Home Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
Article Open Access

Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice

  • Zongyan Xie , Yu Cheng , Qi Zhang , Haojie Hao , Yaqi Yin , Li Zang , Xuhong Wang EMAIL logo and Yiming Mu EMAIL logo
Published/Copyright: June 25, 2021

Abstract

Mesenchymal stem cells (MSCs) can be obtained from almost all tissues and present promising therapeutic effects for metabolic diseases. Human adipose-derived MSCs (hASCs) have recently been widely studied due to their easy access and low immunity. Thus, we intended to figure out the effects and potential mechanism of hASCs on obesity in high-fat-diet (HFD)-induced obese mice. Following 16 weeks of being fed HFD, hASCs were intravenously injected. Two weeks later, body weight, body composition, and energy expenditure were evaluated. Additionally, the phenotypes of macrophages infiltrating adipose tissue were analyzed. The results revealed that hASCs administration significantly reduced adipose tissue weight, adipocyte size, and fat mass and exerted beneficial effects in serum lipid profile. This anti-obesity effect was mediated by the increased O2 consumption, CO2 production, and energy expenditure, which was further evidenced by the upregulation of uncoupling protein-1 (UCP-1) and metabolism-associated genes. Furthermore, hASCs infusion increased the amount of alternatively activated (M2) macrophages in adipose tissue, and the expression of pro-inflammatory cytokines-related genes was reduced. Taken together, these results indicated that hASCs suppressed obesity by increasing UCP-1 expression and enhancing energy expenditure, and this effect might be due to the increased M2 macrophages.

1 Introduction

Obesity has increased at an alarming rate during the few decades throughout the world [1,2,3,4] and has been regarded as a significant risk factor for hepatosteatosis [5], diabetes [6], cancer [7], etc. Therefore, the high incidence of obesity and its associated health problems alerts us that effective interventions are urgently needed to restrict obesity. Nowadays, several therapeutic options such as lifestyle modification, medications, and surgery are feasible for obesity treatment. However, lifestyle modification has limited effects, most medications are withdrawn because of adverse effects, and surgery is invasive and remains contentious to long-term efficacy and safety [8]. Thus, seeking a new treatment that can overcome previous limitations is very attractive for researchers.

According to their phenotypes and functions, adipose tissues can be categorized into white adipose tissue (WAT) and brown adipose tissue (BAT). WAT is involved in fat storage and contains white adipocytes with unilocular lipid droplets [9,10]. The major cell type present in BAT is brown adipocyte, characterized by multichambered lipid droplets and high density of mitochondrial with highly expressed uncoupling protein-1 (UCP-1). Previous studies have revealed that BAT dissipates excessive energy into heat via UCP-1 and protects against obesity and its related disorders [11,12]. Thus, promoting the expression of UCP-1 and enhancing energy expenditure could be a promising approach to restrict obesity. Recently, accumulated studies have indicated that bariatric surgery [13], exercise [14], and cold stimulation [15] could facilitate WAT browning and limit obesity. Further mechanism research has demonstrated that alternatively activated (M2) macrophages related to catecholamine are crucial for adipose tissue browning [15,16]. Moreover, methods aimed to increase M2 macrophages in adipose tissue have been demonstrated to be effective in limiting obesity [16,17,18].

Mesenchymal stem cells (MSCs) are fibroblast-like stem cells characterized by exceptional self-renewal capacity and differential potential to various cell types. It is generally known that MSCs can be widely obtained from various adult tissues and can expand rapidly in vitro. Therefore, owing to its easy access and low immunity, the therapeutic effect of MSCs has acquired much more attention [19]. Till now, researchers have suggested that MSCs may display their therapeutic effect through immunomodulation, which is directed by eliciting M2 macrophages [20,21]. Intravenously infused MSCs have been confirmed to promote M2 polarization in different disease models such as renal ischemia-reperfusion injury [22], acute myocardial infarction [23], and corneal epithelial wound healing in diabetic mice [24]. Furthermore, our study group has demonstrated that MSCs infusion promoted M2 polarization, reduced inflammation, and eventually alleviated insulin resistance in type 2 diabetic rats and mice [25,26,27]. As mentioned, MSCs have been verified to induce M2 macrophages, and M2 macrophages have been confirmed to be effective in combatting obesity. Therefore, we hypothesized that MSCs infusion could limit obesity by inducing M2 macrophages.

Adipose-derived mesenchymal stem cells (ASCs) are originated from the stromal vascular fraction (SVF) of adipose tissues. Compared to other MSCs, ASCs are considered superior because adipose tissue can be acquired easily and repetitively. The isolation procedure is rather simple, less invasive, and provides a significantly higher concentration of isolated cells [28]. Thus, in this study we transplanted human adipose-derived mesenchymal stem cells (hASCs) into high-fat-diet (HFD)-induced obese mice via the tail vein to investigate the anti-obesity effect of hASCs. Additionally, we aimed to clarify the potential mechanism of hASCs in terms of energy metabolism.

2 Materials and methods

2.1 Isolation, culture, and identification of hASCs

Human adipose tissue was freshly obtained from the abdominal wall of a simple obese patient (35 years old, male, BMI = 35.1) who underwent liposuction at the First Medical Center of the PLA General Hospital. Adipose tissue was washed thoroughly with phosphate-buffered saline (PBS) and cut into pieces smaller than 1 mm3. The adipose tissue was digested with low glucose Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, USA) containing 0.05% trypsin and 0.1% type 1 collagenase at 37°C for 40 min. Digestion was ended by the addition of 10% fetal bovine serum (FBS) (Gibco, USA). Then, the floating adipocytes were removed by filtration through a 100 µm metal mesh. Then, SVF was isolated from centrifugation at 1,000 rpm for 5 min and resuspended in low glucose DMEM with 100 U/mL penicillin–streptomycin and 10% FBS and incubated at 37°C, 5% CO2, and 95% humidity. The next day, floating cells were taken out by changing the medium. Then, we changed the medium in 2–3 days. After cell fusion, the cells were passaged at a ratio of 1:3. The 4th generation cells were obtained for our study. Adipogenic and osteogenic differentiation was performed using the cell differentiation kit from R&D Systems (Minneapolis, MN, USA) to determine the pluripotent differentiation traits of hASCs. hASCs (1 × 106) at passage 4 were collected, washed twice with PBS, and then incubated with antibodies against human CD34 (1:50; cat. no. 550761; BD Biosciences, Inc.), CD45 (1:50; cat. no. 555482; BD Biosciences, Inc.), CD90 (1:50; cat. no. 555595; BD Biosciences, Inc.), CD73 (1:50; cat. no. 550257; BD Biosciences, Inc.), CD105 (1:50; cat. no. 560839; BD Biosciences, Inc.), and HLA-DR (1:50; cat. no. 555560; BD Biosciences, Inc.). Phenotype identification was analyzed by flow cytometer (Becton Dickinson, Inc.).

  1. Informed consent: Informed consent has been obtained from all individuals included in this study.

  2. Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies, and in accordance with the tenets of the Helsinki Declaration and has been approved by the Medical Ethics Committee of PLA General Hospital (approval no. S2013-107-01).

2.2 Animal experiments

Eight-week-old male C57Bl/6 mice (weight 17–18 g) were obtained from PLA General Hospital. They were housed under a standard environment (room temperature of 22 ± 1°C, humidity of 55 ± 5%, 12 h light/dark cycle) and allowed to eat and drink freely. After one week of adaptation, mice were randomly administered HFD (cat. no. D12492, %kcal; carbohydrate: protein: fat = 20:20:60, Research Diets) (cat. no. D12492, %kcal), with fat consisting of soybean oil and lard (soybean oil: lard = 1:9.8), which indicated that the main fat component was saturated fat to induce obese mice (n = 12) or normal chow diet (NCD) to induce normal control group (n = 6). The body weight of each mouse was measured once a week, and total food consumption was recorded daily. Sixteen weeks later, obese mice were randomized to a single intravenous infusion of 1 × 106 hASCs suspended in 0.2 mL PBS via the tail vein (the hASC group, n = 6) or 0.2 mL PBS alone (the obese group, n = 6). Two weeks later, calorimetry and EchoMRI experiments were performed on the mice. Afterwards, mice were fasted for 12 h and then sacrificed. Blood was immediately collected for lipid metabolism analysis through the intraorbital vein. Interscapular BAT, inguinal subcutaneous adipose tissue (ingWAT), and epidermal adipose tissue (epiWAT) were collected and measured. Adipose tissues were stored in liquid nitrogen for mRNA/protein analysis and fixed in formalin for histological analysis.

  1. Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals and was approved by the Institutional Animal Care and Use Committee of PLA General Hospital (approval no. 2014-H121-5).

2.3 Lipid metabolism analysis

Blood samples were centrifuged at 1,000 rpm for 10 min and the serum was separated. 200 µL plasma samples were collected for lipid analysis, including low-density lipoprotein cholesterol (LDL-c), triglycerides (TG), high-density lipoprotein cholesterol (HDL-c), and total cholesterol (TC), using an automated biochemical analysis machine (Cobas c701, Roche) with an enzymatic colorimetric assay kit (Roche). All methods were operated based on the instructions of the assay kit.

2.4 Indirect calorimetry and body composition analysis

Two weeks after hASCs infusion, mice were housed separately in metabolic cages (Oxylet, PanLab, Spain) and acclimated for 24 h before measuring oxygen (O2) consumption and carbon dioxide (CO2) production (n = 6/group). Mice were placed in individually ventilated cages with a controlled room temperature of 22°C and a 12 h light/dark cycle. All mice were allowed to eat and drink freely. The activity of mice was monitored by activity sensors and food was monitored by food sensors. Food consumption was monitored by food sensors. The respiratory quotient ([RQ] = VCO2/VO2) was calculated from gas exchange data. Energy expenditure was calculated as EE (kcal/day/kg0.75) = ([3.815 + 1.232 × RQ] × VO2 × 1.44). All data were automatically recorded and calculated using SMART 3.0 software (Metabolism v2.2). Body composition was immediately analyzed after calorimetric experiments. Mice were placed in a clear plastic holder without anesthesia or sedation, and the EchoMRI device (Echo Medical Systems, USA) was used to measure whole body fat and lean mass. All tests were conducted three times and the mean was calculated.

2.5 Histologic analysis

Morphology was studied in BAT, ingWAT, and epiWAT sections stained with hematoxylin–eosin. All tissues were fixed in 10% formalin at room temperature for at least 24 h and embedded in paraffin before cutting 5 µm sections. Subsequently, the sections were stained with hematoxylin for 5 min and eosin for 1 min at room temperature with hematoxylin–eosin staining kit (HE, Richard Allan Scientific, Kalamazoo, MI). The stained sections were observed and photographed using an Olympus BX-50 system (Olympus, Tokyo, Japan). The size of 300 adipocytes per mouse from 6 mice was measured using the ImageJ software program (version 1.45, National Institutes of Health, Bethesda, MD, USA).

2.6 Isolation and flow cytometry analysis of SVF

epiWATs were gathered, washed thoroughly with PBS, and then cut into pieces smaller than 1 mm3. The tissues were digested with low glucose DMEM containing 0.05% trypsin and 0.1% type 1 collagenase, and then filtered through a 100 µm metal mesh. The detailed method was the same as above. SVF pellets were treated with erythrocyte lysis buffer (BD Biosciences, Inc.) and then incubated for 10 min at room temperature with antibodies against mouse F4/80 (1:20; cat. no. 565410; BD Biosciences, Inc.), CD11c (1:20; cat. no. 553801; BD Biosciences, Inc.), and CD206 (1:20; cat. no. 141708; Biolegend, Inc.). Thereafter, cells were washed, resuspended in wash buffer, and then analyzed by flow cytometry (Becton Dickinson, Inc.).

2.7 Western blot analysis

Tissues were homogenized in lysis buffer with protease inhibitors (Sigma, St. Louis, MO, USA). Supernatants were collected for protein quantification through centrifugation at 12,000 g for 20 min. Bicinchoninic Acid protein assay kit (Kang Wei, Beijing, China) was used to measure protein concentrations. 20 µg of each protein sample was resolved on a 10% SDS-PAGE gel, and the proteins were electrically transferred to polyvinylidene fluoride membranes (Millipore, Inc.). The membranes were blocked with 10% nonfat milk for 1 hour at room temperature, and then were treated with primary antibodies UCP-1 (1:1,000, cat. no. ab10983, Abcam), inducible nitric oxide synthase (iNOS) (1:1,000, cat. ab49999, Abcam), arginase-1 (Arg1) (1:300, cat. no. sc-18354, Santa Cruz Biotechnology), and β-actin (1:2,500, cat. no. 3700s, Cell Signaling Technology) overnight at 4°C. Then, the membranes were incubated with the secondary antibodies goat anti-rabbit (1:3,000, cat. no. ZB2301, ZSGB-Bio company), goat anti-mouse (1:3,000, cat. no. ZB2305, ZSGB-Bio company), and rabbit anti-goat (1:3,000, cat. no. ZB2306, ZSGB-Bio company) IgG horseradish peroxidase for 2 h at room temperature. Finally, proteins were visualized with chemiluminescent substrates of eECL Western Blot Kit (Kang Wei, Beijing, China) and exposed to film in a dark room. Quantitative analysis of protein density was performed with ImageJ software (version 1.45, National Institutes of Health, Bethesda, MD, USA), using β-actin as a loading control, and the relative amounts of each protein were obtained by the ratio to β-actin.

2.8 Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) of adipose tissues

RNA samples from epiWAT were extracted using TRIzol reagent (Invitrogen, Carlsbad, USA) and then reversely transcribed to single-stranded cDNA using a reverse transcriptase kit (Invitrogen, Carlsbad, USA) following the manufacturer’s method. Finally, RT-qPCR was performed in a 7500 Real-Time PCR system using SYBR Green PCR reagents (Applied Biosystems, Carlsbad, USA). The reaction system and program were as follows: the cycling stage 40 cycles with 94℃ for 30 s, then 62℃ for 30 s and 72℃ for 30 s; the melt curve stage is 95℃ for 15 s, 60℃ for 60 s, 95℃ for 30 s, and then 60℃ for 15 s. The single peak dissolution curve showed the specificity of the primers. β-Actin was used as an internal control, and the relative mRNA expression of the genes was calculated by the 2−ΔΔCt method. RNase-free DNase I was used to avoid genomic DNA (gDNA) contamination. RNA quality was determined by measuring the A260/A280 ratio and by agarose gel electrophoresis. A negative group with only RNA sample was included in the qRT-PCR assay to verify that RNA was gDNA-free. Reference gene selection was performed according to publications which used the same model (HFD-induced obese mouse) and analyzed the same tissue (adipose tissue) [16,17,29,30]. In addition, Ct values of beta-actin were stabilized at 12–13 during repeated experiments. The primer sequences were listed in Tables 1 and 2.

Table 1

Primer sequences of thermogenic-related genes

Genes Primer sequence (5′–3′) T m (°C) Product size (bp) Amplification efficiency (%)
Th For: CCAAGGTTCATTGGACGGC 59.12 138 99.5
Rev: CTCTCCTCGAATACCACAGCC 59.93
UCP-1 For: GTGAACCCGACAACTTCCGAA 60.81 78 98.2
Rev: TGCCAGGCAAGCTGAAACTC 61.17
Cox8b For: TGTGGGGATCTCAGCCATAGT 60.34 62 96.1
Rev: AGTGGGCTAAGACCCATCCTG 61.25
Prdm16 For: CAGCACGGTGAAGCCATTC 59.50 87 96.9
Rev: GCGTGCATCCGCTTGTG 59.86
Cidea For: TGCTCTTCTGTATCGCCCAGT 61.23 113 95.8
Rev: GCCGTGTTAAGGAATCTGCTG 59.60
Cpt1a For: TGGCATCATCACTGGTGTGTT 60.20 134 98.2
Rev: GTCTAGGGTCCGATTGATCTTTG 58.63
Acox1 For: GCCCAACTGTGACTTCCATTAA 58.85 101 99.1
Rev: GTAGCACTCCCCTCGAGTGAT 61.02
Dio For: CAGTGTGGTGCACGTCTCCAATC 64.02 131 96.3
Rev: TGAACCAAAGTTGACCACCAG 58.63
Acsl1 For: TGGGGTGGAAATCATCAGCC 60.03 285 95.8
Rev: CACAGCATTACACACTGTACAACGG 62.52
Tmem26 For: ACCCTGTCATCCCACAGAG 58.31 123 95.7
Rev: TGTTTGGTGGAGTCCTAAGGTC 59.63
Tbx1 For: GGCAGGCAGACGAATGTTC 59.20 103 94.9
Rev: TTGTCATCTACGGGCACAAAG 58.58
Cd137 For: CGTGCAGAACTCCTGTGATAAC 59.33 104 97.5
Rev: GTCCACCTATGCTGGAGAAGG 59.86
Pgc1α For: AGCCGTGACCACTGACAACGAG 64.95 168 97.9
Rev: GCTGCATGGTTCTGAGTGCTAAG 62.02

For, forward; Rev, reverse; Th, tyrosine hydroxylase; UCP-1, uncoupling protein-1; Cox8b, cytochrome c oxidase subunit 8b; Prdm16, PR domain containing 16; Cidea, cell death inducing DFFA like effector a; Cpt1a, Carnitine palmitoyl transferase 1a; Acox1, acyl-CoA oxidase 1; Dio, iodothyronine deiodinase; Acsl1, Long-chain acyl-CoA synthetase 1; Tmem26, transmembrane protein 26; Tbx1, T-box transcription factor 1; Pgc1α, peroxisome proliferator activated receptor γ coactivator 1α.

Table 2

Primer sequences of macrophages-related genes

Genes Primer sequence (5′–3′) T m (°C) Product size (bp) Amplification efficiency (%)
β-actin For: CCAGTTGGTAACAATGCCATGT 59.44 154 99.0
Rev:GGCTGTATTCCCCTCCATCG 59.96
CD68 For: CATCAGAGCCCGAGTACAGTCTACC 63.93 97 98.2
Rev: AATTCTGCGCCATGAATGTCC 59.59
F4/80 For: CTTTGGCTATGGGCTTCCAGTC 61.27 165 99.1
Rev: GCAAGGAGGACAGAGTTTATCGTG 61.44
iNOS For: ACCTTGGTGAAGGGACTGAG 58.94 102 96.5
Rev: TCCGTTCTCTTGCAGTTGAC 58.13
Arg1 For: AGACCACAGTCTGGCAGTTG 59.89 74 95.4
Rev: CCACCCAAATGACACATAGG 56.09
CD163 For: GGGTCATTCAGAGGCACACTG 60.95 88 97.2
Rev: GCTGGCTGTCCTGTCAAGGCT 64.98
CD206 For: TGATTACGAGCAGTGGAAGC 57.99 126 95.7
Rev: GTTCACCGTAAGCCCAATTT 56.61
MCP1 For: AGGTCCCTGTCATGCTTCTG 59.38 167 97.8
Rev: GCTGCTGGTGATCCTCTTGT 60.04
TNFα For: CCAGACCCTCACACTCAGATC 57.14 81 98.1
Rev: CACTTGGTGGTTTGCTACGAC 54.38
IL1β For: TGGGCCTCAAAGGAAAGAAT 57.00 216 96.9
Rev: CAGGCTTGTGCTCTGCTTGT 60.17
IL10 For: GCTCTTACTGACTGGCATGAG 58.45 105 97.0
Rev: CGCAGCTCTAGGAGCATGTG 60.88

For, forward; Rev, reverse; iNOS, inducible nitric oxide synthase; Arg1, arginase-1; MCP1, monocyte chemotactic protein 1; TNFα, tumor necrosis factor α; IL1β, interleukin 1β; IL10, interleukin 10.

2.9 Statistical analysis

In this study, each experiment was conducted at least 3 times. All data were analyzed using SPSS 19.0 software (SPSS Inc., IBM, USA). Data were expressed as mean ± standard deviation (SD). Sample means were compared by unpaired t-test or one-way ANOVA. Two-tailed p < 0.05 was defined as having statistical significance.

3 Results

3.1 Identification of hASCs

The phenotypes and multiple differentiating capacities were analyzed to identify the characteristics of hASCs used in our experiments. The 4th passage of hASCs was positive for CD90, CD105, and CD73, but negative for CD45, CD34, and HLA-DR (Figure 1a). As expected, hASCs exhibited fibroblastic, adherent characteristics in culture (Figure 1b). Furthermore, hASCs could develop into osteoblasts and adipocytes (Figure 1b) under appropriate conditions. These results indicated that the cells used in our experiments possessed the characteristics of MSCs as described in previous studies [31,32].

Figure 1 
                  Identification of hASCs. hASCs were identified by their immunologic phenotypes and potential to differentiate into adipocytes and osteoblasts. (a) hASCs were positive for CD90, CD73, and CD105, and negative for CD34, CD45, and HLA-DR. (b) The morphology of hASCs in high magnification (scale bar is 100 µm, left image) and the differentiation of adipocytes and osteoblasts were, respectively, detected by Oil Red O staining (middle image) and Alizarin Red staining (right image) (scale bar is 50 µm). Data are representatives of three independent experiments. hASCs, human adipose-derived mesenchymal stem cells; CD, cluster of differentiation; HLA, human leukocyte antigen.
Figure 1

Identification of hASCs. hASCs were identified by their immunologic phenotypes and potential to differentiate into adipocytes and osteoblasts. (a) hASCs were positive for CD90, CD73, and CD105, and negative for CD34, CD45, and HLA-DR. (b) The morphology of hASCs in high magnification (scale bar is 100 µm, left image) and the differentiation of adipocytes and osteoblasts were, respectively, detected by Oil Red O staining (middle image) and Alizarin Red staining (right image) (scale bar is 50 µm). Data are representatives of three independent experiments. hASCs, human adipose-derived mesenchymal stem cells; CD, cluster of differentiation; HLA, human leukocyte antigen.

3.2 Effect of hASCs on body weight gain, food intake, and fat accumulation

During the 16 weeks of dietary obese mouse model generation period, the average body weight of mice fed with HFD increased more rapidly than the control mice fed with NCD (Figure 2a). As shown in Figure 2a, no obvious difference was observed between the obese group and the hASC group before hASCs infusion. As expected, these two groups had more weight gain than the normal group did. Two weeks after hASCs infusion, though the hASC-treated group didn’t show a significant decrease in body weight (Figure 2a), decreased fat mass and increased lean mass were observed (Figure 2c). Food consumption was almost the same between the three groups (Figure 2b). In accordance with the decreased fat mass, both ingWAT and epiWAT in the hASC group were significantly lower than that in the obese group. Furthermore, a representative photograph of the three groups showed that the obese mice were larger with more greasy hair compared with normal group, which was partially alleviated by hASCs infusion (Figure 2e).

Figure 2 
                  Effect of hASCs on (a) body weight, (b) food intake, (c) fat mass and lean mass, and (d) adipose tissue weight. A representative photograph of the three groups (e). Values are expressed as means ± SD; n = 6 mice for each group; *represents P < 0.05, **represents P < 0.01. BAT, interscapular brown adipose tissue; ingWAT, inguinal subcutaneous adipose tissue; epiWAT, epididymal adipose tissue.
Figure 2

Effect of hASCs on (a) body weight, (b) food intake, (c) fat mass and lean mass, and (d) adipose tissue weight. A representative photograph of the three groups (e). Values are expressed as means ± SD; n = 6 mice for each group; *represents P < 0.05, **represents P < 0.01. BAT, interscapular brown adipose tissue; ingWAT, inguinal subcutaneous adipose tissue; epiWAT, epididymal adipose tissue.

3.3 hASCs attenuated serum lipid level and mitigated adipocyte hypertrophy

The levels of TG, TC, LDL-c, and HDL-c in the mice fed with HFD were significantly higher than those of the control mice fed with NCD (Figure 3a–d). Intravenous administration of hASCs significantly suppressed the increases in the levels of TG, LDL-c, and HDL-c (Figure 3a, c, and d). The TC level tended to decrease after hASCs infusion, although not significantly (Figure 3b). Compared with normal group, the obese mice showed significant hypertrophic adipocytes in BAT, epiWAT, and ingWAT, whereas administration of hASCs mitigated adipocyte hypertrophy in all the fat depots (Figure 3e). The diameter of adipocytes in HE stained sections was measured using ImageJ software. We found that hASCs infusion resulted in remarkable decrease in adipocyte size, especially in epiWAT and ingWAT (Figure 3f).

Figure 3 
                  Effects of hASCs on lipid level and adipocyte size. Effects of hASCs on (a) TG, (b) TC, (c) LDL-c, and (d) HDL-c level. (e) HE staining was performed in adipose tissue (the scale bar is 50 µm), (f) The diameter of adipocytes was measured using ImageJ software. TG, triglyceride; TC, total cholesterol; LDL-c, low-density lipoprotein cholesterol; HDL-C, high-density lipoprotein cholesterol. Values are expressed as means ± SD; n = 6 mice for each group, *represents P < 0.05, **represents P < 0.01. The images in E are representatives of three independent experiments.
Figure 3

Effects of hASCs on lipid level and adipocyte size. Effects of hASCs on (a) TG, (b) TC, (c) LDL-c, and (d) HDL-c level. (e) HE staining was performed in adipose tissue (the scale bar is 50 µm), (f) The diameter of adipocytes was measured using ImageJ software. TG, triglyceride; TC, total cholesterol; LDL-c, low-density lipoprotein cholesterol; HDL-C, high-density lipoprotein cholesterol. Values are expressed as means ± SD; n = 6 mice for each group, *represents P < 0.05, **represents P < 0.01. The images in E are representatives of three independent experiments.

3.4 Effect of hASCs on energy expenditure

As mice were active during dark period, we found that O2 consumption and CO2 production were higher during the dark period than the light period (Figure 4a and b). Compared with normal group, O2 consumption was markedly decreased in obese group, and this was significantly improved by hASCs infusion (Figure 4a). Similarly, CO2 production was also remarkably increased by hASCs infusion (Figure 4b). Additionally, as shown in Figure 4c, the obese mice had a lower level of energy expenditure than the normal mice, whereas hASCs infusion increased the energy expenditure with no differences in food intake (Figure 4d) and activity (Figure 4e).

Figure 4 
                  Effect of hASCs on energy expenditure. (a) O2 consumption and (b) CO2 production in dark and light phases. EE (c), food intake (d), and activity (e) of each group. O2, oxygen; CO2, carbon dioxide; EE, energy expenditure. Values are expressed as means ± SD; n = 6 mice for each group; *represents P < 0.05, **represents P < 0.01.
Figure 4

Effect of hASCs on energy expenditure. (a) O2 consumption and (b) CO2 production in dark and light phases. EE (c), food intake (d), and activity (e) of each group. O2, oxygen; CO2, carbon dioxide; EE, energy expenditure. Values are expressed as means ± SD; n = 6 mice for each group; *represents P < 0.05, **represents P < 0.01.

3.5 Expression of UCP-1 protein and thermogenic genes

To further validate that hASCs infusion could improve energy expenditure, we detected the expression of thermogenic-related genes and UCP-1 protein which is required for uncoupled respiration. Protein analysis revealed that UCP-1 expression in the three groups was almost the same in BAT, but was markedly upregulated in ingWAT and epiWAT by hASCs infusion, especially in epiWAT (Figure 5a and b). As the changes were most obvious in epiWAT, we then focused on epiWAT. Consistently, mRNA expression of UCP-1 in epiWAT was also elevated by hASCs infusion. Considering the contribution of adipose tissue browning in energy expenditure, we further detected the gene expression related to brown adipogenic (Pgc1α and Prdm16) and beige fat (Tmem26, Cd137, and Tbx1) markers, mitochondrial activity markers (Cidea, Dio, Acsl1, Acox1, Cpt1a, and Cox8b), and the rate-limiting enzyme (tyrosine hydroxylase, Th) of catecholamine synthesis in epiWAT. Compared with NCD feeding, long-term HFD feeding broadly inhibited the expression of these genes in epiWAT, whereas hASCs infusion significantly reversed their expression (Figure 5c). These data further indicated that hASCs infusion enhanced energy expenditure and potently protected mice from dietary obesity.

Figure 5 
                  Expression of UCP-1 protein and thermogenic genes. (a) Western blot analysis of UCP-1, representative of three independent experiments. (b) Relative protein level of UCP-1, ratios of UCP-1 to β-actin are quantitated. (c) RT-qPCR analysis of the expression of energy expenditure-related genes in epiWAT, the result is set as 1 in normal group, and the results in the other two groups are expressed relative to normal group. UCP-1, uncoupling protein-1. Values are expressed as means ± SD; n = 6 mice for each group, *represents P < 0.05, **represents P < 0.01.
Figure 5

Expression of UCP-1 protein and thermogenic genes. (a) Western blot analysis of UCP-1, representative of three independent experiments. (b) Relative protein level of UCP-1, ratios of UCP-1 to β-actin are quantitated. (c) RT-qPCR analysis of the expression of energy expenditure-related genes in epiWAT, the result is set as 1 in normal group, and the results in the other two groups are expressed relative to normal group. UCP-1, uncoupling protein-1. Values are expressed as means ± SD; n = 6 mice for each group, *represents P < 0.05, **represents P < 0.01.

3.6 Flow cytometry analysis of SVF from epiWAT

In WAT, M2 macrophages have been demonstrated as a major source of catecholamine, which was considered to be crucial in adipose tissue browning. To investigate the effects of hASCs on macrophages phenotype in obese mice, we did flow cytometry analysis of SVF, which was isolated from epiWAT. As shown in Figure 6a, the percentage of F4/80+ CD206+ M2 macrophages in epiWAT from HFD-fed obese mice significantly increased after hASCs treatment. Meanwhile, Figure 6b showed that the F4/80+ CD11c+ classically activated (M1) macrophages were markedly reduced by hASCs infusion.

Figure 6 
                  Flow cytometry analysis and quantification of SVF cells for F4/80 with CD206 (a) and CD11c (b), images are representatives of three independent experiments. Values are means ± SD (n = 6) of three individual experiments, **represents P < 0.01.
Figure 6

Flow cytometry analysis and quantification of SVF cells for F4/80 with CD206 (a) and CD11c (b), images are representatives of three independent experiments. Values are means ± SD (n = 6) of three individual experiments, **represents P < 0.01.

3.7 hASCs remodeled macrophage phenotypes

To further verify the effect of hASCs on adipose tissue macrophages, we analyzed the expression of M1 and M2 macrophages-related genes in SVF from epiWAT. The remarkably elevated expression of CD68 and F4/80 in obese mice demonstrated increased infiltration of macrophages in WAT during dietary obesity, which was suppressed by hASCs infusion (Figure 7a). The mRNA levels of iNOS, MCP1, TNFα, and IL1β, which were M1 phenotypes induced by obesity, were significantly decreased in SVF from HFD-fed mice treated with hASCs (Figure 7a). And, also hASCs infusion led to a dramatic increase in mRNA levels of Arg1, CD206, CD163, and IL10, representatives of M2 phenotypes in SVF (Figure 7a). Consistently, western blot analysis revealed that the protein level of iNOS induced by HFD feeding was obviously alleviated by hASCs infusion, while the protein level of Arg1 was elevated (Figure 7b). All these data indicated that hASCs infusion could increase M2 macrophages in epiWAT.

Figure 7 
                  Expression of macrophage phenotypes-related genes and proteins. (a) RT-qPCR analysis of the expression of macrophages phenotypes-related genes in epiWAT, the result is set as 1 in normal group, and the results in the other two groups are expressed relative to normal group. (b) Western blot analysis of iNOS and Arg1, representative of three independent experiments. Relative protein levels are quantified by ratios of iNOS and Arg1 to β-actin. Values are expressed as means ± SD; n = 6 mice for each group, *represents P < 0.05, **represents P < 0.01.
Figure 7

Expression of macrophage phenotypes-related genes and proteins. (a) RT-qPCR analysis of the expression of macrophages phenotypes-related genes in epiWAT, the result is set as 1 in normal group, and the results in the other two groups are expressed relative to normal group. (b) Western blot analysis of iNOS and Arg1, representative of three independent experiments. Relative protein levels are quantified by ratios of iNOS and Arg1 to β-actin. Values are expressed as means ± SD; n = 6 mice for each group, *represents P < 0.05, **represents P < 0.01.

4 Discussion

Obesity and its related diseases such as cancer, hypertension, and diabetes have threatened the public health [33]. Traditional anti-obesity methods such as dieting and exercise challenge the obese patients and the effect is far from being satisfactory. Thus, it’s urgent to figure out effective interventions to deal with obesity. Studies have found that obesity is a result of accumulated WATs, which possess the function of storing energy and eventually bring adverse effects to health [34]. However, BAT, the other type of adipose tissue, has been confirmed to consume energy [10]. And it has also been demonstrated that increasing the amount of brown-like adipose tissue can promote energy expenditure and limit obesity [12,16]. Recently, increasing the secretion of catecholamine [13,15,16,17] and the modification of pre-adipocyte’s differentiation-related genes [35,36] have been widely studied to promote adipose tissue browning.

Obesity, considered as a chronic inflammatory disease, is accompanied with excess accumulation of adipose tissue [37]. This adipose tissue accumulation can lead to local hypoxia and infiltration of immune cells such as neutrophil, macrophages, lymphocytes, etc. [38]. Thus, adipose tissue is not only an energy storage organ, but also the main source of inflammation, with the elevation secretion of inflammatory factors such as TNFα and IL1β, and adipocytokines like omentin [39] and neuregulin-4 [40]. Furthermore, this chronic inflammation during obesity is now considered as the main initiator of obesity-related disorders, such as type 2 diabetes [41], frailty [42], and cardiac conditions [43]. The macrophages infiltrated in adipose tissue are majorly divided into two types, classically activated macrophages (M1) and alternatively activated macrophages (M2) [44]. M1 macrophages, also named inflammatory macrophages, mainly secrete inflammatory molecules such as TNFα and IL1β, while M2 macrophages are featured with anti-inflammatory molecule IL10. Previous studies have shown that the macrophages accumulated during obesity are majorly M1 macrophages [45]. Promoting M2 macrophage polarization facilitates WAT browning [15,16] and alleviates insulin resistance [37,46]. What is more, our previous study has confirmed that intravenously infused MSCs can increase M2 macrophages in adipose tissue [25]. Therefore, in this study we explored the effect of MSCs on diet-induced obesity and explored the underlying mechanism.

The MSCs in this experiment, which was isolated from the obese patient’s visceral adipose tissue, possessed the internationally defined characteristics as expected [19]. We demonstrated that hASCs infusion could remarkably decrease the percent of fat mass and increase the percent of lean mass. And also the histologic analysis showed that hASCs infusion significantly reduced the adipocyte hypertrophy induced by HFD feeding, in accordance with increased O2 consumption, CO2 production, and energy expenditure. What is more, no differences in food intake were observed between obese group and hASCs group, indicating that the anti-obesity effects were not due to the anorectic effect caused by hASCs infusion. Consistently, Figure 2e showed that the larger shape in obese group was alleviated by hASCs infusion. The unchanged weight may be due to the short experimental time.

Previous studies have demonstrated that UCP-1 protein is required for uncoupled respiration and is responsible for the beneficial effect of BAT [47]. This study found that hASCs infusion upregulated the expression of UCP-1 and the energy metabolism-related genes in WAT. Consistently, the histologic analysis revealed that the adipocyte size was reduced by hASCs infusion. Altogether, the upregulation of UCP-1, brown adipogenic, and beige fat markers, along with the decreased adipocyte size, suggested the adipose tissue browning, which reconfirmed the enhanced energy expenditure.

To further figure out the mechanism of hASCs on obesity, we analyzed the macrophages phenotypes in adipose tissue. The results of flow cytometry analysis, western blot analysis, and RT-qPCR revealed that hASCs infusion increased M2 macrophages in adipose tissue. Previous studies have demonstrated that M2 macrophages express tyrosine hydroxylase that catalyzes the production of catecholamine, thereby driving WAT browning [15,16]. Thus, we might conclude that hASCs attenuate obesity through polarizing M2 macrophages, which was in agreement with prevenient study [48]. However, to further emphasize the importance of macrophages in mediating the effect of hASCs, future studies need to figure out the molecular mechanism of polarizing M2 macrophages and introduce transgenic mice. Additionally, there are still some unanswered questions that may limit the use of hASCs in clinical translation. First, we need to figure out the distribution of intravenously infused hASCs in vivo and how these cells exert immunomodulatory function. Second, the appropriate number of hASCs needs to be sought to exert the best therapeutic effect in clinic. Third, the long-term efficacy and safety of hASCs on obesity need further evaluation.

In conclusion, the findings of the study demonstrated that hASCs infusion decreased fat mass and suppressed adipocyte hypertrophy in the HFD-induced obese mice model. And this effect was due to the enhanced energy expenditure with the upregulation of UCP-1 protein and thermogenic genes. Furthermore, we found that hASCs infusion elevated the amount of M2 macrophages in adipose tissue, which partially explained the effect of hASCs on obesity. As we know, hASCs are easily obtained and amplified from adipose tissue. Moreover, hASCs are low immunogenicity. These characteristics determined that hASCs might be a promising therapy for obesity.

Acknowledgments

We are grateful for technical assistance from Jiejie Liu, Chuan Tong, Liang Dong, and Xin Dai. We also thank members of the Mu laboratories for insightful discussions over this work.

  1. Funding information: This research was supported in part by the National Basic Science and Development Program [2012CB518103], the 863 Projects of Ministry of Science and Technology of China [2013AA020105 and 2012AA020502].

  2. Author contributions: Z.X. designed and conducted the study, performed data analyses, and wrote the manuscript. Y.C. performed certain experiments and provided guidance for data analysis. Q.Z. and H.H. performed certain data collection and analysis. Y.Y. and L.Z. conducted certain experiments. X.W. and Y.M. designed and directed the study and revised the manuscript. All authors read and approved the final manuscript.

  3. Conflict of interest: The authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Ogden CL , Carroll MD , Kit BK , Flegal KM . Prevalence of childhood and adult obesity in the United States, 2011–2012. JAMA. 2014;311:806–14.10.1001/jama.2014.732Search in Google Scholar

[2] Ng M , Fleming T , Robinson M , Thomson B , Graetz N , Margono C , et al. Global, regional, and national prevalence of overweight and obesity in children and adults during 1980–2013: a systematic analysis for the global burden of disease study 2013. Lancet. 2014;384:766–81.10.1016/S0140-6736(14)60460-8Search in Google Scholar

[3] Gordon-Larsen P , Wang H , Popkin BM . Overweight dynamics in Chinese children and adults. Obes Rev. 2014;15(Suppl 1):37–48.10.1111/obr.12121Search in Google Scholar

[4] Kelly T , Yang W , Chen CS , Reynolds K , He J . Global burden of obesity in 2005 and projections to 2030. Int J Obes (Lond). 2008;32:1431–7.10.1038/ijo.2008.102Search in Google Scholar

[5] Mirza MS . Obesity, visceral fat, and NAFLD: querying the role of adipokines in the progression of nonalcoholic fatty liver disease. ISRN Gastroenterol. 2011;2011:592404.10.5402/2011/592404Search in Google Scholar

[6] Martin-Rodriguez E , Guillen-Grima F , Marti A , Brugos-Larumbe A . Comorbidity associated with obesity in a large population: the APNA study. Obes Res Clin Pract. 2015;9:435–47.10.1016/j.orcp.2015.04.003Search in Google Scholar

[7] Arnold M , Pandeya N , Byrnes G , Renehan AG , Stevens GA , Ezzati M , et al. Global burden of cancer attributable to high body-mass index in 2012: a population-based study. Lancet Oncol. 2015;16:36–46.10.1016/S1470-2045(14)71123-4Search in Google Scholar

[8] Williams DM , Nawaz A , Evans M . Drug therapy in obesity: a review of current and emerging treatments. Diabetes Ther. 2020;11:1199–216.10.1007/s13300-020-00816-ySearch in Google Scholar PubMed PubMed Central

[9] Harms M , Seale P . Brown and beige fat: development, function and therapeutic potential. Nat Med. 2013;19:1252–63.10.1038/nm.3361Search in Google Scholar PubMed

[10] Elattar S , Satyanarayana A . Can brown fat win the battle against white fat? J Cell Physiol. 2015;230(10):2311–7.10.1002/jcp.24986Search in Google Scholar PubMed PubMed Central

[11] Liu X , Zheng Z , Zhu X , Meng M , Li L , Shen Y , et al. Brown adipose tissue transplantation improves whole-body energy metabolism. Cell Res. 2013;23:851–4.10.1038/cr.2013.64Search in Google Scholar PubMed PubMed Central

[12] Stanford KI , Middelbeek RJ , Townsend KL , An D , Nygaard EB , Hitchcox KM , et al. Brown adipose tissue regulates glucose homeostasis and insulin sensitivity. J Clin Invest. 2013;123:215–23.10.1172/JCI62308Search in Google Scholar PubMed PubMed Central

[13] Neinast MD , Frank AP , Zechner JF , Li Q , Vishvanath L , Palmer BF , et al. Activation of natriuretic peptides and the sympathetic nervous system following Roux-en-Y gastric bypass is associated with gonadal adipose tissues browning. Mol Metab. 2015;4:427–36.10.1016/j.molmet.2015.02.006Search in Google Scholar PubMed PubMed Central

[14] Sae-Tan S , Rogers CJ , Lambert JD . Decaffeinated green tea and voluntary exercise induce gene changes related to beige adipocyte formation in high fat-fed obese mice. J Funct Foods. 2015;14:210–4.10.1016/j.jff.2015.01.036Search in Google Scholar PubMed PubMed Central

[15] Qiu Y , Nguyen KD , Odegaard JI , Cui X , Tian X , Locksley RM , et al. Eosinophils and type 2 cytokine signaling in macrophages orchestrate development of functional beige fat. Cell. 2014;157:1292–308.10.1016/j.cell.2014.03.066Search in Google Scholar PubMed PubMed Central

[16] Liu PS , Lin YW , Lee B , McCrady-Spitzer SK , Levine JA , Wei LN . Reducing RIP140 expression in macrophage alters ATM infiltration, facilitates white adipose tissue browning, and prevents high-fat diet-induced insulin resistance. Diabetes. 2014;63:4021–31.10.2337/db14-0619Search in Google Scholar PubMed PubMed Central

[17] Brestoff JR , Kim BS , Saenz SA , Stine RR , Monticelli LA , Sonnenberg GF , et al. Group 2 innate lymphoid cells promote beiging of white adipose tissue and limit obesity. Nature. 2015;519:242–6.10.1038/nature14115Search in Google Scholar PubMed PubMed Central

[18] Hui X , Gu P , Zhang J , Nie T , Pan Y , Wu D , et al. Adiponectin enhances cold-induced browning of subcutaneous adipose tissue via promoting M2 macrophage proliferation. Cell Metab. 2015;22:279–90.10.1016/j.cmet.2015.06.004Search in Google Scholar PubMed

[19] Ma S , Xie N , Li W , Yuan B , Shi Y , Wang Y . Immunobiology of mesenchymal stem cells. Cell Death Differ. 2014;21:216–25.10.1038/cdd.2013.158Search in Google Scholar PubMed PubMed Central

[20] Kim J , Hematti P . Mesenchymal stem cell-educated macrophages: a novel type of alternatively activated macrophages. Exp Hematol. 2009;37:1445–53.10.1016/j.exphem.2009.09.004Search in Google Scholar PubMed PubMed Central

[21] Ylostalo JH , Bartosh TJ , Coble K , Prockop DJ . Human mesenchymal stem/stromal cells cultured as spheroids are self-activated to produce prostaglandin E2 that directs stimulated macrophages into an anti-inflammatory phenotype. Stem Cells. 2012;30:2283–96.10.1002/stem.1191Search in Google Scholar PubMed PubMed Central

[22] Li W , Zhang Q , Wang M , Wu H , Mao F , Zhang B , et al. Macrophages are involved in the protective role of human umbilical cord-derived stromal cells in renal ischemia-reperfusion injury. Stem Cell Res. 2013;10:405–16.10.1016/j.scr.2013.01.005Search in Google Scholar PubMed

[23] Lee RH , Pulin AA , Seo MJ , Kota DJ , Ylostalo J , Larson BL , et al. Intravenous hMSCs improve myocardial infarction in mice because cells embolized in lung are activated to secrete the anti-inflammatory protein TSG-6. Cell Stem Cell. 2009;5:54–63.10.1016/j.stem.2009.05.003Search in Google Scholar PubMed PubMed Central

[24] Choi H , Lee RH , Bazhanov N , Oh JY , Prockop DJ . Anti-inflammatory protein TSG-6 secreted by activated MSCs attenuates zymosan-induced mouse peritonitis by decreasing TLR2/NF-kappaB signaling in resident macrophages. Blood. 2011;118:330–8.10.1182/blood-2010-12-327353Search in Google Scholar PubMed PubMed Central

[25] Xie Z , Hao H , Tong C , Cheng Y , Liu J , Pang Y , et al. Human umbilical cord-derived mesenchymal stem cells elicit macrophages into an anti-inflammatory phenotype to alleviate insulin resistance in type 2 diabetic rats. Stem Cells. 2016;34:627–39.10.1002/stem.2238Search in Google Scholar PubMed

[26] Gao J , Cheng Y , Hao H , Yin Y , Xue J , Zhang Q , et al. Decitabine assists umbilical cord-derived mesenchymal stem cells in improving glucose homeostasis by modulating macrophage polarization in type 2 diabetic mice. Stem Cell Res Ther. 2019;10:259.10.1186/s13287-019-1338-2Search in Google Scholar PubMed PubMed Central

[27] Yu S , Cheng Y , Zhang L , Yin Y , Xue J , Li B , et al. Treatment with adipose tissue-derived mesenchymal stem cells exerts anti-diabetic effects, improves long-term complications, and attenuates inflammation in type 2 diabetic rats. Stem Cell Res Ther. 2019;10:333.10.1186/s13287-019-1474-8Search in Google Scholar PubMed PubMed Central

[28] Camara DAD , Shibli JA , Muller EA , De-Sa-Junior PL , Porcacchia AS , Blay A , et al. Adipose tissue-derived stem cells: the biologic basis and future directions for tissue engineering. Materials (Basel). 2020;13:3210.10.3390/ma13143210Search in Google Scholar PubMed PubMed Central

[29] Cohen P , Levy JD , Zhang Y , Frontini A , Kolodin DP , Svensson KJ , et al. Ablation of PRDM16 and beige adipose causes metabolic dysfunction and a subcutaneous to visceral fat switch. Cell. 2014;156:304–16.10.1016/j.cell.2013.12.021Search in Google Scholar PubMed PubMed Central

[30] Hu F , Wang M , Xiao T , Yin B , He L , Meng W , et al. miR-30 promotes thermogenesis and the development of beige fat by targeting RIP140. Diabetes. 2015;64:2056–68.10.2337/db14-1117Search in Google Scholar PubMed PubMed Central

[31] Bieback K , Kern S , Kluter H , Eichler H . Critical parameters for the isolation of mesenchymal stem cells from umbilical cord blood. Stem Cells. 2004;22:625–34.10.1634/stemcells.22-4-625Search in Google Scholar PubMed

[32] Dominici M , Le Blanc K , Mueller I , Slaper-Cortenbach I , Marini F , Krause D , et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The international society for cellular therapy position statement. Cytotherapy. 2006;8:315–7.10.1080/14653240600855905Search in Google Scholar PubMed

[33] Cai L , Lubitz J , Flegal KM , Pamuk ER . The predicted effects of chronic obesity in middle age on medicare costs and mortality. Med Care. 2010;48:510–7.10.1097/MLR.0b013e3181dbdb20Search in Google Scholar PubMed

[34] Choe SS , Huh JY , Hwang IJ , Kim JI , Kim JB . Adipose tissue remodeling: its role in energy metabolism and metabolic disorders. Front Endocrinol (Lausanne). 2016;7:30.10.3389/fendo.2016.00030Search in Google Scholar PubMed PubMed Central

[35] Wang J , Liu R , Wang F , Hong J , Li X , Chen M , et al. Ablation of LGR4 promotes energy expenditure by driving white-to-brown fat switch. Nat Cell Biol. 2013;15:1455–63.10.1038/ncb2867Search in Google Scholar PubMed

[36] Qiang L , Wang L , Kon N , Zhao W , Lee S , Zhang Y , et al. Brown remodeling of white adipose tissue by SirT1-dependent deacetylation of Ppargamma. Cell. 2012;150:620–32.10.1016/j.cell.2012.06.027Search in Google Scholar PubMed PubMed Central

[37] Lumeng CN , Saltiel AR . Inflammatory links between obesity and metabolic disease. J Clin Invest. 2011;121:2111–7.10.1172/JCI57132Search in Google Scholar PubMed PubMed Central

[38] Osborn O , Olefsky JM . The cellular and signaling networks linking the immune system and metabolism in disease. Nat Med. 2012;18:363–74.10.1038/nm.2627Search in Google Scholar PubMed

[39] Aktas G , Alcelik A , Ozlu T , Tosun M , Tekce BK , Savli H , et al. Association between omentin levels and insulin resistance in pregnancy. Exp Clin Endocrinol Diabetes. 2014;122:163–6.10.1055/s-0034-1370917Search in Google Scholar PubMed

[40] Kocak MZ , Aktas G , Atak BM , Duman TT , Yis OM , Erkus E , et al. Is Neuregulin-4 a predictive marker of microvascular complications in type 2 diabetes mellitus? Eur J Clin Invest. 2020;50:e13206.10.1111/eci.13206Search in Google Scholar PubMed

[41] Duman TT , Aktas G , Atak BM , Kocak MZ , Erkus E , Savli H . Neutrophil to lymphocyte ratio as an indicative of diabetic control level in type 2 diabetes mellitus. Afr Health Sci. 2019;19:1602–6.10.4314/ahs.v19i1.35Search in Google Scholar PubMed PubMed Central

[42] Bilgin S , Aktas G , Kahveci G , Atak BM , Kurtkulagi O , Duman TT . Does mean platelet volume/lymphocyte count ratio associate with frailty in type 2 diabetes mellitus? Bratisl Lek Listy. 2021;122:116–9.10.4149/BLL_2021_017Search in Google Scholar PubMed

[43] Sincer I , Mansiroglu AK , Aktas G , Gunes Y , Kocak MZ . Association between hemogram parameters and coronary collateral development in subjects with non-ST-elevation myocardial infarction. Rev Assoc Med Bras. 1992;2020(66):160–5.10.1590/1806-9282.66.2.160Search in Google Scholar PubMed

[44] Olefsky JM , Glass CK . Macrophages, inflammation, and insulin resistance. Annu Rev Physiol. 2010;72:219–46.10.1146/annurev-physiol-021909-135846Search in Google Scholar PubMed

[45] Weisberg SP , McCann D , Desai M , Rosenbaum M , Leibel RL , Ferrante AW Jr . Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest. 2003;112:1796–808.10.1172/JCI200319246Search in Google Scholar

[46] Odegaard JI , Chawla A . Alternative macrophage activation and metabolism. Annu Rev Pathol. 2011;6:275–97.10.1146/annurev-pathol-011110-130138Search in Google Scholar PubMed PubMed Central

[47] Bartelt A , Heeren J . Adipose tissue browning and metabolic health. Nat Rev Endocrinol. 2014;10:24–36.10.1038/nrendo.2013.204Search in Google Scholar PubMed

[48] Zhao H , Shang Q , Pan Z , Bai Y , Li Z , Zhang H , et al. Exosomes from adipose-derived stem cells attenuate adipose inflammation and obesity through polarizing M2 macrophages and beiging in white adipose tissue. Diabetes. 2018;67:235–47.10.2337/db17-0356Search in Google Scholar PubMed

Received: 2020-10-05
Revised: 2021-05-18
Accepted: 2021-05-19
Published Online: 2021-06-25

© 2021 Zongyan Xie et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Research progress on the mechanism of orexin in pain regulation in different brain regions
  3. Adriamycin-resistant cells are significantly less fit than adriamycin-sensitive cells in cervical cancer
  4. Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
  5. Iris metastasis of diffuse large B-cell lymphoma misdiagnosed as primary angle-closure glaucoma: A case report and review of the literature
  6. LncRNA PVT1 promotes cervical cancer progression by sponging miR-503 to upregulate ARL2 expression
  7. Two new inflammatory markers related to the CURB-65 score for disease severity in patients with community-acquired pneumonia: The hypersensitive C-reactive protein to albumin ratio and fibrinogen to albumin ratio
  8. Circ_0091579 enhances the malignancy of hepatocellular carcinoma via miR-1287/PDK2 axis
  9. Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-κB signaling pathway
  10. Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats
  11. ABCB1 polymorphism in clopidogrel-treated Montenegrin patients
  12. Metabolic profiling of fatty acids in Tripterygium wilfordii multiglucoside- and triptolide-induced liver-injured rats
  13. miR-338-3p inhibits cell growth, invasion, and EMT process in neuroblastoma through targeting MMP-2
  14. Verification of neuroprotective effects of alpha-lipoic acid on chronic neuropathic pain in a chronic constriction injury rat model
  15. Circ_WWC3 overexpression decelerates the progression of osteosarcoma by regulating miR-421/PDE7B axis
  16. Knockdown of TUG1 rescues cardiomyocyte hypertrophy through targeting the miR-497/MEF2C axis
  17. MiR-146b-3p protects against AR42J cell injury in cerulein-induced acute pancreatitis model through targeting Anxa2
  18. miR-299-3p suppresses cell progression and induces apoptosis by downregulating PAX3 in gastric cancer
  19. Diabetes and COVID-19
  20. Discovery of novel potential KIT inhibitors for the treatment of gastrointestinal stromal tumor
  21. TEAD4 is a novel independent predictor of prognosis in LGG patients with IDH mutation
  22. circTLK1 facilitates the proliferation and metastasis of renal cell carcinoma by regulating miR-495-3p/CBL axis
  23. microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury
  24. Long noncoding RNA TUG1 regulates degradation of chondrocyte extracellular matrix via miR-320c/MMP-13 axis in osteoarthritis
  25. Duodenal adenocarcinoma with skin metastasis as initial manifestation: A case report
  26. Effects of Loofah cylindrica extract on learning and memory ability, brain tissue morphology, and immune function of aging mice
  27. Recombinant Bacteroides fragilis enterotoxin-1 (rBFT-1) promotes proliferation of colorectal cancer via CCL3-related molecular pathways
  28. Blocking circ_UBR4 suppressed proliferation, migration, and cell cycle progression of human vascular smooth muscle cells in atherosclerosis
  29. Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
  30. Downregulation of circ_0037655 impedes glioma formation and metastasis via the regulation of miR-1229-3p/ITGB8 axis
  31. Vitamin D deficiency and cardiovascular risk in type 2 diabetes population
  32. Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis
  33. Mechanisms of circular RNA circ_0066147 on pancreatic cancer progression
  34. lncRNA myocardial infarction-associated transcript (MIAT) knockdown alleviates LPS-induced chondrocytes inflammatory injury via regulating miR-488-3p/sex determining region Y-related HMG-box 11 (SOX11) axis
  35. Identification of circRNA circ-CSPP1 as a potent driver of colorectal cancer by directly targeting the miR-431/LASP1 axis
  36. Hyperhomocysteinemia exacerbates ischemia-reperfusion injury-induced acute kidney injury by mediating oxidative stress, DNA damage, JNK pathway, and apoptosis
  37. Potential prognostic markers and significant lncRNA–mRNA co-expression pairs in laryngeal squamous cell carcinoma
  38. Gamma irradiation-mediated inactivation of enveloped viruses with conservation of genome integrity: Potential application for SARS-CoV-2 inactivated vaccine development
  39. ADHFE1 is a correlative factor of patient survival in cancer
  40. The association of transcription factor Prox1 with the proliferation, migration, and invasion of lung cancer
  41. Is there a relationship between the prevalence of autoimmune thyroid disease and diabetic kidney disease?
  42. Immunoregulatory function of Dictyophora echinovolvata spore polysaccharides in immunocompromised mice induced by cyclophosphamide
  43. T cell epitopes of SARS-CoV-2 spike protein and conserved surface protein of Plasmodium malariae share sequence homology
  44. Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
  45. Long noncoding RNA HULC contributes to paclitaxel resistance in ovarian cancer via miR-137/ITGB8 axis
  46. Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
  47. Prognostic value of the neutrophil-to-lymphocyte ratio in acute organophosphorus pesticide poisoning
  48. Gastroprotective effects of diosgenin against HCl/ethanol-induced gastric mucosal injury through suppression of NF-κβ and myeloperoxidase activities
  49. Silencing of LINC00707 suppresses cell proliferation, migration, and invasion of osteosarcoma cells by modulating miR-338-3p/AHSA1 axis
  50. Successful extracorporeal membrane oxygenation resuscitation of patient with cardiogenic shock induced by phaeochromocytoma crisis mimicking hyperthyroidism: A case report
  51. Effects of miR-185-5p on replication of hepatitis C virus
  52. Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis
  53. Primary localized cutaneous nodular amyloidosis presenting as lymphatic malformation: A case report
  54. Multimodal magnetic resonance imaging analysis in the characteristics of Wilson’s disease: A case report and literature review
  55. Therapeutic potential of anticoagulant therapy in association with cytokine storm inhibition in severe cases of COVID-19: A case report
  56. Neoadjuvant immunotherapy combined with chemotherapy for locally advanced squamous cell lung carcinoma: A case report and literature review
  57. Rufinamide (RUF) suppresses inflammation and maintains the integrity of the blood–brain barrier during kainic acid-induced brain damage
  58. Inhibition of ADAM10 ameliorates doxorubicin-induced cardiac remodeling by suppressing N-cadherin cleavage
  59. Invasive ductal carcinoma and small lymphocytic lymphoma/chronic lymphocytic leukemia manifesting as a collision breast tumor: A case report and literature review
  60. Clonal diversity of the B cell receptor repertoire in patients with coronary in-stent restenosis and type 2 diabetes
  61. CTLA-4 promotes lymphoma progression through tumor stem cell enrichment and immunosuppression
  62. WDR74 promotes proliferation and metastasis in colorectal cancer cells through regulating the Wnt/β-catenin signaling pathway
  63. Down-regulation of IGHG1 enhances Protoporphyrin IX accumulation and inhibits hemin biosynthesis in colorectal cancer by suppressing the MEK-FECH axis
  64. Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
  65. Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway
  66. lncRNA NEAT1 regulates CYP1A2 and influences steroid-induced necrosis
  67. A two-microRNA signature predicts the progression of male thyroid cancer
  68. Isolation of microglia from retinas of chronic ocular hypertensive rats
  69. Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study
  70. Calcineurin Aβ gene knockdown inhibits transient outward potassium current ion channel remodeling in hypertrophic ventricular myocyte
  71. Aberrant expression of PI3K/AKT signaling is involved in apoptosis resistance of hepatocellular carcinoma
  72. Clinical significance of activated Wnt/β-catenin signaling in apoptosis inhibition of oral cancer
  73. circ_CHFR regulates ox-LDL-mediated cell proliferation, apoptosis, and EndoMT by miR-15a-5p/EGFR axis in human brain microvessel endothelial cells
  74. Resveratrol pretreatment mitigates LPS-induced acute lung injury by regulating conventional dendritic cells’ maturation and function
  75. Ubiquitin-conjugating enzyme E2T promotes tumor stem cell characteristics and migration of cervical cancer cells by regulating the GRP78/FAK pathway
  76. Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
  77. Protective effect of Lactobacillus-containing probiotics on intestinal mucosa of rats experiencing traumatic hemorrhagic shock
  78. Glucocorticoids induce osteonecrosis of the femoral head through the Hippo signaling pathway
  79. Endothelial cell-derived SSAO can increase MLC20 phosphorylation in VSMCs
  80. Downregulation of STOX1 is a novel prognostic biomarker for glioma patients
  81. miR-378a-3p regulates glioma cell chemosensitivity to cisplatin through IGF1R
  82. The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats
  83. TGF-β1-overexpressing mesenchymal stem cells reciprocally regulate Th17/Treg cells by regulating the expression of IFN-γ
  84. The influence of MTHFR genetic polymorphisms on methotrexate therapy in pediatric acute lymphoblastic leukemia
  85. Red blood cell distribution width-standard deviation but not red blood cell distribution width-coefficient of variation as a potential index for the diagnosis of iron-deficiency anemia in mid-pregnancy women
  86. Small cell neuroendocrine carcinoma expressing alpha fetoprotein in the endometrium
  87. Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers
  88. Molecular characterization and phylogenetic studies of Echinococcus granulosus and Taenia multiceps coenurus cysts in slaughtered sheep in Saudi Arabia
  89. ITGB5 mutation discovered in a Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
  90. ACTB and GAPDH appear at multiple SDS-PAGE positions, thus not suitable as reference genes for determining protein loading in techniques like Western blotting
  91. Facilitation of mouse skin-derived precursor growth and yield by optimizing plating density
  92. 3,4-Dihydroxyphenylethanol ameliorates lipopolysaccharide-induced septic cardiac injury in a murine model
  93. Downregulation of PITX2 inhibits the proliferation and migration of liver cancer cells and induces cell apoptosis
  94. Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B
  95. Novel predictor of the occurrence of DKA in T1DM patients without infection: A combination of neutrophil/lymphocyte ratio and white blood cells
  96. Investigation of molecular regulation mechanism under the pathophysiology of subarachnoid hemorrhage
  97. miR-25-3p protects renal tubular epithelial cells from apoptosis induced by renal IRI by targeting DKK3
  98. Bioengineering and Biotechnology
  99. Green fabrication of Co and Co3O4 nanoparticles and their biomedical applications: A review
  100. Agriculture
  101. Effects of inorganic and organic selenium sources on the growth performance of broilers in China: A meta-analysis
  102. Crop-livestock integration practices, knowledge, and attitudes among smallholder farmers: Hedging against climate change-induced shocks in semi-arid Zimbabwe
  103. Food Science and Nutrition
  104. Effect of food processing on the antioxidant activity of flavones from Polygonatum odoratum (Mill.) Druce
  105. Vitamin D and iodine status was associated with the risk and complication of type 2 diabetes mellitus in China
  106. Diversity of microbiota in Slovak summer ewes’ cheese “Bryndza”
  107. Comparison between voltammetric detection methods for abalone-flavoring liquid
  108. Composition of low-molecular-weight glutenin subunits in common wheat (Triticum aestivum L.) and their effects on the rheological properties of dough
  109. Application of culture, PCR, and PacBio sequencing for determination of microbial composition of milk from subclinical mastitis dairy cows of smallholder farms
  110. Investigating microplastics and potentially toxic elements contamination in canned Tuna, Salmon, and Sardine fishes from Taif markets, KSA
  111. From bench to bar side: Evaluating the red wine storage lesion
  112. Establishment of an iodine model for prevention of iodine-excess-induced thyroid dysfunction in pregnant women
  113. Plant Sciences
  114. Characterization of GMPP from Dendrobium huoshanense yielding GDP-D-mannose
  115. Comparative analysis of the SPL gene family in five Rosaceae species: Fragaria vesca, Malus domestica, Prunus persica, Rubus occidentalis, and Pyrus pyrifolia
  116. Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR
  117. Investigation of bioactivities of Taxus chinensis, Taxus cuspidata, and Taxus × media by gas chromatography-mass spectrometry
  118. Morphological structures and histochemistry of roots and shoots in Myricaria laxiflora (Tamaricaceae)
  119. Transcriptome analysis of resistance mechanism to potato wart disease
  120. In silico analysis of glycosyltransferase 2 family genes in duckweed (Spirodela polyrhiza) and its role in salt stress tolerance
  121. Comparative study on growth traits and ions regulation of zoysiagrasses under varied salinity treatments
  122. Role of MS1 homolog Ntms1 gene of tobacco infertility
  123. Biological characteristics and fungicide sensitivity of Pyricularia variabilis
  124. In silico/computational analysis of mevalonate pyrophosphate decarboxylase gene families in Campanulids
  125. Identification of novel drought-responsive miRNA regulatory network of drought stress response in common vetch (Vicia sativa)
  126. How photoautotrophy, photomixotrophy, and ventilation affect the stomata and fluorescence emission of pistachios rootstock?
  127. Apoplastic histochemical features of plant root walls that may facilitate ion uptake and retention
  128. Ecology and Environmental Sciences
  129. The impact of sewage sludge on the fungal communities in the rhizosphere and roots of barley and on barley yield
  130. Domestication of wild animals may provide a springboard for rapid variation of coronavirus
  131. Response of benthic invertebrate assemblages to seasonal and habitat condition in the Wewe River, Ashanti region (Ghana)
  132. Molecular record for the first authentication of Isaria cicadae from Vietnam
  133. Twig biomass allocation of Betula platyphylla in different habitats in Wudalianchi Volcano, northeast China
  134. Animal Sciences
  135. Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens
  136. Predators of the giant pine scale, Marchalina hellenica (Gennadius 1883; Hemiptera: Marchalinidae), out of its natural range in Turkey
  137. Honey in wound healing: An updated review
  138. NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block
  139. Radiotherapy for the treatment of pulmonary hydatidosis in sheep
  140. Retraction
  141. Retraction of “Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating microRNA-34a-5p/NOTCH1 signaling pathway”
  142. Special Issue on Reuse of Agro-Industrial By-Products
  143. An effect of positional isomerism of benzoic acid derivatives on antibacterial activity against Escherichia coli
  144. Special Issue on Computing and Artificial Techniques for Life Science Applications - Part II
  145. Relationship of Gensini score with retinal vessel diameter and arteriovenous ratio in senile CHD
  146. Effects of different enantiomers of amlodipine on lipid profiles and vasomotor factors in atherosclerotic rabbits
  147. Establishment of the New Zealand white rabbit animal model of fatty keratopathy associated with corneal neovascularization
  148. lncRNA MALAT1/miR-143 axis is a potential biomarker for in-stent restenosis and is involved in the multiplication of vascular smooth muscle cells
Downloaded on 2.10.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2021-0061/html
Scroll to top button