Home Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
Article Open Access

Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis

  • Shan Li , Lihai Zhang , Shuhua Li , Hengyi Zhao and Yonggang Chen EMAIL logo
Published/Copyright: September 6, 2021

Abstract

Curcumin has been demonstrated to be an anti-tumor agent in many types of cancers, including gastric cancer (GC). However, the molecular mechanisms by which curcumin performs its anti-tumor effects remain elusive. circ_0056618 and miR-194-5p are reported to be involved in GC progression, but their relationships with curcumin are unclear. In this study, circ_0056618 was elevated, and miR-194-5p was reduced in GC tissues and cells. Curcumin treatment led to a decrease in circ_0056618 level in GC cells. Overexpression of circ_0056618 promoted cell proliferation, migration, and invasion and suppressed cell cycle arrest and apoptosis in curcumin-treated GC cells. Moreover, miR-194-5p was identified as the target of circ_0056618, and its expression in GC cells increased after curcumin treatment. Overexpression of miR-194-5p reversed the promotional effect of circ_0056618 on cell progression in curcumin-treated GC cells. Additionally, curcumin treatment repressed the tumorigenesis of GC in vivo through regulating circ_0056618. Curcumin treatment delayed the development of GC partly through decreasing circ_0056618 and increasing miR-194-5p.

1 Introduction

As a cancer with high incidence worldwide, gastric cancer (GC) severely affects the quality of people’s life [1,2]. Presently, the primary therapeutic strategies for GC include surgery, chemotherapy, and targeted therapy [3]. Unfortunately, although diagnosis and therapy methods have been improved, the prognosis remains poor due to cancer relapse and metastasis [4,5]. Thus, there is an urgent need to search for novel treatment methods for this lethal disease.

Curcumin is a natural polyphenolic compound isolated from turmeric, which has lipid-lowering, anti-tumor, anti-inflammation, and anti-oxidation effects [6,7]. Recently, studies have shown that curcumin can reduce the malignancy of several cancers, such as pancreatic cancer [8], retinoblastoma [9], osteosarcoma [10], and bladder cancer [11]. Moreover, curcumin has also been reported to have an anti-tumor effect on GC [12,13]. Nonetheless, the role and underlying mechanism of curcumin in GC have not been well recognized.

circular RNAs (circRNAs) are a family of non-coding RNAs (ncRNAs) that possess closed-loop structures and play a vital role in gene expression via competitive targeting microRNAs (miRNAs) [14]. circRNAs have been verified to play essential roles in the carcinogenesis of GC. For example, circ_104916 could hamper the viability and metastasis of GC cells [15]. Furthermore, circDLST contributed to the metastasis and tumorigenesis of GC by interacting with miR-502-5p [16]. As for circ_0056618, Li et al. uncovered that circ_0056618 could accelerate the malignancy of GC by reducing miR-206 [17]. However, the relationship between circ_0056618 and curcumin is barely known.

miRNAs are short ncRNAs with ∼22 nucleotides and function as important modulators in various types of cancers, including GC [18,19]. It has been reported that miR-194-5p is downregulated in GC, and miR-194-5p overexpression plays a tumor-suppressive role in GC [20,21]. Furthermore, emerging evidence has reported that miRNAs are associated with the anti-tumor properties of curcumin in GC. For example, Sun et al. declared that curcumin repressed the progression of GC by elevating miR-34a [22]. Qiang et al. suggested that curcumin treatment induces GC cell apoptosis and hampers proliferation by modulation of miR-21 [23]. However, whether miR-194-5p is implicated in the anti-tumor effect of curcumin on GC remains unclear.

In this research, we explored the function of curcumin in circ_0056618 and miR-194-5p expression in GC and then elucidated the underlying mechanisms governing the tumor-inhibitory role of curcumin in GC.

2 Materials and methods

2.1 Sample acquisition

Seventy-one GC tissues and adjacent non-tumor tissues were taken from Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University, and preserved at −80°C prior to use. The patients enrolled in our study did not have other malignant tumors, severe infection, and cognitive impairment history. None of the patients had received any chemotherapy or radiotherapy before this study. The demographic data of 71 patients with GC are shown in Table 1.

Table 1

Clinicopathologic features of GC patients

Clinicopathologic features n
Gender
  Male 42
  Female 29
Age (years)
  ≥60 38
  <60 33
Tumor size (cm)
  ≥3 43
  <3 28
TNM stage
  I–II 21
  III–IV 50
Differentiation grade
  Well/moderately 25
  Poorly 46
Lymph node metastasis
  Yes 40
  No 31
  1. Informed consent: Informed consent was obtained from all the individuals included in this study.

  2. Ethical approval: The research related to human use has complied with all relevant national regulations, institutional policies and is in accordance with the tenets of the Helsinki Declaration, and has been approved by the Ethics Committee of Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University.

2.2 Cell culture and curcumin treatment

Normal human gastric epithelial cells (GES-1) and GC cells (HGC-27 and MKN-45) were obtained from Procell (Wuhan, China) and kept in RPMI 1640 medium (Procell) added with 10% fetal bovine serum (FBS; Procell) and 1% penicillin–streptomycin (Procell) at 37°C in a humid incubator containing 5% CO2.

Curcumin (Sigma-Aldrich, St. Louis, MO, USA) was dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich) at a dose of 50 mM to make stock solution. The stock solution was diluted in the culture medium at a dose of 30 µM. For curcumin treatment, GC cells were subjected to 30 µM curcumin (Sigma-Aldrich) for 24 h in the presence of FBS (Procell). The control groups were subjected to DMSO (Sigma-Aldrich) [23].

2.3 Cell transfection

The overexpression vector of circ_0056618 (circ_0056618) and its control (vector), small interfering RNA against circ_0056618 (si-circRNA) and its control (si-NC), and miR-194-5p mimics (miR-194-5p) and its control (miR-NC) were synthesized by GeneCopoeia (Guangzhou, China). HGC-27 and MKN-45 cells were plated into 6-well plates at a density of 1.0 × 104 cells per well and then transfected with the synthetic oligonucleotides (50 nM) or vectors (2 μg) by Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturers’ instructions.

2.4 Quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay

The RNA in tissues and cells was extracted using TRIzol reagent (Invitrogen) and digested with DNAse I for 1 h at 37°C to eliminate genomic DNA. The RNAs were then quantified utilizing NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Then High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA) or TaqMan microRNA Assay kit (Applied Biosystems) was used to reversely transcribe RNAs into cDNAs according to the manufacturers’ instructions. Next, the qRT-PCR was manipulated with SYBR Premix Ex Taq II (Takara, Dalian, China) and specific primers on the StepOnePlus Real-Time PCR System (Applied Biosystems). The primers are presented in Table 2. The expression was calculated using the 2−ΔΔCt method [24]. GAPDH and U6 were used as internal references.

Table 2

Primer sequences used for qRT-PCR

Primers Sequences (5′–3′) Tm PCR product Ct range
circ_0056618-forward AAGTGGTGATGTCTCGGGAAC 60 209 0.8
circ_0056618-reverse TTCCCTATCTCCCGCTCCTA 58.8
miR-194-5p-forward GCGGCGGTGTAACAGCAACTCC 63.64 98 1.7
miR-194-5p-reverse ATCCAGTGCAGGGTCCGAGG 63.79
GAPDH-forward AAGGTGAAGGTCGGAGTCA 57.86 172 0.8
GAPDH-reverse GGAAGATGGTGATGGGATTT 55.05
U6-forward CGCTTCGGCACATATACTA 54.61 87 1.3
U6-reverse CGCTTCACGAATTTGCGTGTCA 62.78

2.5 Colony formation assay

GC cells (200 cells/well) were plated into 6-well plates. After adherence and curcumin exposure, the cells were cultivated in normal medium for about 2 weeks. The medium was changed every 3 days. Next, the colonies were fixed in 4% paraformaldehyde (Sangon, Shanghai, China) and dyed with 1% crystal violet (Sangon). The colonies containing >50 cells were counted. This experiment was conducted as previously described [9].

2.6 Flow cytometry analysis

For cell cycle analysis, GC cells (1 × 104 cells/well) were sown into 6-well plates. On the next day, the cells were subjected to 30 µM curcumin (Sigma-Aldrich) for 24 h. Next, the cells were harvested and fixed overnight with 70% ethanol. After that, the fixed cells were washed with PBS (Solarbio, Beijing, China) and resuspended in binding buffer at a concentration of 1.0 × 106 cells/mL followed by incubation with propidium iodide (PI; Beyotime, Shanghai, China) for 30 min at 37°C according to manufacturers’ instructions. Finally, the stained cells were analyzed with a FACScan® flow cytometer (Beckman Coulter, Atlanta, GA, USA). For cell apoptosis, the cells (1 × 104 cells/well) were plated into 6-well plates and then administered with 30 µM curcumin (Sigma-Aldrich) for 24 h. After that, the cells were collected, washed, resuspended, and then mixed with 5 μL of Annexin V-fluorescein isothiocyanate (Annexin V-FITC; Beyotime) and 5 μL of PI (Beyotime) for 20 min in the dark according to manufacturers’ instructions. The apoptotic cells were estimated using a FACScan® flow cytometer (Beckman Coulter).

2.7 Wound healing assay

GC cells were sowed into 6-well plates (2 × 103 cells/well) and grown until 100% confluence. Then the cells were scratched utilizing a pipette tip and washed with PBS (Solarbio) to remove the detached cells followed by treatment with curcumin for 24 h (Sigma-Aldrich). The scratched areas were photographed at 0 and 48 h at a magnification of 40× and the wound closure was recorded to assess cell migration capacity. The experiment was conducted as previously reported [25].

2.8 Transwell assay

The 24-well transwell inserts (Corning Incorporated, Corning, NY, USA) coated with or without Matrigel (Solarbio) were adopted to evaluate cell invasion and migration, respectively. Briefly, after indicated transfection and treatment, HGC-27 and MKN-45 cells (2 × 104 cells/well) were suspended into serum-free medium and then added into the top compartment of chambers. The bottom compartment of chambers was filled with 500 μL of culture medium to act as a chemoattractive. After 24 h, the transferred cells were dyed with 1% crystal violet (Sangon) and determined under an inverted microscope (Olympus, Tokyo, Japan) at a magnification of 100×.

2.9 Dual-luciferase reporter assay

The sequences of wild-type (WT) circ_0056618 containing the putative miR-194-5p binding sites were cloned into pmirGLO plasmid (Promega, Fitchburg, WI, USA) to establish the luciferase reporter vector circ_0056618 WT. Similarly, the sequences of mutant (MUT) circ_0056618 lacking the miR-194-5p-binding sites were inserted into pmirGLO plasmid (Promega) to generate circ_0056618 MUT. GC cells were seeded into 6-well plates (5 × 104 cells/well) and then co-transfected with circ_0056618 WT or circ_0056618 MUT (100 ng) and miR-194-5p or miR-NC(50 nM). After 48 h, the Renilla and firefly luciferase activities were measured with a Dual-Luciferase Reporter Assay System (Promega).

2.10 RNA pull-down assay

RNA pull-down assay was executed utilizing the Pierce Magnetic RNA-Protein Pull-Down Kit (Thermo Fisher Scientific). In brief, biotin-labeled wild-type miR-194-5p (Bio-miR-194-5p-WT), mutant miR-194-5p (Bio-miR-194-5p-MUT), or Bio-miR-NC was transfected into GC cells (1 × 104 cells/well) and cultivated for 24 h. Afterward, the cells were collected, lysed, and incubated with streptavidin-coated magnetic beads. Biotin-coupled RNA complexes were pulled down, bound RNAs were extracted, and then the enrichment of circ_0056618 was estimated by qRT-PCR analysis.

2.11 Western blot assay

Total protein in GC cells was extracted utilizing RIPA buffer (Beyotime) and determined utilizing a BCA protein assay kit (Tiangen, Beijing, China). Then the equal amount of protein (30 μg) was separated by sodium dodecyl sulfonate–polyacrylamide gel (Solarbio) and blotted onto polyvinylidenedifluoride membranes (Amersham Biosciences, Chicago, IL, USA). After blocking in 5% defatted milk for 1 h, the membranes were cultivated overnight with primary antibodies against CyclinD1 (1:2,000; bs-0623R; Bioss, Beijing, China), E-cadherin (1:2,000; bs-10009R; Bioss), N-cadherin (1:2,000; bs-1172R; Bioss), or GAPDH (1:5,000; bs-2188R; Bioss) at 4°C followed by interaction with HRP-conjugated secondary antibody (1:5,000; bs-0295M-HRP; Bioss) for 1.5 h at room temperature. The protein bands were visualized with an ECL reagent (Vazyme, Nanjing, China) and analyzed via ImageJ v1.8.0 (National Institutes of Health).

2.12 Murine xenograft model

The BALB/c nude mice (4–6 weeks old) were obtained from Vital River Laboratory (Beijing, China) and divided into four groups (n = 6/group). For control and curcumin groups, 2 × 106 MKN-45 cells suspended in PBS (Solarbio) were subcutaneously implanted into the flank of the nude mice, and DMSO (Sigma-Aldrich) or 30 µM curcumin (Sigma-Aldrich) was intraperitoneally administered into the mice every 7 days. For curcumin + vector and curcumin + circ_0056618 groups, circ_0056618 or vector transfected MKN-45 cells were implanted into the nude mice and then 30 µM curcumin (Sigma-Aldrich) was intraperitoneally administered into the mice every 7 days. Tumor volume was examined every 7 days and computed via the equation: (length × width2)/2. The mice were euthanized after 28 days through cervical dislocation and the neoplasms were weighted and preserved for qRT-PCR assay.

  1. Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals and was approved by the Ethics Committee of Animal Research of Qilu Hospital (Qingdao), Cheeloo College of Medicine, Shandong University.

2.13 Statistical analysis

Each experiment was conducted in triplicate. The data were analyzed with GraphPad Prism 7 and exhibited as mean ± standard deviation. The differences in two groups and three groups were estimated using Student’s t-test and one-way analysis of variance followed by Tukey’s test, respectively. Pearson’s correlation coefficient analysis estimated the linear correlation between circ_0056618 and miR-194-5p in GC tissues after Agostino–Pearson, Kolmogorov–Smirnov, and Shapiro–Wilk methods were used for the analysis of normality distribution of the data. Differences were considered as significant where P-value < 0.05 is represented as * and P-value < 0.01 is represented as **.

3 Results

3.1 circ_0056618 was upregulated and miR-194-5p was downregulated in GC tissues

Initially, qRT-PCR assay was conducted to test the expression levels of circ_0056618 and miR-194-5p in GC tissues and adjacent non-tumor tissues. The results showed that circ_0056618 was highly expressed and miR-194-5p was lowly expressed in GC tissues compared to non-tumor tissues (Figure 1a and b). Pearson’s correlation coefficient analysis estimated that miR-194-5p level was negatively correlated with circ_0056618 level in GC tissues (Figure 1c). These results indicated that circ_0056618 and miR-194-5p might be related to GC progression.

Figure 1 
                  High expression of circ_0056618 and low expression of miR-194-5p in GC tissues. (a and b) qRT-PCR analysis was conducted for circ_0056618 and miR-194-5p expression levels in GC tissues and adjacent normal tissues. (c) The correlation between the levels of circ_0056618 and miR-194-5p in GC tissues was analyzed by Pearson’s correlation coefficient analysis. **P < 0.01.
Figure 1

High expression of circ_0056618 and low expression of miR-194-5p in GC tissues. (a and b) qRT-PCR analysis was conducted for circ_0056618 and miR-194-5p expression levels in GC tissues and adjacent normal tissues. (c) The correlation between the levels of circ_0056618 and miR-194-5p in GC tissues was analyzed by Pearson’s correlation coefficient analysis. **P < 0.01.

3.2 circ_0056618 overexpression ameliorated the effects of curcumin treatment on GC cell colony formation, cell cycle process, and apoptosis

As shown in Figure 2a, circ_0056618 level was elevated in GC cell lines (HGC-27 and MKN-45) compared to that in GES-1 cell line. Then HGC-27 and MKN-45 cells were subjected to 30 µM curcumin for 24 h followed by qRT-PCR assay for circ_0056618 expression level. As a result, curcumin treatment led to an inhibition in circ_0056618 level in HGC-27 and MKN-45 cells compared to control groups, but curcumin did not affect the expression of circ_0056618 in GES-1 cells (Figure 2b). Next, the transfection of circ_0056618 increased the level of circ_0056618 in HGC-27 and MKN-45 cells, suggesting the successful transfection of circ_0056618 (Figure 2c). To explore the association between curcumin and circ_0056618 in the regulation of GC progression, HGC-27 and MKN-45 cells were treated with control, curcumin, curcumin + vector, or curcumin + circ_0056618. As shown in Figure 2d, curcumin-mediated downregulation on circ_0056618 expression was reversed by circ_0056618 overexpression vector transfection. The results of colony formation assay indicated that the colony formation ability of HGC-27 and MKN-45 cells was suppressed following curcumin exposure, while circ_0056618 overexpression overturned the effect (Figure 2e–g). Flow cytometry analysis showed that the proportion of HGC-27 and MKN-45 cells was increased in the G0/G1 phase and reduced in the S phase after curcumin treatment, whereas the impacts were reversed by elevating circ_0056618 (Figure 2h–k). In addition, flow cytometry analysis also exhibited that curcumin treatment facilitated the apoptosis of HGC-27 and MKN-45 cells, while circ_0056618 overexpression abated this effect (Figure 2l). Collectively, circ_0056618 overexpression weakened the effects of curcumin on the malignant behaviors of GC cells.

Figure 2 
                  Curcumin relieved the malignant cell phenotypes of GC cells by downregulating circ_0056618. (a) qRT-PCR assay was conducted for circ_0056618 level in GES-1, HGC-27, and MKN-45 cells. (b) The expression level of circ_0056618 in curcumin-treated GES-1, HGC-27, and MKN-45 cells was determined by qRT-PCR assay. (c) The expression of circ_0056618 in HGC-27 and MKN-45 cells transfected with circ_0056618 or vector was examined by qRT-PCR assay. (d–l) HGC-27 and MKN-45 cells were assigned to four groups: control, curcumin, curcumin + vector, and curcumin + circ_0056618. (d) The expression of circ_0056618 in HGC-27 and MKN-45 cells was detected by qRT-PCR assay. (f–g) The colony formation ability of HGC-27 and MKN-45 cells was examined by colony formation assay. (h–l) The cell cycle process and apoptosis of HGC-27 and MKN-45 cells were analyzed through flow cytometry analysis. **P < 0.01, *P < 0.05.
Figure 2

Curcumin relieved the malignant cell phenotypes of GC cells by downregulating circ_0056618. (a) qRT-PCR assay was conducted for circ_0056618 level in GES-1, HGC-27, and MKN-45 cells. (b) The expression level of circ_0056618 in curcumin-treated GES-1, HGC-27, and MKN-45 cells was determined by qRT-PCR assay. (c) The expression of circ_0056618 in HGC-27 and MKN-45 cells transfected with circ_0056618 or vector was examined by qRT-PCR assay. (d–l) HGC-27 and MKN-45 cells were assigned to four groups: control, curcumin, curcumin + vector, and curcumin + circ_0056618. (d) The expression of circ_0056618 in HGC-27 and MKN-45 cells was detected by qRT-PCR assay. (f–g) The colony formation ability of HGC-27 and MKN-45 cells was examined by colony formation assay. (h–l) The cell cycle process and apoptosis of HGC-27 and MKN-45 cells were analyzed through flow cytometry analysis. **P < 0.01, *P < 0.05.

3.3 Overexpression of circ_0056618 reversed the inhibitory effects of curcumin on GC cell migration and invasion

To investigate whether curcumin affected the migration and invasion of GC cells through regulating circ_0056618, wound healing assay and transwell assay were carried out. Wound healing assay exhibited that curcumin treatment suppressed the ability of wound closure, indicating that the migration ability of HGC-27 and MKN-45 cells was suppressed, which was rescued by increasing circ_0056618 (Figure 3a and b). Moreover, transwell assay showed that the migration and invasion capacities of HGC-27 and MKN-45 cells were repressed by curcumin exposure, while circ_0056618 overexpression abrogated the effects (Figure 3c–e). Taken together, curcumin restrained GC cell migration and invasion by modulation of circ_0056618.

Figure 3 
                  circ_0056618 overexpression reversed the effects of curcumin on cell migration and invasion in GC cells. HGC-27 and MKN-45 cells were assigned to four groups: control, curcumin, curcumin + vector, and curcumin + circ_0056618. (a and b) The migration of HGC-27 and MKN-45 cells was evaluated by wound healing assay. (c–e) The migration and invasion of HGC-27 and MKN-45 cells were assessed via transwell assay. **P < 0.01.
Figure 3

circ_0056618 overexpression reversed the effects of curcumin on cell migration and invasion in GC cells. HGC-27 and MKN-45 cells were assigned to four groups: control, curcumin, curcumin + vector, and curcumin + circ_0056618. (a and b) The migration of HGC-27 and MKN-45 cells was evaluated by wound healing assay. (c–e) The migration and invasion of HGC-27 and MKN-45 cells were assessed via transwell assay. **P < 0.01.

3.4 circ_0056618 functioned as a sponge of miR-194-5p

Through analyzing online tool Circinteractome (https://circinteractome.nia.nih.gov), we found that miR-194-5p contained the potential binding sites of circ_0056618, indicating that miR-194-5p might be a target of circ_0056618 (Figure 4a). As exhibited in Figure 4b, miR-194-5p transfection increased the level of miR-194-5p in HGC-27 and MKN-45 cells compared to miR-NC control groups. Then dual-luciferase reporter assay and RNA pull-down assay were performed to verify the interaction between circ_0056618 and miR-194-5p. Dual-luciferase reporter assay presented that miR-194-5p transfection inhibited the luciferase activity of circ_0056618 WT, but had no effect on the luciferase activity of circ_0056618 MUT in both HGC-27 and MKN-45 cells (Figure 4c and d). RNA pull-down assay indicated that circ_0056618 could be abundantly enriched by Bio-miR-194-5p-WT probe in both HGC-27 and MKN-45 cells compared to Bio-miR-NC or Bio-miR-194-5p-MUT groups (Figure 4e and f). As expected, there was a lower expression of miR-194-5p in HGC-27 and MKN-45 cells than in GES-1 cells (Figure 4g). Moreover, we found that si-circRNA transfection led to a decrease in circ_0056618 expression and an increase in miR-194-5p expression in both HGC-27 and MKN-45 cells in comparison with control groups (Figure 4h and i). Additionally, our results exhibited that curcumin treatment increased miR-194-5p level in HGC-27 and MKN-45 cells, whereas circ_0056618 overexpression restored this effect (Figure 4j and k). All these results suggested that circ_0056618 directly interacted with miR-194-5p to negatively regulate miR-194-5p expression in GC cells.

Figure 4 
                  miR-194-5p was a target of circ_0056618. (a) The potential binding sites between miR-194-5p and circ_0056618 are shown. (b) The expression level of miR-194-5p in HGC-27 and MKN-45 cells transfected with miR-NC or miR-194-5p was determined by qRT-PCR assay. (c and d) The luciferase activity in miR-194-5p/miR-NC and circ_0056618 WT/circ_0056618 MUT co-transfected HGC-27 and MKN-45 cells was measured by dual-luciferase reporter assay. (e and f) After RNA pull-down assay, the enrichment of circ_0056618 in HGC-27 and MKN-45 cell lysates was determined by qRT-PCR assay. (g) qRT-PCR assay was conducted for miR-194-5p expression in GES-1, HGC-27, and MKN-45 cells. (h and i) The expression levels of circ_0056618 and miR-194-5p in HGC-27 and MKN-45 cells transfected with si-NC or si-circRNA were examined through qRT-PCR assay. (j and k) After HGC-27 and MKN-45 cells were treated with control, curcumin, curcumin + vector, or curcumin + circ_0056618, the expression level of miR-194-5p was detected through qRT-PCR assay. **P < 0.01.
Figure 4

miR-194-5p was a target of circ_0056618. (a) The potential binding sites between miR-194-5p and circ_0056618 are shown. (b) The expression level of miR-194-5p in HGC-27 and MKN-45 cells transfected with miR-NC or miR-194-5p was determined by qRT-PCR assay. (c and d) The luciferase activity in miR-194-5p/miR-NC and circ_0056618 WT/circ_0056618 MUT co-transfected HGC-27 and MKN-45 cells was measured by dual-luciferase reporter assay. (e and f) After RNA pull-down assay, the enrichment of circ_0056618 in HGC-27 and MKN-45 cell lysates was determined by qRT-PCR assay. (g) qRT-PCR assay was conducted for miR-194-5p expression in GES-1, HGC-27, and MKN-45 cells. (h and i) The expression levels of circ_0056618 and miR-194-5p in HGC-27 and MKN-45 cells transfected with si-NC or si-circRNA were examined through qRT-PCR assay. (j and k) After HGC-27 and MKN-45 cells were treated with control, curcumin, curcumin + vector, or curcumin + circ_0056618, the expression level of miR-194-5p was detected through qRT-PCR assay. **P < 0.01.

3.5 miR-194-5p overexpression reversed the promotional effects of circ_0056618 on the malignant behaviors of curcumin-treated GC cells

To further explore whether curcumin could decelerate the progression of GC cells through circ_0056618/miR-194-5p axis, HGC-27 and MKN-45 cells were treated with vector + miR-NC, curcumin + vector + miR-NC, curcumin + circ_0056618 + miR-NC, or curcumin + circ_0056618 + miR-194-5p. As demonstrated by colony formation, the promotional effect of circ_0056618 on cell viability could be reversed by increasing miR-194-5p in curcumin-treated HGC-27 and MKN-45 cells in comparison with control groups (Figure 5a and b). Flow cytometry analysis indicated that the promotional role in cell cycle process and the suppressive role in cell apoptosis in curcumin-treated HGC-27 and MKN-45 cells mediated by circ_0056618 overexpression were all abolished by the elevation of miR-194-5p (Figure 5c–f). In addition, the results of wound healing assay and transwell assay demonstrated that the promotional effects of circ_0056618 on cell migration and invasion in curcumin-treated HGC-27 and MKN-45 cells were rescued by elevating miR-194-5p (Figure 5g–l). To sum up, circ_0056618 could promote cell progression in curcumin-treated GC cells by targeting miR-194-5p.

Figure 5 
                  Curcumin relieved the malignant behaviors of GC cells by regulating circ_0056618/miR-194-5p axis. HGC-27 and MKN-45 cells were administered with vector + miR-NC, curcumin + vector + miR-NC, curcumin + circ_0056618 + miR-NC, or curcumin + circ_0056618 + miR-194-5p. (a and b) The colony formation of HGC-27 and MKN-45 cells was assessed by colony formation assay. (c–f) Flow cytometry analysis was conducted for cell cycle process and apoptosis. (g–l) The migration and invasion abilities of HGC-27 and MKN-45 cells were evaluated by wound healing assay and transwell assay. **P < 0.01.
Figure 5

Curcumin relieved the malignant behaviors of GC cells by regulating circ_0056618/miR-194-5p axis. HGC-27 and MKN-45 cells were administered with vector + miR-NC, curcumin + vector + miR-NC, curcumin + circ_0056618 + miR-NC, or curcumin + circ_0056618 + miR-194-5p. (a and b) The colony formation of HGC-27 and MKN-45 cells was assessed by colony formation assay. (c–f) Flow cytometry analysis was conducted for cell cycle process and apoptosis. (g–l) The migration and invasion abilities of HGC-27 and MKN-45 cells were evaluated by wound healing assay and transwell assay. **P < 0.01.

3.6 Effects of curcumin on the levels of CyclinD1, E-cadherin, and N-cadherin in GC cells

Subsequently, we determined the effects of curcumin on the expression levels of CyclinD1 and EMT-associated markers (E-cadherin and N-cadherin) in HGC-27 and MKN-45 cells by western blot assay. Our results showed that curcumin treatment reduced the protein levels of CyclinD1 and N-cadherin and enhanced the protein level of E-cadherin in HGC-27 and MKN-45 cells, while circ_0056618 overexpression abrogated the impacts; moreover, the elevation of miR-194-5p further overturned the effects of circ_0056618 overexpression on CyclinD1, E-cadherin, and N-cadherin levels (Figure 6a and b). These findings indicated that curcumin could modulate the expression of CyclinD1, E-cadherin, and N-cadherin in GC cells through circ_0056618/miR-194-5p axis.

Figure 6 
                  Curcumin altered the expression of CyclinD1, E-cadherin, and N-cadherin in GC cells by modulation of circ_0056618/miR-194-5p axis. (a and b) After HGC-27 and MKN-45 cells were treated with control, curcumin, curcumin + vector, curcumin + circ_0056618, curcumin + circ_0056618 + miR-NC, or curcumin + circ_0056618 + miR-194-5p, the protein levels of CyclinD1, E-cadherin, and N-cadherin were measured by western blot assay. **P < 0.01.
Figure 6

Curcumin altered the expression of CyclinD1, E-cadherin, and N-cadherin in GC cells by modulation of circ_0056618/miR-194-5p axis. (a and b) After HGC-27 and MKN-45 cells were treated with control, curcumin, curcumin + vector, curcumin + circ_0056618, curcumin + circ_0056618 + miR-NC, or curcumin + circ_0056618 + miR-194-5p, the protein levels of CyclinD1, E-cadherin, and N-cadherin were measured by western blot assay. **P < 0.01.

3.7 Curcumin blocked the tumorigenesis of GC in vivo by regulating circ_0056618

At last, the function of curcumin in GC growth in vivo was determined through constructing the murine xenograft model. As shown in Figure 7a and b, tumor size and weight were restrained in curcumin groups compared to control groups, and tumor size and weight were increased in curcumin + circ_0056618 groups compared to curcumin + vector groups. Moreover, we found that circ_0056618 level was decreased and miR-194-5p level was increased in the tumor tissues collected from curcumin groups, while the effects were rescued in curcumin + circ_0056618 groups (Figure 7c and d). These results suggested that curcumin hampered tumor growth of GC in vivo by regulating circ_0056618.

Figure 7 
                  Curcumin hampered tumor growth in vivo. (a) Tumor volume was examined every 7 days. (b) Tumor weight was examined on day 28. (c and d) The expression levels of circ_0056618 and miR-194-5p in the collected tumor tissues were measured by qRT-PCR assay. **P < 0.01.
Figure 7

Curcumin hampered tumor growth in vivo. (a) Tumor volume was examined every 7 days. (b) Tumor weight was examined on day 28. (c and d) The expression levels of circ_0056618 and miR-194-5p in the collected tumor tissues were measured by qRT-PCR assay. **P < 0.01.

4 Discussion

A growing body of evidence has demonstrated that curcumin restrains the malignant biological behaviors of GC cells through different pathways [2628]. Herein, we discovered that curcumin was able to inhibit GC cell growth and motility and induce apoptosis by suppressing circ_0056618 and elevating miR-194-5p.

Previous research have verified that curcumin exerts the anti-tumor effect mainly by repressing tumor cell proliferation and motility and facilitating apoptosis. For example, curcumin treatment restrained Rb cell proliferation, invasion, and migration and accelerated apoptosis [9]. Curcumin suppressed the growth and cell cycle process and facilitated the apoptosis of GC cells [22]. In line with these reports, we demonstrated that curcumin treatment restrained cell colony formation, migration, and invasion and accelerated cell cycle arrest and apoptosis in GC cells in vitro and blocked tumorigenesis of GC in vivo, indicating that curcumin might be a candidate agent for GC therapy.

Zheng et al. suggested that circ_0056618 level was enhanced in colorectal cancer (CRC) and promoted CRC cell growth, angiogenesis, and migration by reducing miR-206 and elevating CXCR4 and VEGF-A [29]. Li et al. unraveled that circ_0056618 was elevated in GC and facilitated cell proliferation and motility in GC [17]. In this study, we also observed that there was an increase in circ_0056618 level in GC tissues and cells. Moreover, we found that curcumin treatment predominantly decreased the expression of circ_0056618 in GC cells. Thus, we further explored whether circ_0056618 could participate in regulating curcumin-mediated malignant phenotypes of GC cells. As a result, overexpression of circ_0056618 ameliorated curcumin-mediated anti-proliferation, anti-metastasis, and pro-apoptosis effects on GC cells, suggesting that curcumin could decelerate GC development by reducing circ_0056618 expression.

Subsequently, the underlying mechanism of how curcumin regulates GC progression was further investigated. miR-194-5p has been demonstrated to be the target of several circRNAs, such as circ_0023028 [30], circ-USP1 [31], and circ_0001971 [32]. Through bioinformatics analysis, dual-luciferase reporter assay and RNA pull-down assay, miR-194-5p was verified to be the target of circ_0056618 for the first time. Our results showed that miR-194-5p was weakly expressed in GC tissues and cells, and circ_0056618 could negatively regulate miR-194-5p expression in GC cells and curcumin-treated GC cells. Previous studies showed that miR-194-5p had the capacity to repress GC cell growth and metastasis [33,34]. In this study, our results exhibited that the elevation of miR-194-5p effectively reversed the impacts of circ_0056618 on cell growth, apoptosis, and metastasis in curcumin-treated GC cells, indicating that circ_0056618 promoted curcumin-mediated GC development by interacting with miR-194-5p.

In summary, curcumin treatment could repress GC cell growth and metastasis and promote apoptosis partly by regulation of circ_0056618/miR-194-5p axis. The findings facilitated our understanding on the mechanism of curcumin in GC therapy and indicated that curcumin might be a potential therapeutic drug for GC. In addition, accumulating evidence showed that curcumin might prevent GC through regulation of oncogenic pathways [35]. However, the underlying mechanisms still need further investigation.


Co-author.


  1. Funding information: The authors state no funding involved.

  2. Conflict of interest: The authors state no conflict of interest.

  3. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Lordick F, Janjigian YY. Clinical impact of tumour biology in the management of gastroesophageal cancer. Nat Rev Clin Oncol. 2016;13(6):348–60.10.1038/nrclinonc.2016.15Search in Google Scholar

[2] de Martel C, Forman D, Plummer M. Gastric cancer: epidemiology and risk factors. Gastroenterol Clin North Am. 2013;42(2):219–40.10.1016/j.gtc.2013.01.003Search in Google Scholar

[3] Kanda M, Kodera Y. Recent advances in the molecular diagnostics of gastric cancer. World J Gastroenterol. 2015;21(34):9838–52.10.3748/wjg.v21.i34.9838Search in Google Scholar

[4] Shen L, Shan YS, Hu HM, Price TJ, Sirohi B, Yeh KH, et al. Management of gastric cancer in Asia: resource-stratified guidelines. Lancet Oncol. 2013;14(12):e535–47.10.1016/S1470-2045(13)70436-4Search in Google Scholar

[5] Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics, 2009. CA Cancer J Clin. 2009;59(4):225–49.10.3322/caac.20006Search in Google Scholar PubMed

[6] Shanmugam MK, Rane G, Kanchi MM, Arfuso F, Chinnathambi A, Zayed ME, et al. The multifaceted role of curcumin in cancer prevention and treatment. Molecules. 2015;20(2):2728–69.10.3390/molecules20022728Search in Google Scholar PubMed PubMed Central

[7] Lopez-Lazaro M. Anticancer and carcinogenic properties of curcumin: considerations for its clinical development as a cancer chemopreventive and chemotherapeutic agent. Mol Nutr Food Res. 2008;52(Suppl 1):S103–27.10.1002/mnfr.200700238Search in Google Scholar PubMed

[8] Wang Q, Qu C, Xie F, Chen L, Liu L, Liang X, et al. Curcumin suppresses epithelial-to-mesenchymal transition and metastasis of pancreatic cancer cells by inhibiting cancer-associated fibroblasts. Am J Cancer Res. 2017;7(1):125–33.10.1158/1538-7445.AM2017-LB-125Search in Google Scholar

[9] Li Y, Sun W, Han N, Zou Y, Yin D. Curcumin inhibits proliferation, migration, invasion and promotes apoptosis of retinoblastoma cell lines through modulation of miR-99a and JAK/STAT pathway. BMC Cancer. 2018;18(1):1230.10.1186/s12885-018-5130-ySearch in Google Scholar PubMed PubMed Central

[10] Sun Y, Liu L, Wang Y, He A, Hu H, Zhang J, et al. Curcumin inhibits the proliferation and invasion of MG-63 cells through inactivation of the p-JAK2/p-STAT3 pathway. Onco Targets Ther. 2019;12:2011–21.10.2147/OTT.S172909Search in Google Scholar PubMed PubMed Central

[11] Wang K, Tan SL, Lu Q, Xu R, Cao J, Wu SQ, et al. Curcumin suppresses microRNA-7641-mediated regulation of p16 expression in bladder cancer. Am J Chin Med. 2018;46(6):1357–68.10.1142/S0192415X18500714Search in Google Scholar PubMed

[12] Gu X, Zhang Q, Zhang W, Zhu L. Curcumin inhibits liver metastasis of gastric cancer through reducing circulating tumor cells. Aging (Albany NY). 2019;11(5):1501–9.10.18632/aging.101848Search in Google Scholar PubMed PubMed Central

[13] Silva G, Teixeira Lima F, Seba V, Mendes Lourenco AL, Lucas TG, de Andrade BV, et al. Curcumin analog CH-5 suppresses the proliferation, migration, and invasion of the human gastric cancer cell line HGC-27. Molecules. 2018;23(2):279.10.3390/molecules23020279Search in Google Scholar PubMed PubMed Central

[14] Zhou R, Wu Y, Wang W, Su W, Liu Y, Wang Y, et al. Circular RNAs (circRNAs) in cancer. Cancer Lett. 2018;425:134–42.10.1016/j.canlet.2018.03.035Search in Google Scholar PubMed

[15] Li J, Zhen L, Zhang Y, Zhao L, Liu H, Cai D, et al. circ-104916 is downregulated in gastric cancer and suppresses migration and invasion of gastric cancer cells. Onco Targets Ther. 2017;10:3521–9.10.2147/OTT.S136347Search in Google Scholar PubMed PubMed Central

[16] Zhang J, Hou L, Liang R, Chen X, Zhang R, Chen W, et al. circDLST promotes the tumorigenesis and metastasis of gastric cancer by sponging miR-502-5p and activating the NRAS/MEK1/ERK1/2 signaling. Mol Cancer. 2019;18(1):80.10.1186/s12943-019-1015-1Search in Google Scholar PubMed PubMed Central

[17] Li H, Yao G, Feng B, Lu X, Fan Y. circ_0056618 and CXCR4 act as competing endogenous in gastric cancer by regulating miR-206. J Cell Biochem. 2018;119(11):9543–51.10.1002/jcb.27271Search in Google Scholar PubMed

[18] van Kouwenhove M, Kedde M, Agami R. MicroRNA regulation by RNA-binding proteins and its implications for cancer. Nat Rev Cancer. 2011;11(9):644–56.10.1038/nrc3107Search in Google Scholar PubMed

[19] Wang QX, Zhu YQ, Zhang H, Xiao J. Altered miRNA expression in gastric cancer: a systematic review and meta-analysis. Cell Physiol Biochem. 2015;35(3):933–44.10.1159/000369750Search in Google Scholar PubMed

[20] Qu F, Cao P. Long noncoding RNA SOX2OT contributes to gastric cancer progression by sponging miR-194-5p from AKT2. Exp Cell Res. 2018;369(2):187–96.10.1016/j.yexcr.2018.05.017Search in Google Scholar PubMed

[21] Ding Z, Lan H, Xu R, Zhou X, Pan Y. LncRNA TP73-AS1 accelerates tumor progression in gastric cancer through regulating miR-194-5p/SDAD1 axis. Pathol Res Pract. 2018;214(12):1993–9.10.1016/j.prp.2018.09.006Search in Google Scholar PubMed

[22] Sun C, Zhang S, Liu C, Liu X. Curcumin promoted miR-34a expression and suppressed proliferation of gastric cancer cells. Cancer Biother Radiopharm. 2019;34(10):634–41.10.1089/cbr.2019.2874Search in Google Scholar PubMed

[23] Qiang Z, Meng L, Yi C, Yu L, Chen W, Sha W. Curcumin regulates the miR-21/PTEN/Akt pathway and acts in synergy with PD98059 to induce apoptosis of human gastric cancer MGC-803 cells. J Int Med Res. 2019;47(3):1288–97.10.1177/0300060518822213Search in Google Scholar PubMed PubMed Central

[24] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8.10.1006/meth.2001.1262Search in Google Scholar PubMed

[25] Li Y, Jiang B, He Z, Zhu H, He R, Fan S, et al. circIQCH sponges miR-145 to promote breast cancer progression by upregulating DNMT3A expression. Aging (Albany NY). 2020;12(15):15532–45.10.18632/aging.103746Search in Google Scholar PubMed PubMed Central

[26] Cai XZ, Wang J, Li XD, Wang GL, Liu FN, Cheng MS, et al. Curcumin suppresses proliferation and invasion in human gastric cancer cells by downregulation of PAK1 activity and cyclin D1 expression. Cancer Biol Ther. 2009;8(14):1360–8.10.4161/cbt.8.14.8720Search in Google Scholar PubMed

[27] Yu LL, Wu JG, Dai N, Yu HG, Si JM. Curcumin reverses chemoresistance of human gastric cancer cells by downregulating the NF-kappaB transcription factor. Oncol Rep. 2011;26(5):1197–203.10.3892/or.2011.1410Search in Google Scholar

[28] Fu H, Wang C, Yang D, Wei Z, Xu J, Hu Z, et al. Curcumin regulates proliferation, autophagy, and apoptosis in gastric cancer cells by affecting PI3K and P53 signaling. J Cell Physiol. 2018;233(6):4634–42.10.1002/jcp.26190Search in Google Scholar PubMed

[29] Zheng X, Ma YF, Zhang XR, Li Y, Zhao HH, Han SG. circ_0056618 promoted cell proliferation, migration and angiogenesis through sponging with miR-206 and upregulating CXCR4 and VEGF-A in colorectal cancer. Eur Rev Med Pharmacol Sci. 2020;24(8):4190–202.Search in Google Scholar

[30] Chen X, Su X, Zhu C, Zhou J. Knockdown of hsa_circ_0023028 inhibits cell proliferation, migration, and invasion in laryngeal cancer by sponging miR-194-5p. Biosci Rep. 2019;39(6):BSR20190177.10.1042/BSR20190177Search in Google Scholar PubMed PubMed Central

[31] Gao Y, Wu P, Ma Y, Xue Y, Liu Y, Zheng J, et al. Circular RNA USP1 regulates the permeability of blood-tumour barrier via miR-194-5p/FLI1 axis. J Cell Mol Med. 2020;24(1):342–55.10.1111/jcmm.14735Search in Google Scholar PubMed PubMed Central

[32] Tan X, Zhou C, Liang Y, Lai YF, Liang Y. circ_0001971 regulates oral squamous cell carcinoma progression and chemosensitivity by targeting miR-194/miR-204 in vitro and in vivo. Eur Rev Med Pharmacol Sci. 2020;24(5):2470–81.Search in Google Scholar

[33] Bao J, Zou JH, Li CY, Zheng GQ. miR-194 inhibits gastric cancer cell proliferation and tumorigenesis by targeting KDM5B. Eur Rev Med Pharmacol Sci. 2016;20(21):4487–93.Search in Google Scholar

[34] Wei R, Ding C, Rodriguez RA, Del Mar Requena Mullor M. The SOX2OT/miR-194-5p axis regulates cell proliferation and mobility of gastric cancer through suppressing epithelial-mesenchymal transition. Oncol Lett. 2018;16(5):6361–8.10.3892/ol.2018.9433Search in Google Scholar PubMed PubMed Central

[35] Bahrami A, Ferns GA. Effect of curcumin and its derivates on gastric cancer: molecular mechanisms. Nutr Cancer. 2021;73(9):1553–69.10.1080/01635581.2020.1808232Search in Google Scholar PubMed

Received: 2020-08-07
Revised: 2021-07-06
Accepted: 2021-07-20
Published Online: 2021-09-06

© 2021 Shan Li et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Research progress on the mechanism of orexin in pain regulation in different brain regions
  3. Adriamycin-resistant cells are significantly less fit than adriamycin-sensitive cells in cervical cancer
  4. Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus
  5. Iris metastasis of diffuse large B-cell lymphoma misdiagnosed as primary angle-closure glaucoma: A case report and review of the literature
  6. LncRNA PVT1 promotes cervical cancer progression by sponging miR-503 to upregulate ARL2 expression
  7. Two new inflammatory markers related to the CURB-65 score for disease severity in patients with community-acquired pneumonia: The hypersensitive C-reactive protein to albumin ratio and fibrinogen to albumin ratio
  8. Circ_0091579 enhances the malignancy of hepatocellular carcinoma via miR-1287/PDK2 axis
  9. Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-κB signaling pathway
  10. Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats
  11. ABCB1 polymorphism in clopidogrel-treated Montenegrin patients
  12. Metabolic profiling of fatty acids in Tripterygium wilfordii multiglucoside- and triptolide-induced liver-injured rats
  13. miR-338-3p inhibits cell growth, invasion, and EMT process in neuroblastoma through targeting MMP-2
  14. Verification of neuroprotective effects of alpha-lipoic acid on chronic neuropathic pain in a chronic constriction injury rat model
  15. Circ_WWC3 overexpression decelerates the progression of osteosarcoma by regulating miR-421/PDE7B axis
  16. Knockdown of TUG1 rescues cardiomyocyte hypertrophy through targeting the miR-497/MEF2C axis
  17. MiR-146b-3p protects against AR42J cell injury in cerulein-induced acute pancreatitis model through targeting Anxa2
  18. miR-299-3p suppresses cell progression and induces apoptosis by downregulating PAX3 in gastric cancer
  19. Diabetes and COVID-19
  20. Discovery of novel potential KIT inhibitors for the treatment of gastrointestinal stromal tumor
  21. TEAD4 is a novel independent predictor of prognosis in LGG patients with IDH mutation
  22. circTLK1 facilitates the proliferation and metastasis of renal cell carcinoma by regulating miR-495-3p/CBL axis
  23. microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury
  24. Long noncoding RNA TUG1 regulates degradation of chondrocyte extracellular matrix via miR-320c/MMP-13 axis in osteoarthritis
  25. Duodenal adenocarcinoma with skin metastasis as initial manifestation: A case report
  26. Effects of Loofah cylindrica extract on learning and memory ability, brain tissue morphology, and immune function of aging mice
  27. Recombinant Bacteroides fragilis enterotoxin-1 (rBFT-1) promotes proliferation of colorectal cancer via CCL3-related molecular pathways
  28. Blocking circ_UBR4 suppressed proliferation, migration, and cell cycle progression of human vascular smooth muscle cells in atherosclerosis
  29. Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
  30. Downregulation of circ_0037655 impedes glioma formation and metastasis via the regulation of miR-1229-3p/ITGB8 axis
  31. Vitamin D deficiency and cardiovascular risk in type 2 diabetes population
  32. Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis
  33. Mechanisms of circular RNA circ_0066147 on pancreatic cancer progression
  34. lncRNA myocardial infarction-associated transcript (MIAT) knockdown alleviates LPS-induced chondrocytes inflammatory injury via regulating miR-488-3p/sex determining region Y-related HMG-box 11 (SOX11) axis
  35. Identification of circRNA circ-CSPP1 as a potent driver of colorectal cancer by directly targeting the miR-431/LASP1 axis
  36. Hyperhomocysteinemia exacerbates ischemia-reperfusion injury-induced acute kidney injury by mediating oxidative stress, DNA damage, JNK pathway, and apoptosis
  37. Potential prognostic markers and significant lncRNA–mRNA co-expression pairs in laryngeal squamous cell carcinoma
  38. Gamma irradiation-mediated inactivation of enveloped viruses with conservation of genome integrity: Potential application for SARS-CoV-2 inactivated vaccine development
  39. ADHFE1 is a correlative factor of patient survival in cancer
  40. The association of transcription factor Prox1 with the proliferation, migration, and invasion of lung cancer
  41. Is there a relationship between the prevalence of autoimmune thyroid disease and diabetic kidney disease?
  42. Immunoregulatory function of Dictyophora echinovolvata spore polysaccharides in immunocompromised mice induced by cyclophosphamide
  43. T cell epitopes of SARS-CoV-2 spike protein and conserved surface protein of Plasmodium malariae share sequence homology
  44. Anti-obesity effect and mechanism of mesenchymal stem cells influence on obese mice
  45. Long noncoding RNA HULC contributes to paclitaxel resistance in ovarian cancer via miR-137/ITGB8 axis
  46. Glucocorticoids protect HEI-OC1 cells from tunicamycin-induced cell damage via inhibiting endoplasmic reticulum stress
  47. Prognostic value of the neutrophil-to-lymphocyte ratio in acute organophosphorus pesticide poisoning
  48. Gastroprotective effects of diosgenin against HCl/ethanol-induced gastric mucosal injury through suppression of NF-κβ and myeloperoxidase activities
  49. Silencing of LINC00707 suppresses cell proliferation, migration, and invasion of osteosarcoma cells by modulating miR-338-3p/AHSA1 axis
  50. Successful extracorporeal membrane oxygenation resuscitation of patient with cardiogenic shock induced by phaeochromocytoma crisis mimicking hyperthyroidism: A case report
  51. Effects of miR-185-5p on replication of hepatitis C virus
  52. Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis
  53. Primary localized cutaneous nodular amyloidosis presenting as lymphatic malformation: A case report
  54. Multimodal magnetic resonance imaging analysis in the characteristics of Wilson’s disease: A case report and literature review
  55. Therapeutic potential of anticoagulant therapy in association with cytokine storm inhibition in severe cases of COVID-19: A case report
  56. Neoadjuvant immunotherapy combined with chemotherapy for locally advanced squamous cell lung carcinoma: A case report and literature review
  57. Rufinamide (RUF) suppresses inflammation and maintains the integrity of the blood–brain barrier during kainic acid-induced brain damage
  58. Inhibition of ADAM10 ameliorates doxorubicin-induced cardiac remodeling by suppressing N-cadherin cleavage
  59. Invasive ductal carcinoma and small lymphocytic lymphoma/chronic lymphocytic leukemia manifesting as a collision breast tumor: A case report and literature review
  60. Clonal diversity of the B cell receptor repertoire in patients with coronary in-stent restenosis and type 2 diabetes
  61. CTLA-4 promotes lymphoma progression through tumor stem cell enrichment and immunosuppression
  62. WDR74 promotes proliferation and metastasis in colorectal cancer cells through regulating the Wnt/β-catenin signaling pathway
  63. Down-regulation of IGHG1 enhances Protoporphyrin IX accumulation and inhibits hemin biosynthesis in colorectal cancer by suppressing the MEK-FECH axis
  64. Curcumin suppresses the progression of gastric cancer by regulating circ_0056618/miR-194-5p axis
  65. Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway
  66. lncRNA NEAT1 regulates CYP1A2 and influences steroid-induced necrosis
  67. A two-microRNA signature predicts the progression of male thyroid cancer
  68. Isolation of microglia from retinas of chronic ocular hypertensive rats
  69. Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study
  70. Calcineurin Aβ gene knockdown inhibits transient outward potassium current ion channel remodeling in hypertrophic ventricular myocyte
  71. Aberrant expression of PI3K/AKT signaling is involved in apoptosis resistance of hepatocellular carcinoma
  72. Clinical significance of activated Wnt/β-catenin signaling in apoptosis inhibition of oral cancer
  73. circ_CHFR regulates ox-LDL-mediated cell proliferation, apoptosis, and EndoMT by miR-15a-5p/EGFR axis in human brain microvessel endothelial cells
  74. Resveratrol pretreatment mitigates LPS-induced acute lung injury by regulating conventional dendritic cells’ maturation and function
  75. Ubiquitin-conjugating enzyme E2T promotes tumor stem cell characteristics and migration of cervical cancer cells by regulating the GRP78/FAK pathway
  76. Carriage of HLA-DRB1*11 and 1*12 alleles and risk factors in patients with breast cancer in Burkina Faso
  77. Protective effect of Lactobacillus-containing probiotics on intestinal mucosa of rats experiencing traumatic hemorrhagic shock
  78. Glucocorticoids induce osteonecrosis of the femoral head through the Hippo signaling pathway
  79. Endothelial cell-derived SSAO can increase MLC20 phosphorylation in VSMCs
  80. Downregulation of STOX1 is a novel prognostic biomarker for glioma patients
  81. miR-378a-3p regulates glioma cell chemosensitivity to cisplatin through IGF1R
  82. The molecular mechanisms underlying arecoline-induced cardiac fibrosis in rats
  83. TGF-β1-overexpressing mesenchymal stem cells reciprocally regulate Th17/Treg cells by regulating the expression of IFN-γ
  84. The influence of MTHFR genetic polymorphisms on methotrexate therapy in pediatric acute lymphoblastic leukemia
  85. Red blood cell distribution width-standard deviation but not red blood cell distribution width-coefficient of variation as a potential index for the diagnosis of iron-deficiency anemia in mid-pregnancy women
  86. Small cell neuroendocrine carcinoma expressing alpha fetoprotein in the endometrium
  87. Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers
  88. Molecular characterization and phylogenetic studies of Echinococcus granulosus and Taenia multiceps coenurus cysts in slaughtered sheep in Saudi Arabia
  89. ITGB5 mutation discovered in a Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
  90. ACTB and GAPDH appear at multiple SDS-PAGE positions, thus not suitable as reference genes for determining protein loading in techniques like Western blotting
  91. Facilitation of mouse skin-derived precursor growth and yield by optimizing plating density
  92. 3,4-Dihydroxyphenylethanol ameliorates lipopolysaccharide-induced septic cardiac injury in a murine model
  93. Downregulation of PITX2 inhibits the proliferation and migration of liver cancer cells and induces cell apoptosis
  94. Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B
  95. Novel predictor of the occurrence of DKA in T1DM patients without infection: A combination of neutrophil/lymphocyte ratio and white blood cells
  96. Investigation of molecular regulation mechanism under the pathophysiology of subarachnoid hemorrhage
  97. miR-25-3p protects renal tubular epithelial cells from apoptosis induced by renal IRI by targeting DKK3
  98. Bioengineering and Biotechnology
  99. Green fabrication of Co and Co3O4 nanoparticles and their biomedical applications: A review
  100. Agriculture
  101. Effects of inorganic and organic selenium sources on the growth performance of broilers in China: A meta-analysis
  102. Crop-livestock integration practices, knowledge, and attitudes among smallholder farmers: Hedging against climate change-induced shocks in semi-arid Zimbabwe
  103. Food Science and Nutrition
  104. Effect of food processing on the antioxidant activity of flavones from Polygonatum odoratum (Mill.) Druce
  105. Vitamin D and iodine status was associated with the risk and complication of type 2 diabetes mellitus in China
  106. Diversity of microbiota in Slovak summer ewes’ cheese “Bryndza”
  107. Comparison between voltammetric detection methods for abalone-flavoring liquid
  108. Composition of low-molecular-weight glutenin subunits in common wheat (Triticum aestivum L.) and their effects on the rheological properties of dough
  109. Application of culture, PCR, and PacBio sequencing for determination of microbial composition of milk from subclinical mastitis dairy cows of smallholder farms
  110. Investigating microplastics and potentially toxic elements contamination in canned Tuna, Salmon, and Sardine fishes from Taif markets, KSA
  111. From bench to bar side: Evaluating the red wine storage lesion
  112. Establishment of an iodine model for prevention of iodine-excess-induced thyroid dysfunction in pregnant women
  113. Plant Sciences
  114. Characterization of GMPP from Dendrobium huoshanense yielding GDP-D-mannose
  115. Comparative analysis of the SPL gene family in five Rosaceae species: Fragaria vesca, Malus domestica, Prunus persica, Rubus occidentalis, and Pyrus pyrifolia
  116. Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR
  117. Investigation of bioactivities of Taxus chinensis, Taxus cuspidata, and Taxus × media by gas chromatography-mass spectrometry
  118. Morphological structures and histochemistry of roots and shoots in Myricaria laxiflora (Tamaricaceae)
  119. Transcriptome analysis of resistance mechanism to potato wart disease
  120. In silico analysis of glycosyltransferase 2 family genes in duckweed (Spirodela polyrhiza) and its role in salt stress tolerance
  121. Comparative study on growth traits and ions regulation of zoysiagrasses under varied salinity treatments
  122. Role of MS1 homolog Ntms1 gene of tobacco infertility
  123. Biological characteristics and fungicide sensitivity of Pyricularia variabilis
  124. In silico/computational analysis of mevalonate pyrophosphate decarboxylase gene families in Campanulids
  125. Identification of novel drought-responsive miRNA regulatory network of drought stress response in common vetch (Vicia sativa)
  126. How photoautotrophy, photomixotrophy, and ventilation affect the stomata and fluorescence emission of pistachios rootstock?
  127. Apoplastic histochemical features of plant root walls that may facilitate ion uptake and retention
  128. Ecology and Environmental Sciences
  129. The impact of sewage sludge on the fungal communities in the rhizosphere and roots of barley and on barley yield
  130. Domestication of wild animals may provide a springboard for rapid variation of coronavirus
  131. Response of benthic invertebrate assemblages to seasonal and habitat condition in the Wewe River, Ashanti region (Ghana)
  132. Molecular record for the first authentication of Isaria cicadae from Vietnam
  133. Twig biomass allocation of Betula platyphylla in different habitats in Wudalianchi Volcano, northeast China
  134. Animal Sciences
  135. Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens
  136. Predators of the giant pine scale, Marchalina hellenica (Gennadius 1883; Hemiptera: Marchalinidae), out of its natural range in Turkey
  137. Honey in wound healing: An updated review
  138. NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block
  139. Radiotherapy for the treatment of pulmonary hydatidosis in sheep
  140. Retraction
  141. Retraction of “Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating microRNA-34a-5p/NOTCH1 signaling pathway”
  142. Special Issue on Reuse of Agro-Industrial By-Products
  143. An effect of positional isomerism of benzoic acid derivatives on antibacterial activity against Escherichia coli
  144. Special Issue on Computing and Artificial Techniques for Life Science Applications - Part II
  145. Relationship of Gensini score with retinal vessel diameter and arteriovenous ratio in senile CHD
  146. Effects of different enantiomers of amlodipine on lipid profiles and vasomotor factors in atherosclerotic rabbits
  147. Establishment of the New Zealand white rabbit animal model of fatty keratopathy associated with corneal neovascularization
  148. lncRNA MALAT1/miR-143 axis is a potential biomarker for in-stent restenosis and is involved in the multiplication of vascular smooth muscle cells
Downloaded on 8.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2021-0092/html?lang=en
Scroll to top button