the host was in the soil. Host: unidentified cicada nymph. Synnemata: presence, branching, 15–60 mm in length × 1.0–2.5 mm in diameter. Synnemata originated from the head of cicada nymphs with the thick layer of mycelia (hiding under the ground). Color: white to cream. Form: simple, erect, and distinguishing form fertile part and stipe. Fertile part: a dense white powdery covering on the surface due to the presence of a mass of conidia. Phialides: grouped inside the fertile part. Conidia: hyaline to white, cylindrical, 4.7–6.5 µm in length × 2.6–3.1 µm in diameter. Colonies from cultures on PDA: floccose and white, then becoming powdery by the conidiation of aerial hyphae. Conidia from the mycelia: smaller than those of from synnemata (Figure 1).

Figure 1 
                  Morphology of Isaria cicadae: (a) Synemata forming from Cicadae, (b) Phialides, (c) conidia, (d) mycelia after 30 days on PDA media, (e) chain of conidia, and (f) conidia from mycelia. The bar scale indicated 10 µm.
Figure 1

Morphology of Isaria cicadae: (a) Synemata forming from Cicadae, (b) Phialides, (c) conidia, (d) mycelia after 30 days on PDA media, (e) chain of conidia, and (f) conidia from mycelia. The bar scale indicated 10 µm.

3.2 Amplification of ITS, nrLSU, nrSSU, Rpb1, and Tef1 gene

Isolated genomic DNA was amplified with the described primers; then, electrophoresis on 2.0% agarose gel showed a significant and clear band of gene ITS: 700 bps, nrLSU: 950 bps, nrSSU: 1,102 bps, Rpb1: 803 bps, and Tef1: 1,020 bps. The PCR product was sequenced. Sequencing signals of both strands of both target genes were unique and good for reading (data not shown). According to BLAST results, the ITS, nrLSU, nrSSU, Rpb1, and Tef1 of T011 were similar to ITS, nrLSU, nrSSU, Rpb1, and Tef1 of C. cicadae (Telemorph of I. cicadae) (Table 2).

Table 2

BLAST results of T011 specimen’s ITS, nrLSU, nrSSU, Rpb1, and Tef1

Target gene BLAST description Total score Per. Ident. E-value Accession
nrLSU-F Cordyceps cicadae 1,509 100.00 0.0 MH879588
nrLSU-R Cordyceps cicadae 1,509 99.64 0.0 MH879588
nrSSU-F Cordyceps cicadae 1,109 100.00 0.0 MH879636
nrSSU-R Cordyceps cicadae 1,048 99.65 0.0 MH879636
ITS-F Cordyceps cicadae 1,000 99.82 0.0 MT555324
ITS-R Cordyceps cicadae 1,444 99.82 0.0 MN128643
Tef1-F Cordyceps cicadae 1,729 99.17 0.0 MH879662
Tef1-R Cordyceps cicadae 1,676 98.33 0.0 MN576985
Rpb1-F Cordyceps cicadae 1,247 100.00 0.0 MN913552
Rpb1-F Cordyceps cicadae 1,280 99.57 0.0 MN576876

Note: F: forward sequence; R: reverse sequence; Per. Ident.: percentage of identity.

3.3 The systematic concatenated ITS, nrLSU, nrSSU, Rpb1, and Tef1 dataset and phylogeny analysis

Total of 62 sequences of ITS, nrLSU, nrSSU, Rpb1, and Tef1 belonged to order Hypocreales, families Clavicipitaceae (served as referent data), and 2 sequences belonged to order Hypocreales, genus Verticillium (served as outgroup) were collected from Genbank and listed in Table 3 and T011 sequence. According to 62 sequences, they were divided into three families (Cordycipitaceae, Clavicipitaceae, Ophiocordycipitaceae), and each family was also divided intro genus, including Cordycipitaceae (genus: Cordyceps, Beauveria, Simplicillium, Lecanicillium), Clavicipitaceae (genus: Claviceps, Balansia, Pochonia, Conoideocrella, Metapochonia, Metarhizium), and Ophiocordycipitaceae (genus: Drechmeria, Ophiocordyceps). The best-fit model of DNA evolution for the analyses was obtained using the jModelTest2. Results are shown from General Time Reversible and Gramma distributed with invariant Sites (G + I) with the following parameters: parameters = 109, BIC = 42628.811, lnL = −20671.999, (+I) = 0.450, (+G) = 0.466, R = 2.186, f(A) = 0.246, f(T) = 0.221, f(G) = 0.257, f(C) = 0.276, r(AT) = 0.030, r(AC) = 0.040, r(AG) = 0.110, r(TA) = 0.030, r(TC) = 0.260, r(TG) = 0.040, r(CA) = 0.040, r(CT) = 0.220, r(CG) = 0.050, r(GA) = 0.100, r(GT) = 0.330, and r(GC) = 0.040. This model was used to construct phylogenetic trees using maximum likelihood from concatenated data set. Phylogenetic analysis was presented in Figure 2. As the results, the Clavicipitaceae formed a strong monophyletic group and separated from the out group. All the species in our dataset formed threes clades that were previously reported. According to T011, the T011 multiple gene sequences (ITS, nrLSU, nrSSU, Rpb1, and Tef1) formed a group with referent sequences of C. cicadae, Cordyceps sp., and Isaria sp., belonged to the clade Clavicipitaceae, subclade Cordyceps, with the high supported bootstrap values: 100, 100, 100 for NJ, MP, ML method (Figure 2, blanket). Therefore, the molecular identification indicated that T011 was identified as I. cicadae (anamorph of C. cicadae).

Table 3

The concatenated dataset of ITS, nrLSU, nrSSU, Rpb1, and Tef1 genes used for the construction of phylogenetic trees

No. Taxon Genus Accession
nrLSU nrSSU Rbp1 Tef1 ITS
1 Balansia pilulaeformis Balansia AF543788 AF543764 DQ522365 DQ522319 JN049816
2 Beauveria caledonica Beauveria AF339520 AF339570 EF469086 EF469057 HQ880817
3 Beauveria scarabaeidicola Beauveria AF339524 AF339574 DQ522380 DQ522335 JN049827
4 Beauveria staphylinidicola Beauveria EF468836 EF468981 EF468881 EF468776
5 Claviceps fusiformis Claviceps U17402 DQ522539 DQ522366 DQ522320 JN049817
6 Claviceps paspali Claviceps U47826 U32401 DQ522367 DQ522321 JN049818
7 Claviceps purpurea Claviceps AF543789 AF543765 AY489648 AF543778 KJ529004
8 Claviceps purpurea Claviceps EF469075 EF469122 EF469087 EF469058 KX977396
9 Conoideocrella luteorostrata Conoideocrella EF468850 EF468995 EF468906 EF468801 JN049859
10 Conoideocrella luteorostrata Conoideocrella EF468849 EF468994 EF468905 EF468800 JN049860
11 Cordyceps cardinalis Cordyceps sp. AY184963 AY184974 EF469088 EF469059
12 Cordyceps cf. pruinosa Cordyceps EF468820 EF468965 EF468868 EF468760
13 Cordyceps cf. pruinosa Cordyceps EF468821 EF468966 EF468869 EF468762
14 Cordyceps cf. pruinosa Cordyceps EF468823 EF468968 EF468871 EF468761
15 Cordyceps cicadae Cordyceps MH879588 MH879636 MH885438 MH879662 MF803085
16 Cordyceps kyusyuensis Cordyceps EF468813 EF468960 EF468863 EF468754 EF368021
17 Cordyceps militaris Cordyceps AY184966 AY184977 DQ522377 DQ522332 JN049825
18 Cordyceps pruinosa Cordyceps AY184968 AY184979 DQ522397 DQ522351 JN049826
19 Cordyceps sp. MT239107 MT268242 MT268246 MT192488
20 Drechmeria balanoides Drechmeria AF339539 AF339588 DQ522388 DQ522342 EF546660
21 Drechmeria zeospora Drechmeria AF339589 EF469091 EF469062
22 Isaria sp. MT239106 MT268241 MT268245 MT192487
23 Isaria sp. MT555409 MT637810 MT555325
24 Lecanicillium antillanum Lecanicillium AF339536 AF339585 DQ522396 DQ522350 MH861888
25 Lecanicillium fusisporum Lecanicillium AF339549 AF339598 EF468889 EF468783 MH859538
26 Lecanicillium psalliotae Lecanicillium AF339559 AF339608 EF468890 EF468784 N049846
27 Lecanicillium tenuipes Lecanicillium AF339526 AF339576 DQ522387 DQ522341 JN036556
28 Metarhizium guizhouense Metarhizium AF543787 AF543763 DQ522383 AF543775 JN049829
29 Pochonia chlamydosporia Pochonia DQ518758 DQ522544 DQ522372 DQ522327 JN049821
30 Metapochonia bulbillosa Metapochonia AF339542 AF339591 EF468902 EF468796 EU999952
31 Metapochonia rubescens Metapochonia AF339566 AF339615 EF468903 EF468797 MH862138
32 Metarhizium anisopliae Metarhizium AF339530 AF339579 DQ522399 AF543774 JN049834
33 Metarhizium carneum Metarhizium EF468842 EF468989 EF468895 EF468788 AY624170
34 Metarhizium carneum Metarhizium EF468843 EF468988 EF468894 EF468789 AY624171
35 Metarhizium flavoviride Metarhizium AF339531 AF339580 DQ522400 DQ522353 AF138271
36 Ophiocordyceps acicularis Ophiocordyceps EF468805 EF468950 EF468852 EF468744 JN049820
37 Ophiocordyceps acicularis Ophiocordyceps EF468804 EF468951 EF468853 EF468745
38 Ophiocordyceps aphodii Ophiocordyceps DQ518755 DQ522541 DQ522323
39 Ophiocordyceps entomorrhiza Ophiocordyceps EF468809 EF468954 EF468857 EF468749 JN049850
40 Ophiocordyceps melolonthae Ophiocordyceps DQ518762 DQ522548 DQ522376 DQ522331 KF937353
41 Ophiocordyceps stylophora Ophiocordyceps EF468837 EF468982 EF468882 EF468777
42 Ophiocordyceps stylophora Ophiocordyceps DQ518766 DQ522552 DQ522382 DQ522337 JN049828
43 Ophiocordyceps unilateralis Ophiocordyceps DQ518768 DQ522554 DQ522385 DQ522339 AY494596
44 Ophiocordyceps variabilis Ophiocordyceps EF468839 EF468985 EF468885 EF468779
45 Ophiocordyceps variabilis Ophiocordyceps DQ518769 DQ522555 DQ522386
46 Ophiocordyceps gracilis Ophiocordyceps EF468810 EF468955 EF468858 EF468750 HM119586
47 Ophiocordyceps gracilis Ophiocordyceps EF468811 EF468956 EF468859 EF468751 JN049851
48 Ophiocordyceps heteropoda Ophiocordyceps AY489722 AY489690 AY489651 AY489617
49 Ophiocordyceps heteropoda Ophiocordyceps EF468812 EF468957 EF468860 EF468752 JN049852
50 Ophiocordyceps nigrella Ophiocordyceps EF468818 EF468963 EF468866 EF468758 JN049853
51 Ophiocordyceps rhizoidea Ophiocordyceps EF468825 EF468970 EF468873 EF467764 JN049857
52 Ophiocordyceps rhizoidea Ophiocordyceps EF468824 EF468969 EF468872 EF468765 GU723769
53 Ophiocordyceps robertsii Ophiocordyceps EF468826 EF468766 AJ309335
54 Ophiocordyceps sobolifera Ophiocordyceps KJ878898 KJ878933 KJ879013 KJ878979 KT281884
55 Cordyceps ninchukispora Cordyceps EF468846 EF468991 EF468900 EF468795 AY245642
56 Pochonia chlamydosporia Pochonia AF339544 AF339593 EF469098 EF469069 MH858871
57 Simplicillium lamellicola Simplicillium AF339552 AF339601 DQ522404 DQ522356 MH854806
58 Simplicillium lanosoniveum Simplicillium AF339554 AF339603 DQ522405 DQ522357 AJ292395
59 Simplicillium lanosoniveum Simplicillium AF339553 AF339602 DQ522406 DQ522358 AJ292396
60 Simplicillium obclavatum Simplicillium AF339517 AF339567 EF468798 MH860859
61 Tolypocladium longisegmentum Tolypocladium EF468816 EF468864
62 Tolypocladium fractum Tolypocladium DQ518759 DQ522545 DQ522373 DQ522328
63 Glomerella cingulata Polycephalomyces AF543786 AF543762 AY489659 AF543773 EU326204
64 Glomerella cingulata Polycephalomyces U48428 U48427 DQ858454 AF543772 EU326192
Figure 2 
                  Phylogenetic relationships among T011 and concatenated data set based on the analysis of ML method with bootstrap 1,000. The support values associated with each internal branch correspond to NJ, MP, ML method, indicating that T011 was closely related to C. cicadae (Teleomorph of I. cicadae).
Figure 2

Phylogenetic relationships among T011 and concatenated data set based on the analysis of ML method with bootstrap 1,000. The support values associated with each internal branch correspond to NJ, MP, ML method, indicating that T011 was closely related to C. cicadae (Teleomorph of I. cicadae).

4 Discussion

Morphology analysis indicated that T011 is Isaria cicadae, belonged to the family of Cordycipitaceae. Based on the morphology analysis, our specimen T011 shared the common features of Isaria cicadae Miq. Bull. Sci. phys. nat. Néerl.: 85 (1838) [17], including: (1) specimen grew in the soil, (2) parasite on the nymph of cicada, (3) synnemata were simple and erect with branching, white to cream, (4) colonies were floccose, white and turned into powdery with age, and (5) conidia: hyaline to white, cylindrical, large (T011: 4.7–6.5 × 2.6–3.1 mm, and referent: 3.5–8.0 × 1.5–3.5 µm).

To confirm the authenticity of T011 as Isaria cicadae, the construction of ITS, nrLSU, nrSSU, Rpb1, and Tef1-based phylogeny was performed. According to Mitchell et al. (1995), they suggested that molecular phylogenetic approaches to fungal evolution have proved valuable information toward the goals of understanding the relationship among the specific fungal groups [8]. Additionally, the use of fungal molecular data, including ITS, nrLSU, nrSSU, Rpb1, and Tef1, for the identification of fungi ushered in a new era of molecular phylogenetic sequence identification in kingdom Fungi [1,12]. In this study, the combination of ITS, nrLSU, nrSSU, Rpb1, and Tef1 genes were applied to strongly strengthen the identification of T011, which was classified as I. cicadae. According to phylogenetic analysis, phylogenetic analysis of ITS, nrLSU, nrSSU, Rpb1, and Tef1 yielded consistent topology in different taxa of Clavicipitaceae. The phylogenetic position of T011 was obtained and accepted at subclade level: Cordyceps. Notably, within this clade, the highly supported monophyletic group with referent C. cicadae was obtained with high bootstrap value (Bootstrap >95: NJ: 100; MP: 100; ML: 100) and separated this group from other referent taxon in subclade Cordyceps, such as C. ninchukispora, C. pruinosa, and C. kyusyuensis. Additionally, T011 formed the group with referent C. cicadae, Cordyceps sp., and Isaria sp. Among them, Cordyceps sp. and Isaria sp. were proposed using the ancient Chinese name “chanhua” (Cordyceps chanhua) [25]. Therefore, based on the phylogenetic analysis, the T011 was identified as the Isaria cicadae (anamorph of C. cicadae), which was strongly similar to Cordyceps chanhua. Therefore, we have successfully applied the phylogenetic analyses based on the concatenated dataset to strengthen the identification of T011, collected in the local coffee garden in Ea Knop Town – Ea Kar District, as I. cicadae (anamorph of C. cicadae).

5 Conclusion

We have successfully applied the phylogenetic analysis of multiple genes of ITS, nrLSU, nrSSU, Rpb1, and Tef1 to demimit sample T011, which was collected in Ea Knop Town – Ea Kar District, Đak Lak Province, was strongly supported as Isaria cicadae (anamorph of C. cicadae), which was similar to our preliminary identification. This is the first molecular record of Isaria cicadae in Vietnam.


Equal contributors.


Acknowledgments

We express our special thanks to National Foundation For Science and Technology Development (NAFOSTED), Vietnam, and Ho Chi Minh City Open University for the genuine support throughout this research work.

  1. Funding information: The research was funded by National Foundation For Science and Technology Development (NAFOSTED): 106-NN.06.2015.44, Vietnam, and Ho Chi Minh City Open University under the grant number E2019.06.3.

  2. Conflict of interest: The authors state no conflict of interest.

  3. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Bruns TD, White TJ, Taylor JW. Fungal molecular systematics. Annu Rev Ecol Evol Syst. 1991;22:525–64.10.1146/annurev.es.22.110191.002521Suche in Google Scholar

[2] Castlebury LA, Rossman AY, Sung G-H, Hyten AS, Spatafora JW. Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycol Res. 2004;108:864–72.10.1017/S0953756204000607Suche in Google Scholar

[3] Hsu JH, Jhou BY, Yeh SH, Chen YI, Chen CC. Healthcare functions of Cordyceps cicadae. J Nutr Food Sci. 2015;5:432. 10.4172/2155-9600.1000432.Suche in Google Scholar

[4] Kobayasi Y, Shimizu D. Monographic studies of Cordyceps 2: group parasitic on Cicadae. Bull Natl Sci Mus. 1963;6:286–314.Suche in Google Scholar

[5] Li L, Zhang T, Li C, Xie L, Li N, Hou T, et al. Potential therapeutic effects of Cordyceps cicadae and Paecilomyces cicadae on adenine-induced chronic renal failure in rats and their phytochemical analysis. Drug Design Dev Ther. 2018;13:103–17. 10.2147/DDDT.S180543.Suche in Google Scholar

[6] Liu T, Liu Z, Yao X, Huang Y, Qu Q, Shi X, et al. Identification of cordycepin biosynthesis-related genes through de novo transcriptome assembly and analysis in Cordyceps cicadae. R Soc Open Sci. 2018;5(12):181247. 10.1098/rsos.181247.Suche in Google Scholar

[7] Luangsa-ard JJ, Hywel-Jones NL, Manoch L, Samson RA. On the relationships of Paecilomyces sect. Isarioidea species. Mycol Res. 2005;109(Pt 5):581–9. 10.1017/s0953756205002741.Suche in Google Scholar

[8] Mitchell JI, Roberts PJ, Moss ST. Sequence or structure: a short review on the application of nucleic acid sequence information to fungal taxonomy. Mycologist. 1995;9:67–76. 10.1016/S0269-915X(09)80212-7.Suche in Google Scholar

[9] Olatunji OJ, Feng Y, Olatunji OO, Tang J, Ouyang Z, Su Z. Neuroprotective effects of adenosine isolated from Isaria cicadae against oxidative and ER stress damages induced by glutamate in PC12 cells. Environ Toxicol Pharmacol. 2016;44:53–61. 10.1016/j.etap.2016.02.009.Suche in Google Scholar PubMed

[10] Paterson RR. Cordyceps: a traditional Chinese medicine and another fungal therapeutic biofactory? Phytochemistry. 2008;69(7):1469–95. 10.1016/j.phytochem.2008.01.027.Suche in Google Scholar PubMed PubMed Central

[11] Prayook S, Siripuk S, Panida L. First report of Cordyceps sp. isolated from Cicada in Northeastern Thailand and their characterizations. J Biol Sci. 2013;13:587–95. 10.3923/jbs.2013.587.595.Suche in Google Scholar

[12] Raja HA, Miller AN, Pearce CJ, Oberlies NH. Fungal identification using molecular tools: a primer for the natural products research community. J Nat Products. 2017;80(3):756–70. 10.1021/acs.jnatprod.6b01085.Suche in Google Scholar

[13] Rehner S. Primers for elongation factor 1-a (EF1-a). Beltsville, MD, USA: Insect Biocontrol Laboratory USDA, ARS, PSI; 2001. p. 4. 1p. Available online: http://ocid.NACSE.ORG/research/deephyphae/EF1primer.pdf.Suche in Google Scholar

[14] Shi Z, Pan HJ, Fan LF. Advances in research of polysaccharides in Cordyceps species. Food Technol Biotechnol. 2009;47(3):304–12.Suche in Google Scholar

[15] Sun YF, Sun Y, Wang ZA, Han RL, Lu HF, Zhang JL, et al. Isaria Cicadae conidia possess antiproliferative and inducing apoptosis properties in gynaecological carcinoma cells. Mycology. 2017;8(4):327–34. 10.1080/21501203.2017.1386243.Suche in Google Scholar

[16] Sung GH, Hywel-Jones NL, Sung JM, Luangsa-Ard JJ, Shrestha B, Spatafora JW. Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Stud Mycol. 2007;57:5–59. 10.3114/sim.2007.57.01.Suche in Google Scholar

[17] Vilgalys R, Hester M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J Bacteriol. 1990;172:4238–46. 10.1128/jb.172.8.4238-4246.1990.Suche in Google Scholar

[18] Vilgalys R, Hester M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J Bacteriol. 1990;172:4238–46. 10.1128/jb.172.8.4238-4246.1990.Suche in Google Scholar

[19] Weng SC, Chou CJ, Lin LC, Tsai WJ, Kuo YC. Immunomodulatory functions of extracts from the Chinese medicinal fungus Isaria cicadae. J Ethnopharmacol. 2002;83:79–85. 10.1016/s0378-8741(02)00212-x.Suche in Google Scholar

[20] White TJ, Bruns T, Lee S, Taylor J. PCR protocols. San Diego: Academic Press, Inc; 1990. p. 315–22. 10.1016/B978-0-12-372180-8.50042-1.Suche in Google Scholar

[21] Xiao JH, Zhong JJ. Secondary metabolites from Cordyceps species and their antitumor activity studies. Recent Pat Biotechnol. 2007;1(2):123–37. 10.2174/187220807780809454.Suche in Google Scholar PubMed

[22] Xie H, Li X, Chen Y, Lang M, Shen Z, Shi L. Ethanolic extract of Cordyceps cicadae exerts antitumor effect on human gastric cancer SGC-7901 cells by inducing apoptosis, cell cycle arrest and endoplasmic reticulum stress. J Ethnopharmacol. 2019;231:230–40. 10.1016/j.jep.2018.11.028.Suche in Google Scholar PubMed

[23] Zeng WB, Yu H, Ge F, Yang JY, Chen ZH, Wang YB, et al. Distribution of nucleosides in populations of Cordyceps cicadae. Molecules. 2014;19(5):6123–41. 10.3390/molecules19056123.Suche in Google Scholar PubMed PubMed Central

[24] Zhang CB, Wang YL, Yi M, Dong DC, Su XQ. Identification and phylogenetic analysis of the strain isolated from infected Platylomia pieli in Mopan Mountain, Tianwang Town, Jiangsu province. Guangdong Agric Sci. 2013;40:152–4.Suche in Google Scholar

[25] Li ZZ, Luan FG, Hywel-Jones Nigel L, Zhang SL, Chen MJ, Huang B, et al. Biodiversity of cordycipitoid fungi associated with Isaria cicadae Miquel II: teleomorph discovery and nomenclature of chanhua, an important medicinal fungus in China. Mycosystema. 2021;40(2):1–12.Suche in Google Scholar

Received: 2020-02-18
Revised: 2021-06-01
Accepted: 2021-06-19
Published Online: 2021-07-15

© 2021 Thuan Duc Lao et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Biomedical Sciences
  2. Research progress on the mechanism of orexin in pain regulation in different brain regions
  3. Adriamycin-resistant cells are significantly less fit than adriamycin-sensitive cells in cervical cancer
  4. Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
  5. Iris metastasis of diffuse large B-cell lymphoma misdiagnosed as primary angle-closure glaucoma: A case report and review of the literature
  6. LncRNA PVT1 promotes cervical cancer progression by sponging miR-503 to upregulate ARL2 expression
  7. Two new inflammatory markers related to the CURB-65 score for disease severity in patients with community-acquired pneumonia: The hypersensitive C-reactive protein to albumin ratio and fibrinogen to albumin ratio
  8. Circ_0091579 enhances the malignancy of hepatocellular carcinoma via miR-1287/PDK2 axis
  9. Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-κB signaling pathway
  10. Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats
  11. ABCB1 polymorphism in clopidogrel-treated Montenegrin patients
  12. Metabolic profiling of fatty acids in Tripterygium wilfordii multiglucoside- and triptolide-induced liver-injured rats
  13. miR-338-3p inhibits cell growth, invasion, and EMT process in neuroblastoma through targeting MMP-2
  14. Verification of neuroprotective effects of alpha-lipoic acid on chronic neuropathic pain in a chronic constriction injury rat model
  15. Circ_WWC3 overexpression decelerates the progression of osteosarcoma by regulating miR-421/PDE7B axis
  16. Knockdown of TUG1 rescues cardiomyocyte hypertrophy through targeting the miR-497/MEF2C axis
  17. MiR-146b-3p protects against AR42J cell injury in cerulein-induced acute pancreatitis model through targeting Anxa2
  18. miR-299-3p suppresses cell progression and induces apoptosis by downregulating PAX3 in gastric cancer
  19. Diabetes and COVID-19
  20. Discovery of novel potential KIT inhibitors for the treatment of gastrointestinal stromal tumor
  21. TEAD4 is a novel independent predictor of prognosis in LGG patients with IDH mutation
  22. circTLK1 facilitates the proliferation and metastasis of renal cell carcinoma by regulating miR-495-3p/CBL axis
  23. microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury
  24. Long noncoding RNA TUG1 regulates degradation of chondrocyte extracellular matrix via miR-320c/MMP-13 axis in osteoarthritis
  25. Duodenal adenocarcinoma with skin metastasis as initial manifestation: A case report
  26. Effects of Loofah cylindrica extract on learning and memory ability, brain tissue morphology, and immune function of aging mice
  27. Recombinant Bacteroides fragilis enterotoxin-1 (rBFT-1) promotes proliferation of colorectal cancer via CCL3-related molecular pathways
  28. Blocking circ_UBR4 suppressed proliferation, migration, and cell cycle progression of human vascular smooth muscle cells in atherosclerosis
  29. Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
  30. Downregulation of circ_0037655 impedes glioma formation and metastasis via the regulation of miR-1229-3p/ITGB8 axis
  31. Vitamin D deficiency and cardiovascular risk in type 2 diabetes population
  32. Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis
  33. Mechanisms of circular RNA circ_0066147 on pancreatic cancer progression
  34. lncRNA myocardial infarction-associated transcript (MIAT) knockdown alleviates LPS-induced chondrocytes inflammatory injury via regulating miR-488-3p/sex determining region Y-related HMG-box 11 (SOX11) axis
  35. Identification of circRNA circ-CSPP1 as a potent driver of colorectal cancer by directly targeting the miR-431/LASP1 axis
  36. Hyperhomocysteinemia exacerbates ischemia-reperfusion injury-induced acute kidney injury by mediating oxidative stress, DNA damage, JNK pathway, and apoptosis
  37. Potential prognostic markers and significant lncRNA–mRNA co-expression pairs in laryngeal squamous cell carcinoma
  38. Gamma irradiation-mediated inactivation of enveloped viruses with conservation of genome integrity: Potential application for SARS-CoV-2 inactivated vaccine development
  39. ADHFE1 is a correlative factor of patient survival in cancer
  40. The association of transcription factor Prox1 with the proliferation, migration, and invasion of lung cancer
  41. Is there a relationship between the prevalence of autoimmune thyroid disease and diabetic kidney disease?
  42. Immunoregulatory function of Dictyophora echinovolvata spore polysaccharides in immunocompromised mice induced by cyclophosphamide
  43. T cell epitopes of SARS-CoV-2 spike protein and conserved surface protein of Plasmodium malariae share sequence homology
  44. Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
  45. Long noncoding RNA HULC contributes to paclitaxel resistance in ovarian cancer via miR-137/ITGB8 axis
  46. Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
  47. Prognostic value of the neutrophil-to-lymphocyte ratio in acute organophosphorus pesticide poisoning
  48. Gastroprotective effects of diosgenin against HCl/ethanol-induced gastric mucosal injury through suppression of NF-κβ and myeloperoxidase activities
  49. Silencing of LINC00707 suppresses cell proliferation, migration, and invasion of osteosarcoma cells by modulating miR-338-3p/AHSA1 axis
  50. Successful extracorporeal membrane oxygenation resuscitation of patient with cardiogenic shock induced by phaeochromocytoma crisis mimicking hyperthyroidism: A case report
  51. Effects of miR-185-5p on replication of hepatitis C virus
  52. Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis
  53. Primary localized cutaneous nodular amyloidosis presenting as lymphatic malformation: A case report
  54. Multimodal magnetic resonance imaging analysis in the characteristics of Wilson’s disease: A case report and literature review
  55. Therapeutic potential of anticoagulant therapy in association with cytokine storm inhibition in severe cases of COVID-19: A case report
  56. Neoadjuvant immunotherapy combined with chemotherapy for locally advanced squamous cell lung carcinoma: A case report and literature review
  57. Rufinamide (RUF) suppresses inflammation and maintains the integrity of the blood–brain barrier during kainic acid-induced brain damage
  58. Inhibition of ADAM10 ameliorates doxorubicin-induced cardiac remodeling by suppressing N-cadherin cleavage
  59. Invasive ductal carcinoma and small lymphocytic lymphoma/chronic lymphocytic leukemia manifesting as a collision breast tumor: A case report and literature review
  60. Clonal diversity of the B cell receptor repertoire in patients with coronary in-stent restenosis and type 2 diabetes
  61. CTLA-4 promotes lymphoma progression through tumor stem cell enrichment and immunosuppression
  62. WDR74 promotes proliferation and metastasis in colorectal cancer cells through regulating the Wnt/β-catenin signaling pathway
  63. Down-regulation of IGHG1 enhances Protoporphyrin IX accumulation and inhibits hemin biosynthesis in colorectal cancer by suppressing the MEK-FECH axis
  64. Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
  65. Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway
  66. lncRNA NEAT1 regulates CYP1A2 and influences steroid-induced necrosis
  67. A two-microRNA signature predicts the progression of male thyroid cancer
  68. Isolation of microglia from retinas of chronic ocular hypertensive rats
  69. Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study
  70. Calcineurin Aβ gene knockdown inhibits transient outward potassium current ion channel remodeling in hypertrophic ventricular myocyte
  71. Aberrant expression of PI3K/AKT signaling is involved in apoptosis resistance of hepatocellular carcinoma
  72. Clinical significance of activated Wnt/β-catenin signaling in apoptosis inhibition of oral cancer
  73. circ_CHFR regulates ox-LDL-mediated cell proliferation, apoptosis, and EndoMT by miR-15a-5p/EGFR axis in human brain microvessel endothelial cells
  74. Resveratrol pretreatment mitigates LPS-induced acute lung injury by regulating conventional dendritic cells’ maturation and function
  75. Ubiquitin-conjugating enzyme E2T promotes tumor stem cell characteristics and migration of cervical cancer cells by regulating the GRP78/FAK pathway
  76. Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
  77. Protective effect of Lactobacillus-containing probiotics on intestinal mucosa of rats experiencing traumatic hemorrhagic shock
  78. Glucocorticoids induce osteonecrosis of the femoral head through the Hippo signaling pathway
  79. Endothelial cell-derived SSAO can increase MLC20 phosphorylation in VSMCs
  80. Downregulation of STOX1 is a novel prognostic biomarker for glioma patients
  81. miR-378a-3p regulates glioma cell chemosensitivity to cisplatin through IGF1R
  82. The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats
  83. TGF-β1-overexpressing mesenchymal stem cells reciprocally regulate Th17/Treg cells by regulating the expression of IFN-γ
  84. The influence of MTHFR genetic polymorphisms on methotrexate therapy in pediatric acute lymphoblastic leukemia
  85. Red blood cell distribution width-standard deviation but not red blood cell distribution width-coefficient of variation as a potential index for the diagnosis of iron-deficiency anemia in mid-pregnancy women
  86. Small cell neuroendocrine carcinoma expressing alpha fetoprotein in the endometrium
  87. Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers
  88. Molecular characterization and phylogenetic studies of Echinococcus granulosus and Taenia multiceps coenurus cysts in slaughtered sheep in Saudi Arabia
  89. ITGB5 mutation discovered in a Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
  90. ACTB and GAPDH appear at multiple SDS-PAGE positions, thus not suitable as reference genes for determining protein loading in techniques like Western blotting
  91. Facilitation of mouse skin-derived precursor growth and yield by optimizing plating density
  92. 3,4-Dihydroxyphenylethanol ameliorates lipopolysaccharide-induced septic cardiac injury in a murine model
  93. Downregulation of PITX2 inhibits the proliferation and migration of liver cancer cells and induces cell apoptosis
  94. Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B
  95. Novel predictor of the occurrence of DKA in T1DM patients without infection: A combination of neutrophil/lymphocyte ratio and white blood cells
  96. Investigation of molecular regulation mechanism under the pathophysiology of subarachnoid hemorrhage
  97. miR-25-3p protects renal tubular epithelial cells from apoptosis induced by renal IRI by targeting DKK3
  98. Bioengineering and Biotechnology
  99. Green fabrication of Co and Co3O4 nanoparticles and their biomedical applications: A review
  100. Agriculture
  101. Effects of inorganic and organic selenium sources on the growth performance of broilers in China: A meta-analysis
  102. Crop-livestock integration practices, knowledge, and attitudes among smallholder farmers: Hedging against climate change-induced shocks in semi-arid Zimbabwe
  103. Food Science and Nutrition
  104. Effect of food processing on the antioxidant activity of flavones from Polygonatum odoratum (Mill.) Druce
  105. Vitamin D and iodine status was associated with the risk and complication of type 2 diabetes mellitus in China
  106. Diversity of microbiota in Slovak summer ewes’ cheese “Bryndza”
  107. Comparison between voltammetric detection methods for abalone-flavoring liquid
  108. Composition of low-molecular-weight glutenin subunits in common wheat (Triticum aestivum L.) and their effects on the rheological properties of dough
  109. Application of culture, PCR, and PacBio sequencing for determination of microbial composition of milk from subclinical mastitis dairy cows of smallholder farms
  110. Investigating microplastics and potentially toxic elements contamination in canned Tuna, Salmon, and Sardine fishes from Taif markets, KSA
  111. From bench to bar side: Evaluating the red wine storage lesion
  112. Establishment of an iodine model for prevention of iodine-excess-induced thyroid dysfunction in pregnant women
  113. Plant Sciences
  114. Characterization of GMPP from Dendrobium huoshanense yielding GDP-D-mannose
  115. Comparative analysis of the SPL gene family in five Rosaceae species: Fragaria vesca, Malus domestica, Prunus persica, Rubus occidentalis, and Pyrus pyrifolia
  116. Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR
  117. Investigation of bioactivities of Taxus chinensis, Taxus cuspidata, and Taxus × media by gas chromatography-mass spectrometry
  118. Morphological structures and histochemistry of roots and shoots in Myricaria laxiflora (Tamaricaceae)
  119. Transcriptome analysis of resistance mechanism to potato wart disease
  120. In silico analysis of glycosyltransferase 2 family genes in duckweed (Spirodela polyrhiza) and its role in salt stress tolerance
  121. Comparative study on growth traits and ions regulation of zoysiagrasses under varied salinity treatments
  122. Role of MS1 homolog Ntms1 gene of tobacco infertility
  123. Biological characteristics and fungicide sensitivity of Pyricularia variabilis
  124. In silico/computational analysis of mevalonate pyrophosphate decarboxylase gene families in Campanulids
  125. Identification of novel drought-responsive miRNA regulatory network of drought stress response in common vetch (Vicia sativa)
  126. How photoautotrophy, photomixotrophy, and ventilation affect the stomata and fluorescence emission of pistachios rootstock?
  127. Apoplastic histochemical features of plant root walls that may facilitate ion uptake and retention
  128. Ecology and Environmental Sciences
  129. The impact of sewage sludge on the fungal communities in the rhizosphere and roots of barley and on barley yield
  130. Domestication of wild animals may provide a springboard for rapid variation of coronavirus
  131. Response of benthic invertebrate assemblages to seasonal and habitat condition in the Wewe River, Ashanti region (Ghana)
  132. Molecular record for the first authentication of Isaria cicadae from Vietnam
  133. Twig biomass allocation of Betula platyphylla in different habitats in Wudalianchi Volcano, northeast China
  134. Animal Sciences
  135. Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens
  136. Predators of the giant pine scale, Marchalina hellenica (Gennadius 1883; Hemiptera: Marchalinidae), out of its natural range in Turkey
  137. Honey in wound healing: An updated review
  138. NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block
  139. Radiotherapy for the treatment of pulmonary hydatidosis in sheep
  140. Retraction
  141. Retraction of “Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating microRNA-34a-5p/NOTCH1 signaling pathway”
  142. Special Issue on Reuse of Agro-Industrial By-Products
  143. An effect of positional isomerism of benzoic acid derivatives on antibacterial activity against Escherichia coli
  144. Special Issue on Computing and Artificial Techniques for Life Science Applications - Part II
  145. Relationship of Gensini score with retinal vessel diameter and arteriovenous ratio in senile CHD
  146. Effects of different enantiomers of amlodipine on lipid profiles and vasomotor factors in atherosclerotic rabbits
  147. Establishment of the New Zealand white rabbit animal model of fatty keratopathy associated with corneal neovascularization
  148. lncRNA MALAT1/miR-143 axis is a potential biomarker for in-stent restenosis and is involved in the multiplication of vascular smooth muscle cells
Heruntergeladen am 14.3.2026 von https://www.degruyterbrill.com/document/doi/10.1515/biol-2021-0074/html
Button zum nach oben scrollen