Home Life Sciences Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
Article Open Access

Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress

  • Zhibiao Liu , Bing Fei , Lisheng Xie , Jin Liu , Xiaorui Chen , Wenyan Zhu , Lingyun Lv , Wei Ma , Ziwen Gao , Jie Hou and Wandong She EMAIL logo
Published/Copyright: July 1, 2021

Abstract

Background

To analyze mechanisms of action of glucocorticoid treatment for endoplasmic reticulum stress (ERS) in sensorineural hearing loss (SNHL), we aimed to evaluate the expression and activation status of the protein kinase RNA-like ER kinase (PERK)–C/EBP homologous protein (CHOP) pathway, which is the major pathway in the ERS.

Methods

In the present study, we established an in vitro ERS model using tunicamycin-treated hair-cell-like HEI-OC1 cells. The effect of dexamethasone on proliferation inhibition, apoptosis, and ATF4–CHOP pathway in HEI-OC1 cells was examined by CCK-8 assay, flow cytometry, western blotting, and reverse transcription PCR, respectively.

Results

In HEI-OC1 cells, dexamethasone was shown to significantly reduce the tunicamycin-induced expression of ATF4 and CHOP in the context of sustained viability and proliferation, a therapeutic effect that was reversible by co-treatment with a glucocorticoid antagonist.

Conclusion

Dexamethasone can protect hair-cell-like HEI-OC1 cells from ERS damage, which may be one of the mechanisms of action for GCs in SNHL treatment.

1 Introduction

Endoplasmic reticulum (ER) is an important organelle to maintain normal cellular homeostasis. When eukaryotic cells are exposed to pathophysiological stressors, a large number of misfolded proteins accumulate in the ER and activate endoplasmic reticulum stress (ERS) [1]. ERS is related to many human diseases [1,2]. During the early stages of ERS, cells can adapt to altered environmental conditions by reducing unfolded or misfolded protein. However, if stress conditions persist, cells undergo apoptosis [3]. Protein kinase RNA-like ER kinase (PERK) is a predominant ERS-induced apoptotic signaling pathway and it is activated by phosphorylation, thereby phosphorylating eukaryotic initiation factor 2α (eIF2α). p-eIF2α can promote the expression of activating transcription factor 4 (ATF4) and C/EBP homologous protein (CHOP) [4,5]. After CHOP expression increases considerably, CHOP accumulates in the nucleus and ultimately results in apoptosis [5]. In several animal models of sensorineural hearing loss (SNHL), ERS was believed to be associated with inner ear injuries [6,7,8,9].

Glucocorticoids (GCs) regulate many complex signaling pathways [10,11,12]. It has been reported that, under ERS conditions, there is crosstalk between CHOP and GR signaling, which is associated with a glucocorticoid receptor (GR)-CHOP heterocomplex formation [13].

Therefore, we hypothesized that GCs might protect inner ear cells from ERS damage. In the present study, we examined the effects of GCs on the expression of proteins associated with the PERK–CHOP pathway in HEI-OC1 cells to validate a putative role of ERS in SNHL and to determine whether GCs can reduce ERS.

2 Materials and methods

2.1 Cell culture and drug administration

HEI-OC1 cells were obtained from the Chinese academy of medical science. The cells were maintained in DMEM medium (Life technologies) supplemented with 10% Fetal Bovine Serum (FBS Life technologies) and 100 U/mL penicillin along with 200 mg/mL streptomycin. 1 × 104 HEI-OC1 cells were seeded in 96-well microplates and cultured for 24 h. Cultures were then assigned to three groups. In the first group, cells were cultured with various concentrations of tunicamycin (TM) (0.1, 0.5, 1, 5, or 10 µg/mL) in DMEM culture medium for 12, 24, 36, or 48 h to determine the optimal concentration and culture time for tunicamycin-mediated inhibition. In the second group, cells were pretreated with various concentrations of dexamethasone (DEX) (0.2, 2, 20, or 200 nmol/mL) for 12 h and then treated with the optimal concentration of tunicamycin in DMEM culture medium to determine the optimal concentration of dexamethasone for reducing tunicamycin-mediated inhibition. In the third group, cells were pretreated with different concentrations of mifepristone (MIF) (0.2, 2, 20, and 200 nmol/mL) and the optimal concentration of dexamethasone for 12 h followed by culturing with tunicamycin to determine the optimal concentration of mifepristone-mediated antagonism of the therapeutic effects elicited by dexamethasone. The inhibition rate of cell proliferation was detected using the CCK-8 Cell Proliferation Detection Kit (Tianjin Bayang Huake Biotechnology Co., Ltd, China.). The optimized conditions were then used to conduct comparative analyses between cultures, using appropriate controls containing no drugs or with individual drug treatments.

2.2 Flow cytometry (FACS)

Flow cytometric analysis has been done using Annexin V/Propidium Iodide (PI) Apoptosis Detection Kit (Beyotime, Shanghai, China) according to the manufacturer’s instructions. HEI-OC1 cells (3 × 105) were collected and stained with 5 μL Annexin V-APC and 5 μL PI in the dark at room temperature for 10 min. Data were then acquired on a BD Accuri™ C6 Plus flow cytometer (BD, Franklin Lakes, NJ, USA) and analyzed by Flow Jo V10 software (Tree Star Software, San Carlos, CA, USA).

2.3 qPCR and mRNA extraction

Total RNA was extracted from HEI-OC1 Cells using TRIzol reagent. cDNA was then obtained by reverse-transcription. Real-time PCR was performed with the Applied Biosystems QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Singapore). The M-MLV was applied to synthesize cDNA through reverse-transcription. For cDNA synthesis, samples were incubated at 43°C for 30 min, 97°C for 5 min, and 5°C for 5 min. The thermal cycle conditions for real-time PCR included an initial denaturation at 95°C for 30 s, followed by 40 cycles of 5 s denaturation at 95°C and 30 s extension at 60°C. Relative fold changes were determined by 2ΔΔCt method [14]. Primer sequences of PERK, eIF2α, ATF4, CHOP, and β-actin that were used in real-time PCR are listed in Table 1.

Table 1

Sequences for real-time PCR primers

Gene Sequences (5′ → 3′) Amplification efficiency
PERK F: GTACTGACTCCAATGCCAGCCTA 1.00
R: CATCTGGGTGCTGAATGGGTA
eIF2α F: ATGGTTATGAAGGCATTGATGCTG 1.00
R: TGTCATCACATACCTGGGTGGAG
ATF4 F: CTATGGATGATGGCTTGGCCA 1.01
R:CCAACGTGGTCAAGAGCTCAT
CHOP F: AGTGCATCTTCATACACCACCACA 1.02
R: CAGATCCTCATACCAGGCTTCCA
β-Actin F: AGAGGGAAATCGTGCGTGAC 1.03
R: CAATAGTGATGACCTGGCCGT

2.4 Western blotting

Total protein was extracted from HEI-OC1 Cells by using RIPA buffer with protease and phosphatase inhibitors. Protein concentration was determined by BCA assay. Thirty micrograms of protein were resolved by SDS-PAGE and then transferred onto a PVDF membrane. The membrane was blocked with 5% BSA for 1 h at room temperature and then incubated with the primary antibodies (PERK, or eIF2α, or p-eIF2α, Cell Signaling Tech, USA; p-PERK, ImmunoWay, USA; ATF4, Abcam, UK; CHOP, or BAX, or Bcl-2, Proteintech, USA. 1:1,000/each antibody) at 4°C overnight. After washing with TBST, the membranes were incubated with appropriate secondary antibodies (anti-rabbit IgG, 1:10,000, Fcmacs, China) for 2 h at room temperature. ECL substrate was used to visualize the bands, and the blots were developed by Tanon 5200 Multi fully automatic fluorescence/chemiluminescence image analysis system (Tanon Science & Technology Co, Ltd, Shanghai, China). Protein bands were analyzed for densitometry using NIH Image J software.

2.5 Statistical analysis

All data were expressed as mean ± standard deviation. SPSS20.0 software (IBM Corp. Armonk, NY, USA) was used for statistical analyses. The independent samples t-test was used to compare the values of means between groups. A value of p < 0.05 was considered a statistically significant difference. All experiments have been done in three independent replicas.

3 Result

3.1 Dexamethasone reversed mifepristone and tunicamycin’s ERS and apoptotic effect in HEI-OC1 cells

HEI-OC1 cells were treated with various concentrations (0.1, 0.5, 1, 5, 10 µg/mL) of tunicamycin (TM) for 12, 24, 36, and 48 h. TM inhibited the proliferation of HEI-OC1 cells in a dose- and time-dependent manner. TM (5 µg/mL – 36 h) significantly inhibit the proliferation of HEI-OC1 cell in both time and dose-dependent manners (p < 0.05) (Figure 1a). HEI-OC1 cells were then pretreated with various concentrations (0.2, 2, 20, or 200 nmol/mL) of glucocorticoid dexamethasone (DXM); after 12 h, 5 µg/mL of TM was added into the medium and cells were cultured for additional 36 h. The optimal concentration of DXM was found to be 20 nmol/mL (Figure 1b). All doses of DXM reduced the TM-induced inhibition of HEI-OC1 cell proliferation (all p < 0.05).

Figure 1 
                  The effects of tunicamycin, dexamethasone, and mifepristone on the proliferation of HEI-OC1 cells. (a) Dose-response of tunicamycin on the proliferation of HEI-OC1 cells. While significant inhibition of HEI-OC1 cell proliferation was observed at all test doses of tunicamycin and at all time points (all p < 0.05), the strongest inhibition of tunicamycin on the proliferation of HEI-OC1 cells was observed at 36 h postexposure at a concentration of 5 µg/mL (p < 0.05). (b) Dose-response profile of dexamethasone pretreatment on the proliferation of HEI-OC1 cells. HEI-OC1 cells were pretreated with various concentrations of dexamethasone (0–200 nmol/mL) for 12 h before culturing with 5 µg/mL of tunicamycin. Dexamethasone alleviated the inhibition of tunicamycin on HEI-OC1 cell proliferation (all p < 0.05). The optimal dose of dexamethasone was 20 nmol/mL (p < 0.05). (c) Dose-response profile of mifepristone-mediated antagonism of dexamethasone protection of HEI-OC1 cells from tunicamycin-induced proliferation inhibition. Cells were pretreated with various concentrations of mifepristone (0–200 nmol/mL) and 20 nmol/mL of dexamethasone for 12 h and then cultured with 5 µg/mL tunicamycin for 36 h. Mifepristone reversed the protective effect of dexamethasone (all p < 0.05). The optimal concentration of mifepristone was 20 nmol/mL (p < 0.05). All results are expressed as 
                        
                           
                           
                              
                                 X
                                 ¯
                              
                              ±
                              SD
                           
                           \bar{X}\pm \text{SD}
                        
                     , * indicates p < 0.05.
Figure 1

The effects of tunicamycin, dexamethasone, and mifepristone on the proliferation of HEI-OC1 cells. (a) Dose-response of tunicamycin on the proliferation of HEI-OC1 cells. While significant inhibition of HEI-OC1 cell proliferation was observed at all test doses of tunicamycin and at all time points (all p < 0.05), the strongest inhibition of tunicamycin on the proliferation of HEI-OC1 cells was observed at 36 h postexposure at a concentration of 5 µg/mL (p < 0.05). (b) Dose-response profile of dexamethasone pretreatment on the proliferation of HEI-OC1 cells. HEI-OC1 cells were pretreated with various concentrations of dexamethasone (0–200 nmol/mL) for 12 h before culturing with 5 µg/mL of tunicamycin. Dexamethasone alleviated the inhibition of tunicamycin on HEI-OC1 cell proliferation (all p < 0.05). The optimal dose of dexamethasone was 20 nmol/mL (p < 0.05). (c) Dose-response profile of mifepristone-mediated antagonism of dexamethasone protection of HEI-OC1 cells from tunicamycin-induced proliferation inhibition. Cells were pretreated with various concentrations of mifepristone (0–200 nmol/mL) and 20 nmol/mL of dexamethasone for 12 h and then cultured with 5 µg/mL tunicamycin for 36 h. Mifepristone reversed the protective effect of dexamethasone (all p < 0.05). The optimal concentration of mifepristone was 20 nmol/mL (p < 0.05). All results are expressed as X ¯ ± SD , * indicates p < 0.05.

To understand the glucocorticoid receptor (GR) role in this therapeutic response, HEI-OC1 cells were pretreated with the optimal therapeutic dose of DXM(20 nmol/mL) in the presence of various concentrations (0.2, 2, 20, or 200 nmol/mL) of the GR antagonist, mifepristone (MIF). After 12 h, 5 µg/mL of TM was added into the medium, and the cells were cultured for an additional 36 h. All test doses of MIF reduced the protective effect of dexamethasone (20 nmol/mL) against TM-induced inhibition of HEI-OC1 cell proliferation (p < 0.05, 1C).

Investigating DXM potential protection against the damage induced by ERS, HEI-OC1 cells were incubated with 5 µg/mL of TM alone or following pretreatment with DXM (20 nmol/mL), MIF (20 nmol/mL), or DXM + MIF. Flow cytometry was used to detect apoptosis. Compared to the normal control group, no increased apoptosis was observed in cells treated with DXM or MIF alone (p > 0.05). Increased apoptosis was observed in the TM, TM + DXM, TM + MIF, and TM + DXM + MIF groups compared to the control group (p < 0.05, Figure 2d–g). However, apoptosis was significantly decreased in the TM + DXM group compared to the TM group (p < 0.05, Figure 2d and e), and more apoptotic cells were counted in the TM + DXM + MIF group compared to the TM + DXM group (p < 0.05, Figure 2e and g). These results indicate that TM-induced ERS promoted apoptosis in HEI-OC1 cells and that DXM-mediated protection of HEI-OC1 cells from this pathological response could be reversed by MIF.

Figure 2 
                  Dexamethasone protects HEI-OC1 cells from tunicamycin-induced apoptosis. Examples of flow cytometry analysis of apoptosis in the control group (a), the DXM group (b), the MIF group (c), the TM group (d), the TM + DXM group (e), the TM + MIF group (f), and the TM + DXM + MIF group (g). Apoptosis rates were statistically analyzed (h). Compared to the control group, no increased apoptosis was observed in the DXM and MIF groups (all p > 0.05). Significantly more apoptosis was observed in the TM, TM + MIF, TM + DXM, and TM + DXM + MIF groups compared to the control group (all p < 0.05). However, dexamethasone treatment (TM + DXM) significantly protected HEI-OC1 cells from tunicamycin-induced apoptosis, and mifepristone (TM + DXM + MIF) reversed this protective effect (all p < 0.05). Mifepristone pretreatment did not alter the apoptosis rate in the TM + MIF group compared to the TM alone group (p > 0.05). All results are expressed as 
                        
                           
                           
                              
                                 X
                                 ¯
                              
                              ±
                              SD
                           
                           \bar{X}\pm \text{SD}
                        
                     , * indicates p < 0.05.
Figure 2

Dexamethasone protects HEI-OC1 cells from tunicamycin-induced apoptosis. Examples of flow cytometry analysis of apoptosis in the control group (a), the DXM group (b), the MIF group (c), the TM group (d), the TM + DXM group (e), the TM + MIF group (f), and the TM + DXM + MIF group (g). Apoptosis rates were statistically analyzed (h). Compared to the control group, no increased apoptosis was observed in the DXM and MIF groups (all p > 0.05). Significantly more apoptosis was observed in the TM, TM + MIF, TM + DXM, and TM + DXM + MIF groups compared to the control group (all p < 0.05). However, dexamethasone treatment (TM + DXM) significantly protected HEI-OC1 cells from tunicamycin-induced apoptosis, and mifepristone (TM + DXM + MIF) reversed this protective effect (all p < 0.05). Mifepristone pretreatment did not alter the apoptosis rate in the TM + MIF group compared to the TM alone group (p > 0.05). All results are expressed as X ¯ ± SD , * indicates p < 0.05.

3.2 Tunicamycin upregulated the expression of ATF-4 and CHOP proteins in HEI-OC1 cells

To study the effects of TM-induced ERS at the molecular level, HEI-OC1 cells were treated with increasing concentrations of TM (0–10 µg/mL) between 0 and 48 h. The expression of ATF4 and CHOP proteins was significantly increased with increasing TM concentrations and culture times (Figure 3a and b). A dose-response profile for ATF4 and CHOP expression was observed across the 0.5–5 µg/mL concentration range of TM (p < 0.05, Figure 3c and d). This TM-induced ATF4 and CHOP expression were significantly increased with extended cultured intervals (p < 0.05, Figure 3e and f).

Figure 3 
                  Effects of tunicamycin on the expression of ATF4 and CHOP in HEI-OC1 cells. (a) Example of western blots of ATF4 and CHOP protein expression in HEI-OC1 cells treated with various concentrations of tunicamycin (0–10 µg/mL) for 36 h. The expression of ATF4 and CHOP proteins in HEI-OC1 cells gradually increased with increasing concentrations of tunicamycin. (b) Example of western blots of ATF4 and CHOP protein expression in HEI-OC1 cells cultured with 5 µg/mL of tunicamycin for various culture times (0–48 h). The expression of ATF4 and CHOP proteins in HEI-OC1 cells gradually increased in the presence of TM with longer culture times. The western blots were quantitatively analyzed (c–f). A dose-response on ATF4 and CHOP expression was observed across the concentration range of 0.5–5 µg/mL of tunicamycin (all p < 0.05, c and d). At a fixed dose of 5 µg/mL tunicamycin, increased ATF4 protein was expressed when the cells cultured longer (all p < 0.05, e). Similar time-dependent effects on protein expression were also observed for CHOP when the cells were cultured for 24–36 h in the presence of tunicamycin (all p < 0.05, f). All results are expressed as 
                        
                           
                           
                              
                                 X
                                 ¯
                              
                              ±
                              SD
                           
                           \bar{X}\pm \text{SD}
                        
                     , * indicates p < 0.05.
Figure 3

Effects of tunicamycin on the expression of ATF4 and CHOP in HEI-OC1 cells. (a) Example of western blots of ATF4 and CHOP protein expression in HEI-OC1 cells treated with various concentrations of tunicamycin (0–10 µg/mL) for 36 h. The expression of ATF4 and CHOP proteins in HEI-OC1 cells gradually increased with increasing concentrations of tunicamycin. (b) Example of western blots of ATF4 and CHOP protein expression in HEI-OC1 cells cultured with 5 µg/mL of tunicamycin for various culture times (0–48 h). The expression of ATF4 and CHOP proteins in HEI-OC1 cells gradually increased in the presence of TM with longer culture times. The western blots were quantitatively analyzed (c–f). A dose-response on ATF4 and CHOP expression was observed across the concentration range of 0.5–5 µg/mL of tunicamycin (all p < 0.05, c and d). At a fixed dose of 5 µg/mL tunicamycin, increased ATF4 protein was expressed when the cells cultured longer (all p < 0.05, e). Similar time-dependent effects on protein expression were also observed for CHOP when the cells were cultured for 24–36 h in the presence of tunicamycin (all p < 0.05, f). All results are expressed as X ¯ ± SD , * indicates p < 0.05.

3.3 Effects of dexamethasone and mifepristone on the upregulation of ATF-4 and CHOP induced by tunicamycin in HEI-OC1 cells

The ERS-related expression of PERK, eIF2α, ATF4, and CHOP in HEI-OC1 cells was then examined by western blot and Qrt-PCR in the context of therapeutic pretreatment with DXM. TM treatment significantly upregulated the protein expression of BAX, p-PERK, p-eIF2α, ATF4, and CHOP (Figure 4a and b), downregulated the protein expression of Bcl-2, and upregulated mRNA expression of ATF4 and CHOP (p < 0.05) (Figure 4c); pretreatment with DXM reversed TM’s effect (all p < 0.05, Figure 4a and b). DXM-mediated inhibition of ERS was reversed by co-treatment with MIF, demonstrating specificity for the antagonistic response at the molecular levels. These results suggest that DXM protects HEI-OC1 cells from ERS-induced apoptosis by inhibiting BAX, p-PERK, p-eIF2α, ATF4, and CHOP expression and increasing the Bcl-2 expression.

Figure 4 
                  Effects of dexamethasone and mifepristone on the upregulation of ATF-4 and CHOP induced by tunicamycin in HEI-OC1 cells. (a and b) Example of western blots of ATF4, CHOP, PERK, eIF2α, BAX, and Bcl-2 expression after drug treatment. Upregulation of ATF4, CHOP, BAX, PERK, and eIF2α expression and downregulation of Bcl-2 were observed in the TM, TM + MIF, and TM + DXM + MIF groups. The upregulation of ATF4, CHOP, BAX, PERK, and eIF2α and the downregulation of Bcl-2 were blocked by dexamethasone in the TM + DXM group. (c) Similar results were also observed in the expression pattern of ATF4 and CHOP mRNA levels in each test group. The expression of PERK and eIF2ɑ mRNA was not changed after drug treatment (all p > 0.05). All results are expressed as 
                        
                           
                           
                              
                                 X
                                 ¯
                              
                              ±
                              SD
                           
                           \bar{X}\pm \text{SD}
                        
                     , * indicates p < 0.05.
Figure 4

Effects of dexamethasone and mifepristone on the upregulation of ATF-4 and CHOP induced by tunicamycin in HEI-OC1 cells. (a and b) Example of western blots of ATF4, CHOP, PERK, eIF2α, BAX, and Bcl-2 expression after drug treatment. Upregulation of ATF4, CHOP, BAX, PERK, and eIF2α expression and downregulation of Bcl-2 were observed in the TM, TM + MIF, and TM + DXM + MIF groups. The upregulation of ATF4, CHOP, BAX, PERK, and eIF2α and the downregulation of Bcl-2 were blocked by dexamethasone in the TM + DXM group. (c) Similar results were also observed in the expression pattern of ATF4 and CHOP mRNA levels in each test group. The expression of PERK and eIF2ɑ mRNA was not changed after drug treatment (all p > 0.05). All results are expressed as X ¯ ± SD , * indicates p < 0.05.

4 Discussion

GCs have vast effects on the metabolic, immunological, and homeostatic functions. In the inner ear, it directly targets the glucocorticoid receptor (GR) [15]. After GCs were delivered in the inner ear, thousands of inner ear genes were affected and this number increased significantly [16]. GCs have been widely used in the protection of inner ear injury. For example, GCs could significantly improve the auditory brainstem response threshold after acoustic overexposure [17]. Also, recently many hospitals consider GCs being applied perioperatively in patients undergoing cochlear implantation as a promising treatment regimen [18]. On the other hand, high doses of corticosterone can impair auditory nerve processing [19].

ERS is considered a common cause of various sensorineural deafness. Sensorineural hearing loss is reported to be associated with ERS in animal studies. Whether GCs can protect inner ear cells by inhibiting ER stress remains unclear [20,21,22]. We speculate that ERS may be prominent in the inner ear cells of patients suffering from SNHL. However, the relationship between GCs and ERS is immensely complicated, and the effects of GCs whether inhibiting or promoting ERS can differ upon different cells [23,24]. Question remains, if the inner ear cells are damaged in SSNHL patients, will GCs promote or inhibit ERS? To answer this question, we used tunicamycin (the most common drug used to induce ERS) to treat hair-cell-like HEI-OC1 cells as an in vitro system for modeling inner ear ERS damage. Additionally, we pretreated HEI-OC1 cells with GCs to investigate whether GCs have protective effects against ERS damage. We found that dexamethasone can effectively protect HEI-OC1 cells from ERS damage. Also, these effects could be inhibited by mifepristone, a well-studied GC antagonist.

In order to explore the relationship between ERS and apoptosis, we further determined the protein expression of BAX and Bcl-2 in HEI-OC1 cells. We found that TM significantly upregulated the protein expression of BAX and downregulated the protein expression of Bcl-2 in HEI-OC1. Previous studies have found that ERS can induce apoptosis in H9c2 cell and MLTC-1 cells, which was similar to our results. To determine the role of GCs in ERS-induced apoptosis, we examined the protein expression of ERS marker genes. Interestingly, GCs not only inhibited the expression of p-PERK, p-eIF2α, ATF4, and CHOP, but also reversed the expression of apoptosis-related proteins. These results indicated that GCs may reduce apoptosis by alleviating ERS.

After binding to GRs, GCs enter the nucleus and control the activity of large gene networks associated with a variety of developmental and metabolic processes [25]. GCs may inhibit ERS and protect cells through multiple pathways. For instance, GCs can inhibit ERS by promoting the secretion of correctly folded proteins and degradation of misfolded proteins; GRs may undergo re-localization and phosphorylation by ERS inducers, thereby decreasing ERS; GCs can alleviate ERS response by inducing leucine zippers, and the interactions of GR-bound GCs with CHOP can reverse tunicamycin-induced cell death [13,24,26]. To determine the molecular mechanisms of GC-mediated mitigation of ERS damage in inner ear cells, dexamethasone and mifepristone were used to pretreat HEI-OC1 cells in this study. The Figure 5 was drew to explain the mechanisms of action of glucocorticoid treatment ERS in SNHL.

Figure 5 
               Mechanisms of action of glucocorticoid treatment ERS in SNHL.
Figure 5

Mechanisms of action of glucocorticoid treatment ERS in SNHL.

We found that dexamethasone could suppress tunicamycin-induced increases in ATF4 and CHOP expression in HEI-OC1 cells. Attenuation of ERS in inner ear cells may, therefore, represent an important mechanism of action for GCs to elicit their therapeutic effects in patients with SNHL.

In conclusion, our results suggest that GCs can inhibit ERS-related ATF4 and CHOP expression and confer protective effects against ERS damage and potential apoptosis in inner ear cells; and also that GCs may alleviate SNHL by inhibiting ERS, which may be one of the mechanisms of action for GC treatment in patients with SNHL. This study provided a theoretical basis for clinical treatment of SNHL.


These authors contributed equally to this work.


Acknowledgment

The authors would like to thank Drs. Xiaoping Du and Matthew B. West (Hough Ear Institute, OK, USA) for their critical reviews and thoughtful feedback during the preparation of our manuscript.

  1. Funding information: This work was supported by the National Natural Science Funds of China (81271074); the Six Talent Peaks Project of Jiangsu Province (WSW-075); the Medical Science and Technology Development key Foundation of the Department of Health of Nanjing City (ZKX17019); and the Jiangsu Provincial Key Medical Discipline (ZDXKB2016015), P.R. China.

  2. Author contributions: W.S., Substantial contribution to the design of the manuscript, revising it critically for important intellectual content. Z.L.: Preparing the main paper. Z.L., B.F.: Substantial contribution to literature search, data analysis, and interpretation. L.X., J.L., X.C., W.Z., L.L.,W.M., Z.G., J.H.: Substantial contribution to literature search. Z.L.: Drafting the manuscript and revising it critically for important intellectual content. All authors read and approved the final manuscript. All listed authors have approved the manuscript before submission, including the names and order of authors.

  3. Conflict of interest: The authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Liu MQ, Chen Z, Chen LX. Endoplasmic reticulum stress: a novel mechanism and therapeutic target for cardiovascular diseases. Acta Pharmacol Sin. 2016;37(4):425–43.10.1038/aps.2015.145Search in Google Scholar PubMed PubMed Central

[2] Louessard M, Bardou I, Lemarchand E, Thiebaut AM, Parcq J, Leprince J, et al. Activation of cell surface GRP78 decreases endoplasmic reticulum stress and neuronal death. Cell Death Differ. 2017;24(9):1518–29.10.1038/cdd.2017.35Search in Google Scholar PubMed PubMed Central

[3] Hetz C, Chevet E, Harding HP. Targeting the unfolded protein response in disease. Nat Rev Drug Discov. 2013;12(9):703–19.10.1038/nrd3976Search in Google Scholar PubMed

[4] Nougarède A, Tesnière C, Ylanko J, Rimokh R, Gillet G, Andrews DW. Improved IRE1 and PERK pathway sensors for multiplex endoplasmic reticulum stress assay reveal stress response to nuclear dyes used for image segmentation. Assay Drug Dev Technol. 2018;16(6):350–60.10.1089/adt.2018.862Search in Google Scholar PubMed

[5] Kim J, Song H, Heo HR, Kim JW, Kim HR, Hong Y, et al. Cadmium-induced ER stress and inflammation are mediated through C/EBP-DDIT3 signaling in human bronchial epithelial cells. Exp Mol Med. 2017;49(9):e372.10.1038/emm.2017.125Search in Google Scholar PubMed PubMed Central

[6] Kalinec GM, Thein P, Parsa A, Yorgason J, Luxford W, Urrutia R, et al. Acetaminophen and NAPQI are toxic to auditory cells via oxidative and endoplasmic reticulum stress-dependent pathways. Hear Res. 2014;313:26–37.10.1016/j.heares.2014.04.007Search in Google Scholar PubMed PubMed Central

[7] Zong S, Liu T, Wan F, Chen P, Luo P, Xiao H. Endoplasmic reticulum stress is involved in cochlear cell apoptosis in a cisplatin-induced ototoxicity rat model. Audiol Neurootol. 2017;22(3):160–8.10.1159/000480346Search in Google Scholar PubMed

[8] Hu J, Li B, Apisa L, Yu H, Entenman S, Xu M, et al. ER stress inhibitor attenuates hearing loss and hair cell death in Cdh23erl/erl mutant mice. Cell Death Dis. 2016;7(11):e2485.10.1038/cddis.2016.386Search in Google Scholar PubMed PubMed Central

[9] Xue Q, Li C, Chen J, Guo H, Li D, Wu X. The protective effect of the endoplasmic reticulum stress-related factors BiP/GRP78 and CHOP/Gadd153 on noise-induced hearing loss in guinea pigs. Noise Health. 2016;18(84):247–55.10.4103/1463-1741.192481Search in Google Scholar PubMed PubMed Central

[10] Sevilla LM, Pérez P. Roles of the glucocorticoid and mineralocorticoid receptors in skin pathophysiology. Int J Mol Sci. 2018;19:7.10.3390/ijms19071906Search in Google Scholar PubMed PubMed Central

[11] Alam MM, Okazaki K, Nguyen L, Ota N, Kitamura H, Murakami S, et al. Glucocorticoid receptor signaling represses the antioxidant response by inhibiting histone acetylation mediated by the transcriptional activator NRF2. J Biol Chem. 2017;292(18):7519–30.10.1074/jbc.M116.773960Search in Google Scholar PubMed PubMed Central

[12] Whirledge S, DeFranco DB. Glucocorticoid signaling in health and disease: insights from tissue-specific GR knockout mice. Endocrinology. 2018;159(1):46–64.10.1210/en.2017-00728Search in Google Scholar PubMed PubMed Central

[13] Mihailidou C, Panagiotou C, Kiaris H, Kassi E, Moutsatsou P. Crosstalk between C/EBP homologous protein (CHOP) and glucocorticoid receptor in lung cancer. Mol Cell Endocrinol. 2016;436:211–23.10.1016/j.mce.2016.08.001Search in Google Scholar PubMed

[14] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402–8.10.1006/meth.2001.1262Search in Google Scholar PubMed

[15] Kumagami H, Terakado M, Takahashi H. Distribution of glucocorticoid receptors and 11β-hydroxysteroid dehydrogenase isoforms in the human inner ear. Otol Neurotol. 2013;34(1):151–7.10.1097/MAO.0b013e31826a55adSearch in Google Scholar PubMed

[16] Trune DR, Shives KD, Hausman F, Kempton JB, MacArthur CJ, Choi D. Intratympanically delivered steroids impact thousands more inner ear genes than systemic delivery. Ann Otol Rhinol Laryngol. 2019;128(6_suppl):134S–8S.10.1177/0003489419837562Search in Google Scholar PubMed

[17] Tabuchi K, Murashita H, Sakai S, Hoshino T, Uemaetomari I, Hara A. Therapeutic time window of methylprednisolone in acoustic injury. Otol Neurotol. 2006;27(8):1176–9.10.1097/01.mao.0000226313.82069.3fSearch in Google Scholar PubMed

[18] Honeder C, Zhu C, Gausterer JC, Schöpper H, Ahmadi N, Saidov N, et al. Sustained-release triamcinolone acetonide hydrogels reduce hearing threshold shifts in a model for cochlear implantation with hearing preservation. Audiol Neurootol. 2019;24(5):237–44.10.1159/000501331Search in Google Scholar PubMed

[19] Singer W, Kasini K, Manthey M, Eckert P, Armbruster P, Vogt MA, et al. The glucocorticoid antagonist mifepristone attenuates sound-induced long-term deficits in auditory nerve response and central auditory processing in female rats. FASEB J. 2018;32(6):3005–19.10.1096/fj.201701041RRRSearch in Google Scholar PubMed

[20] Ermutlu G, Süslü N, Yılmaz T, Saraç S. Sudden hearing loss: an effectivity comparison of intratympanic and systemic steroid treatments. Eur Arch Otorhinolaryngol. 2017;274(10):3585–91.10.1007/s00405-017-4691-8Search in Google Scholar PubMed

[21] Chin CJ, Dorman K. Sudden sensorineural hearing loss. CMAJ. 2017;189(11):E437–8.10.1503/cmaj.161191Search in Google Scholar PubMed PubMed Central

[22] Lai D, Zhao F, Jalal N, Zheng Y. Intratympanic glucocorticosteroid therapy for idiopathic sudden hearing loss: meta-analysis of randomized controlled trials. Med (Baltim). 2017;96(50):e8955.10.1097/MD.0000000000008955Search in Google Scholar PubMed PubMed Central

[23] Smith M, Wilkinson S. ER homeostasis and autophagy. Essays Biochem. 2017;61(6):625–35.10.1042/EBC20170092Search in Google Scholar PubMed PubMed Central

[24] André F, Corazao-Rozas P, Idziorek T, Quesnel B, Kluza J, Marchetti P. GILZ overexpression attenuates endoplasmic reticulum stress-mediated cell death via the activation of mitochondrial oxidative phosphorylation. Biochem Biophys Res Commun. 2016;478(2):513–20.10.1016/j.bbrc.2016.07.053Search in Google Scholar PubMed

[25] Bain DL, Yang Q, Connaghan KD, Robblee JP, Miura MT, Degala GD, et al. Glucocorticoid receptor-DNA interactions: binding energetics are the primary determinant of sequence-specific transcriptional activity. J Mol Biol. 2012;422(1):18–32.10.1016/j.jmb.2012.06.005Search in Google Scholar PubMed

[26] Hu DD, Mai JN, He LY, Li PQ, Chen WX, Yan JJ, et al. Glucocorticoids prevent enterovirus 71 capsid protein VP1 induced calreticulin surface exposure by alleviating neuronal ER stress. Neurotox Res. 2017;31(2):204–17.10.1007/s12640-016-9670-0Search in Google Scholar PubMed

Received: 2020-07-10
Revised: 2021-02-20
Accepted: 2021-03-24
Published Online: 2021-07-01

© 2021 Zhibiao Liu et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Research progress on the mechanism of orexin in pain regulation in different brain regions
  3. Adriamycin-resistant cells are significantly less fit than adriamycin-sensitive cells in cervical cancer
  4. Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
  5. Iris metastasis of diffuse large B-cell lymphoma misdiagnosed as primary angle-closure glaucoma: A case report and review of the literature
  6. LncRNA PVT1 promotes cervical cancer progression by sponging miR-503 to upregulate ARL2 expression
  7. Two new inflammatory markers related to the CURB-65 score for disease severity in patients with community-acquired pneumonia: The hypersensitive C-reactive protein to albumin ratio and fibrinogen to albumin ratio
  8. Circ_0091579 enhances the malignancy of hepatocellular carcinoma via miR-1287/PDK2 axis
  9. Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-κB signaling pathway
  10. Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats
  11. ABCB1 polymorphism in clopidogrel-treated Montenegrin patients
  12. Metabolic profiling of fatty acids in Tripterygium wilfordii multiglucoside- and triptolide-induced liver-injured rats
  13. miR-338-3p inhibits cell growth, invasion, and EMT process in neuroblastoma through targeting MMP-2
  14. Verification of neuroprotective effects of alpha-lipoic acid on chronic neuropathic pain in a chronic constriction injury rat model
  15. Circ_WWC3 overexpression decelerates the progression of osteosarcoma by regulating miR-421/PDE7B axis
  16. Knockdown of TUG1 rescues cardiomyocyte hypertrophy through targeting the miR-497/MEF2C axis
  17. MiR-146b-3p protects against AR42J cell injury in cerulein-induced acute pancreatitis model through targeting Anxa2
  18. miR-299-3p suppresses cell progression and induces apoptosis by downregulating PAX3 in gastric cancer
  19. Diabetes and COVID-19
  20. Discovery of novel potential KIT inhibitors for the treatment of gastrointestinal stromal tumor
  21. TEAD4 is a novel independent predictor of prognosis in LGG patients with IDH mutation
  22. circTLK1 facilitates the proliferation and metastasis of renal cell carcinoma by regulating miR-495-3p/CBL axis
  23. microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury
  24. Long noncoding RNA TUG1 regulates degradation of chondrocyte extracellular matrix via miR-320c/MMP-13 axis in osteoarthritis
  25. Duodenal adenocarcinoma with skin metastasis as initial manifestation: A case report
  26. Effects of Loofah cylindrica extract on learning and memory ability, brain tissue morphology, and immune function of aging mice
  27. Recombinant Bacteroides fragilis enterotoxin-1 (rBFT-1) promotes proliferation of colorectal cancer via CCL3-related molecular pathways
  28. Blocking circ_UBR4 suppressed proliferation, migration, and cell cycle progression of human vascular smooth muscle cells in atherosclerosis
  29. Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
  30. Downregulation of circ_0037655 impedes glioma formation and metastasis via the regulation of miR-1229-3p/ITGB8 axis
  31. Vitamin D deficiency and cardiovascular risk in type 2 diabetes population
  32. Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis
  33. Mechanisms of circular RNA circ_0066147 on pancreatic cancer progression
  34. lncRNA myocardial infarction-associated transcript (MIAT) knockdown alleviates LPS-induced chondrocytes inflammatory injury via regulating miR-488-3p/sex determining region Y-related HMG-box 11 (SOX11) axis
  35. Identification of circRNA circ-CSPP1 as a potent driver of colorectal cancer by directly targeting the miR-431/LASP1 axis
  36. Hyperhomocysteinemia exacerbates ischemia-reperfusion injury-induced acute kidney injury by mediating oxidative stress, DNA damage, JNK pathway, and apoptosis
  37. Potential prognostic markers and significant lncRNA–mRNA co-expression pairs in laryngeal squamous cell carcinoma
  38. Gamma irradiation-mediated inactivation of enveloped viruses with conservation of genome integrity: Potential application for SARS-CoV-2 inactivated vaccine development
  39. ADHFE1 is a correlative factor of patient survival in cancer
  40. The association of transcription factor Prox1 with the proliferation, migration, and invasion of lung cancer
  41. Is there a relationship between the prevalence of autoimmune thyroid disease and diabetic kidney disease?
  42. Immunoregulatory function of Dictyophora echinovolvata spore polysaccharides in immunocompromised mice induced by cyclophosphamide
  43. T cell epitopes of SARS-CoV-2 spike protein and conserved surface protein of Plasmodium malariae share sequence homology
  44. Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
  45. Long noncoding RNA HULC contributes to paclitaxel resistance in ovarian cancer via miR-137/ITGB8 axis
  46. Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
  47. Prognostic value of the neutrophil-to-lymphocyte ratio in acute organophosphorus pesticide poisoning
  48. Gastroprotective effects of diosgenin against HCl/ethanol-induced gastric mucosal injury through suppression of NF-κβ and myeloperoxidase activities
  49. Silencing of LINC00707 suppresses cell proliferation, migration, and invasion of osteosarcoma cells by modulating miR-338-3p/AHSA1 axis
  50. Successful extracorporeal membrane oxygenation resuscitation of patient with cardiogenic shock induced by phaeochromocytoma crisis mimicking hyperthyroidism: A case report
  51. Effects of miR-185-5p on replication of hepatitis C virus
  52. Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis
  53. Primary localized cutaneous nodular amyloidosis presenting as lymphatic malformation: A case report
  54. Multimodal magnetic resonance imaging analysis in the characteristics of Wilson’s disease: A case report and literature review
  55. Therapeutic potential of anticoagulant therapy in association with cytokine storm inhibition in severe cases of COVID-19: A case report
  56. Neoadjuvant immunotherapy combined with chemotherapy for locally advanced squamous cell lung carcinoma: A case report and literature review
  57. Rufinamide (RUF) suppresses inflammation and maintains the integrity of the blood–brain barrier during kainic acid-induced brain damage
  58. Inhibition of ADAM10 ameliorates doxorubicin-induced cardiac remodeling by suppressing N-cadherin cleavage
  59. Invasive ductal carcinoma and small lymphocytic lymphoma/chronic lymphocytic leukemia manifesting as a collision breast tumor: A case report and literature review
  60. Clonal diversity of the B cell receptor repertoire in patients with coronary in-stent restenosis and type 2 diabetes
  61. CTLA-4 promotes lymphoma progression through tumor stem cell enrichment and immunosuppression
  62. WDR74 promotes proliferation and metastasis in colorectal cancer cells through regulating the Wnt/β-catenin signaling pathway
  63. Down-regulation of IGHG1 enhances Protoporphyrin IX accumulation and inhibits hemin biosynthesis in colorectal cancer by suppressing the MEK-FECH axis
  64. Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
  65. Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway
  66. lncRNA NEAT1 regulates CYP1A2 and influences steroid-induced necrosis
  67. A two-microRNA signature predicts the progression of male thyroid cancer
  68. Isolation of microglia from retinas of chronic ocular hypertensive rats
  69. Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study
  70. Calcineurin Aβ gene knockdown inhibits transient outward potassium current ion channel remodeling in hypertrophic ventricular myocyte
  71. Aberrant expression of PI3K/AKT signaling is involved in apoptosis resistance of hepatocellular carcinoma
  72. Clinical significance of activated Wnt/β-catenin signaling in apoptosis inhibition of oral cancer
  73. circ_CHFR regulates ox-LDL-mediated cell proliferation, apoptosis, and EndoMT by miR-15a-5p/EGFR axis in human brain microvessel endothelial cells
  74. Resveratrol pretreatment mitigates LPS-induced acute lung injury by regulating conventional dendritic cells’ maturation and function
  75. Ubiquitin-conjugating enzyme E2T promotes tumor stem cell characteristics and migration of cervical cancer cells by regulating the GRP78/FAK pathway
  76. Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
  77. Protective effect of Lactobacillus-containing probiotics on intestinal mucosa of rats experiencing traumatic hemorrhagic shock
  78. Glucocorticoids induce osteonecrosis of the femoral head through the Hippo signaling pathway
  79. Endothelial cell-derived SSAO can increase MLC20 phosphorylation in VSMCs
  80. Downregulation of STOX1 is a novel prognostic biomarker for glioma patients
  81. miR-378a-3p regulates glioma cell chemosensitivity to cisplatin through IGF1R
  82. The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats
  83. TGF-β1-overexpressing mesenchymal stem cells reciprocally regulate Th17/Treg cells by regulating the expression of IFN-γ
  84. The influence of MTHFR genetic polymorphisms on methotrexate therapy in pediatric acute lymphoblastic leukemia
  85. Red blood cell distribution width-standard deviation but not red blood cell distribution width-coefficient of variation as a potential index for the diagnosis of iron-deficiency anemia in mid-pregnancy women
  86. Small cell neuroendocrine carcinoma expressing alpha fetoprotein in the endometrium
  87. Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers
  88. Molecular characterization and phylogenetic studies of Echinococcus granulosus and Taenia multiceps coenurus cysts in slaughtered sheep in Saudi Arabia
  89. ITGB5 mutation discovered in a Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
  90. ACTB and GAPDH appear at multiple SDS-PAGE positions, thus not suitable as reference genes for determining protein loading in techniques like Western blotting
  91. Facilitation of mouse skin-derived precursor growth and yield by optimizing plating density
  92. 3,4-Dihydroxyphenylethanol ameliorates lipopolysaccharide-induced septic cardiac injury in a murine model
  93. Downregulation of PITX2 inhibits the proliferation and migration of liver cancer cells and induces cell apoptosis
  94. Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B
  95. Novel predictor of the occurrence of DKA in T1DM patients without infection: A combination of neutrophil/lymphocyte ratio and white blood cells
  96. Investigation of molecular regulation mechanism under the pathophysiology of subarachnoid hemorrhage
  97. miR-25-3p protects renal tubular epithelial cells from apoptosis induced by renal IRI by targeting DKK3
  98. Bioengineering and Biotechnology
  99. Green fabrication of Co and Co3O4 nanoparticles and their biomedical applications: A review
  100. Agriculture
  101. Effects of inorganic and organic selenium sources on the growth performance of broilers in China: A meta-analysis
  102. Crop-livestock integration practices, knowledge, and attitudes among smallholder farmers: Hedging against climate change-induced shocks in semi-arid Zimbabwe
  103. Food Science and Nutrition
  104. Effect of food processing on the antioxidant activity of flavones from Polygonatum odoratum (Mill.) Druce
  105. Vitamin D and iodine status was associated with the risk and complication of type 2 diabetes mellitus in China
  106. Diversity of microbiota in Slovak summer ewes’ cheese “Bryndza”
  107. Comparison between voltammetric detection methods for abalone-flavoring liquid
  108. Composition of low-molecular-weight glutenin subunits in common wheat (Triticum aestivum L.) and their effects on the rheological properties of dough
  109. Application of culture, PCR, and PacBio sequencing for determination of microbial composition of milk from subclinical mastitis dairy cows of smallholder farms
  110. Investigating microplastics and potentially toxic elements contamination in canned Tuna, Salmon, and Sardine fishes from Taif markets, KSA
  111. From bench to bar side: Evaluating the red wine storage lesion
  112. Establishment of an iodine model for prevention of iodine-excess-induced thyroid dysfunction in pregnant women
  113. Plant Sciences
  114. Characterization of GMPP from Dendrobium huoshanense yielding GDP-D-mannose
  115. Comparative analysis of the SPL gene family in five Rosaceae species: Fragaria vesca, Malus domestica, Prunus persica, Rubus occidentalis, and Pyrus pyrifolia
  116. Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR
  117. Investigation of bioactivities of Taxus chinensis, Taxus cuspidata, and Taxus × media by gas chromatography-mass spectrometry
  118. Morphological structures and histochemistry of roots and shoots in Myricaria laxiflora (Tamaricaceae)
  119. Transcriptome analysis of resistance mechanism to potato wart disease
  120. In silico analysis of glycosyltransferase 2 family genes in duckweed (Spirodela polyrhiza) and its role in salt stress tolerance
  121. Comparative study on growth traits and ions regulation of zoysiagrasses under varied salinity treatments
  122. Role of MS1 homolog Ntms1 gene of tobacco infertility
  123. Biological characteristics and fungicide sensitivity of Pyricularia variabilis
  124. In silico/computational analysis of mevalonate pyrophosphate decarboxylase gene families in Campanulids
  125. Identification of novel drought-responsive miRNA regulatory network of drought stress response in common vetch (Vicia sativa)
  126. How photoautotrophy, photomixotrophy, and ventilation affect the stomata and fluorescence emission of pistachios rootstock?
  127. Apoplastic histochemical features of plant root walls that may facilitate ion uptake and retention
  128. Ecology and Environmental Sciences
  129. The impact of sewage sludge on the fungal communities in the rhizosphere and roots of barley and on barley yield
  130. Domestication of wild animals may provide a springboard for rapid variation of coronavirus
  131. Response of benthic invertebrate assemblages to seasonal and habitat condition in the Wewe River, Ashanti region (Ghana)
  132. Molecular record for the first authentication of Isaria cicadae from Vietnam
  133. Twig biomass allocation of Betula platyphylla in different habitats in Wudalianchi Volcano, northeast China
  134. Animal Sciences
  135. Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens
  136. Predators of the giant pine scale, Marchalina hellenica (Gennadius 1883; Hemiptera: Marchalinidae), out of its natural range in Turkey
  137. Honey in wound healing: An updated review
  138. NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block
  139. Radiotherapy for the treatment of pulmonary hydatidosis in sheep
  140. Retraction
  141. Retraction of “Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating microRNA-34a-5p/NOTCH1 signaling pathway”
  142. Special Issue on Reuse of Agro-Industrial By-Products
  143. An effect of positional isomerism of benzoic acid derivatives on antibacterial activity against Escherichia coli
  144. Special Issue on Computing and Artificial Techniques for Life Science Applications - Part II
  145. Relationship of Gensini score with retinal vessel diameter and arteriovenous ratio in senile CHD
  146. Effects of different enantiomers of amlodipine on lipid profiles and vasomotor factors in atherosclerotic rabbits
  147. Establishment of the New Zealand white rabbit animal model of fatty keratopathy associated with corneal neovascularization
  148. lncRNA MALAT1/miR-143 axis is a potential biomarker for in-stent restenosis and is involved in the multiplication of vascular smooth muscle cells
Downloaded on 11.1.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2021-0057/html
Scroll to top button