Home Physical Sciences Exploitation of mangliculous marine fungi, Amarenographium solium, for the green synthesis of silver nanoparticles and their activity against multiple drug-resistant bacteria
Article Open Access

Exploitation of mangliculous marine fungi, Amarenographium solium, for the green synthesis of silver nanoparticles and their activity against multiple drug-resistant bacteria

  • Mohamed S. Hodhod , Abdel-Rhman Z. Gaafar ORCID logo EMAIL logo , Bandar M. AlMunqedhi , Abdalla Elzein and Abdelmalik M. Abdelmalik
Published/Copyright: February 12, 2024
Download Article (PDF)
Open Chemistry
From the journal Open Chemistry Volume 22 Issue 1

Abstract

The green synthesis pathway for silver nanoparticles (AgNPs) used in bacterial treatment is regarded as crucial because of its cost-effectiveness, nontoxicity, and eco-friendliness. During the present work, the mangliculous marine fungi Amarenographium solium isolated from the Arabian Gulf Coast of Saudi Arabia were utilized for the synthesis of AgNP, through the bio-reduction of aqueous silver nitrate (AgNO3) solution. The success in AgNP synthesis was visually identified by the development of dark brown color in the cell-free filtrate and was further confirmed by ultraviolet–visible spectroscopy, which showed a peak at 425 nm. The AgNPs produced were further characterized using X-ray diffraction data analysis that proved the bioreduction of silver to 20 nm, and transmission electron microscopy revealed the formation of well-dispersed spherical nanoparticles with an average mean size of 12 nm. The optimization reaction parameters of temperature, pH, and metal salt concentration were carried out and resulted in a combination of 30°C, 7 and 1.5 mM, respectively, for rapid and maximum yield production. The antibacterial activity of the produced nanoparticles was evaluated using the two-fold microdilution method and showed a minimum inhibitory concentration of 9.375 μg/mL of AgNP against multiple drug-resistant bacterial strains.

Keywords: marine fungi; silver nanoparticles; biosynthesis; characterization; optimization; antibacterial activity

1 Introduction

Multiple drug resistance is a global threat, driven by the extensive use of antimicrobials that results in the emergence of many different bacterial species with increased resistance frequencies, especially in developing countries due to poor sanitary conditions, the availability of antimicrobials without prescriptions, and low healthcare budgets that resulted in the limitation of access to new effective antibiotics [1]. World health leaders have named antibiotic-resistant microorganisms ‘nightmare bacteria’ that ‘pose a catastrophic threat’ as new forms of drug resistance can easily spread between continents and across international boundaries, causing infections with significantly high rates of morbidities and mortality [2,3].

Metal nanoparticles (m-NPs) have been shown to be effective antibacterial agents capable of bypassing resistance mechanisms and hindering their future resistance potential [4]. Many routes have been developed for the synthesis of m-NPs, including physical and chemical pathways, but concerns have been raised over the environmental pollution of these production routes, which generate massive amounts of toxic hazard byproducts. Nanobiotechnology has emerged due to the integration between biotechnology and nanotechnology providing a new route of synthesis for antibiotic production using “green chemistry,” which is a clean, nontoxic, and environmentally friendly method used for the synthesis of m-NP by exploiting biological systems, i.e., plants, algae, fungi, and bacteria [5,6,7].

Fungi are the most efficient biological system for nanoparticle synthesis due to several advantageous characteristics including extreme metal bioaccumulation abilities, elevated levels of tolerance, and their ability to secrete efficient nanoparticle bioreduction extracellular enzymes, which ease the nanoparticles synthesis scaleup, making the entire process more cost-effective [8,9]. Silver is widely used in nanoparticle synthesis over other metals, due to its powerful antibacterial effect [10].

However, the AgNPs produced have a wide variation in antibacterial potential depending on the bioreduction machinery possessed by different fungal species. Studies using fungi in silver nanoparticles (AgNPs) included the use of Pleurotus ostreatus, Fusarium oxysporum, and filamentous fungi, which have shown antibacterial activity against various pathogenic bacterial strains [11]. Green AgNPs have been identified as potential antibacterial agents against a variety of Gram-positive and Gram-negative pathogenic bacteria, including Bacillus subtilis, Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa, Salmonella epidermidis, Salmonella typhimurium, Staphylococcus aureus, Streptococcus pneumoniae, Streptococcus pyogens, and Vibrio parahaemolyticus [12,13,14,15,16].

Therefore, the continuous search for new fungal resources can yield new particles with different characteristics. Among these untapped resources are manglicolous fungi, which are the second largest ecological group that inhabits salt-tolerant shrubs, ferns, and palms that colonize intertidal zones of mudflats and banks of tropical and subtropical rivers and coastlines in many parts of the world [17,18]. This study aims to utilize the manglicolous fungi Amarenographium solium for the first time in the synthesis of AgNP and to evaluate their activity against multiple drug-resistant bacteria.

2 Materials and methods

2.1 Fungal isolation and growth conditions

Intertidal deteriorated wood samples originated from a mangrove stand on Tarout island in Saudi Arabia’s Arabian Gulf Sea, at coordinates (26°35′43N to 50°3′51E). The morphological features of fruiting structures (conidiophores, conidiogensis, conidiomata, and conidia for anamorphic fungus) were used to identify A. solium [19]. The conidia were placed in seawater and photographed, measured, and described employing a compound microscope (China, Motic ACCU-scope 3002). A scanning electron microscope (SEM) (JOEL, JSM-6380 LA, Tokyo, Japan) was used to analyze A. solium further. To obtain single spore cultures of A. solium, we prepared a conidia suspension in seawater on a microscopic slide under sterilized condition. Small drops of suspension were placed on Petri plates containing glucose yeast agar GYA (10 g glucose, 1 g yeast extract, 18 g agar in 1 L of seawater) and incubated at 25°C in the dark. Petri plates were checked after 12 h for germinated conidia, which were then transferred to new GYA petri plates using sterile forceps and cultured in the dark at 25°C for 1–2 weeks [20]. A pure fresh culture of A. solium was maintained in glycerol solution (10%) at −80°C and registered in the MycoBank Molecular Microbiology Laboratory, Department of Botany and Microbiology, College of Sciences, King Saud University, under the ID number MF412.

2.2 Molecular identification of A. solium

Pure isolates were grown in yeast, maltose, and glucose broth (YMG) (4 g yeast extract, 10 g of glucose, 10 g malt extract in 1 liter of seawater) until sufficient mycelium was formed. Mycelium was harvested by centrifugation at 1,400 rpm for 10 min, then washed three times with sterile normal saline solution (0.89% NaCl). The DNA extraction procedure was carried out using the DNA extraction kit (QIAGEN; DNeasy Plant, Cell/tissue and Fungi DNA extraction kit, Venlo, The Netherlands) according to the manufacturer’s instructions. The large ribosomal subunit (LSU rDNA) was amplified using the forward primer LROR and LR7 as reverse [21], while the small ribosomal subunit (SSU rDNA) was amplified using NS1 as forward and NS8 as reverse [22] (Table 1).

Table 1

Forward and reverse primers along with their sequences

Primer Sequence (5′−3′)
LR0R ACCCGC TGA ACT TAA GC
LR7 TACTAC CAC CAA GAT CT
NS1 GTAGTCATATGCTTGTCTC
NS8 TCCGCAGGTTCACCTACGGA

Sequencing was carried out by Macrogen Inc. (Korea) using MGTMTaq-HF DNA Polymerase; with cycling profile: initial denaturation at 96°C for 3 min, followed by 45 cycles of 96°C for 15 s, 52°C for 45 s, 72°C for 1 min 30 s of denaturation, annealing and extension respectively, then a final extension at 72°C for 7 min. After that, sequences were edited using Sequencher, Demo V4.10.1 for sequence enhancement, aligned with their relatives from GenBank within Clustal X [23] and then manually adjusted. Sequences were then uploaded to GenBank via BanKit and the accession numbers to the sequences were given as (MK007121) and (MK007122) for the large and small ribosomal subunits, respectively. Phylogenetic analysis was performed using the Molecular Evolutionary Genetics Analysis program (MEGA X) (Kumar et al. [24]) to generate maximum likelihood (ML) trees and maximum parsimony (MP) trees [25,26].

2.3 Biosynthesis of AgNPs

A. solium was propagated in 250 Erlenmeyer flasks with 100 mL of YMG sea-water medium. For 5 days at 25°C, cultured flasks were allowed to incubate in a rotating shaker at 200 rpm. Extracellular biosynthesis of AgNP was carried out using the supernatant (potential bioreduction agent) obtained after centrifugation of the cultured flasks at 1,400 rpm for 10 min and the metal salt precursor solution 1 mM silver nitrate (AgNO3) (HPLC grade – Sigma-Aldrich). The supernatant was added to the AgNO3 solution in a 1:9 ratio. The metal salt’s bioreduction was immediately identified by the development of a brown hue, and it was then placed on a rotating shaker (200 rpm) at 25°C for 72 h to finish the reduction process [27].

2.4 Optimization of the AgNP reaction for rapid synthesis

Yield optimization was performed using a factorial experiment in a completely randomized design CRD [28]. The experiment was carried out using temperature, metal salt concentration (mM), and pH as the main factors, each with three levels and three replicates. AgNP yield (mg/mL) was the response variable and was determined using ultraviolet–visible spectroscopy (UV-1800 Shimadzu Spectrophotometer; Japan). Biosynthesis was estimated using the standard curve for the synthesized metal and the linear equation Y = XS ± I “where Y = yield (mg/mL), S = slope, and I = intercept” [29].

2.5 Characterization of AgNPs

2.5.1 X-ray diffraction (XRD)

The mean size of AgNPs was determined by XRD-Ultima IV Rigaku; USA on the corresponding drop-coated film of nanoparticle solution. The Scherer formula d = 0.9 λ/β cos θ was employed to calculate the mean size of the generated nanoparticles, where d is the mean diameter of the nanoparticles, λ is the wavelength of the X-ray radiation source, β is the complete angular width around half maximum at the diffraction angle of the XRD peak, and θ is the angle of Bragg [30].

2.5.2 Transmission electron microscopy (TEM)

The physical characteristics of the produced AgNPs, involving their form and size, were studied and characterized employing a TEM apparatus (JEOL-JEM-1011; Tokyo, Japan). The sample was generated by drop-coating a sheet of AgNPs (100%) over carbon-coated copper TEM grids. Prior to measuring, the films on the TEM grids were dried.

2.5.3 Fourier transform infrared (FTIR) spectroscopy

FTIR spectroscopy (PerkinElmer 1000 FT-IR, USA) was used to identify candidate biomolecules involved in AgNP bioreduction. The biosynthesized nanoparticles were centrifuged at 14,000 rpm for 15 minutes before being re-dispersed in sterile distilled water to eliminate any uncoordinated biological molecules. The process of centrifugation and redispersion in sterile distilled water was carried out three times to guarantee greater separation of free entities from m-NP. The purified pellets were subsequently dried, and the powders were analyzed using FTIR spectroscopy.

2.6 Antibacterial activity

The antibacterial ability of the m-NP produced was tested against eight pathogenic bacterial species (Table 2) obtained from the Microbiology Laboratory, Department of Botany and Microbiology, College of Science, King Saud University. A two-fold microdilution method was used to determine the minimum inhibitory concentration MIC using a 96-well plate (FALCON, France); 1,200 μg/mL was the starting concentration for AgNP, while 9.375 μg/mL was the end point concentration reached by serial microdilutions. Plates (three replicates) were then measured using an ELISA reader (ELX 800 microplate reader; BioTek, USA). After MIC determination, aliquots of 50 µL from all wells that did not show bacterial growth were subcultured on Mueller-Hinton agar plates and incubated at 37°C for 24 h, to determine the minimum end point of bactericidal concentration.

Table 2

bacterial stains used to assess the potential of biosynthesized AgNP activity

Bacterial strain Type Sensitivity
1 E. coli Gram negative Sensitive
2 E. coli Resistant
3 Acinetobacter baumannii Sensitive
4 Acinetobacter baumannii Resistant
5 S. aureus Gram-positive Sensitive
6 S. aureus Resistant
7 S. epidermidis Sensitive
8 S. epidermidis Resistant

2.7 Statistical analysis

A one-way analysis of variance was performed to analyze antibacterial activity data using IBM SPSS Statistics 25.

3 Results

3.1 Morphological identification

Using dissecting, compound and electron microscope, A. solium was recognized by its characteristics, including (1) Pycnidia 330–380 µm high, 210–245 µm in diameter, subglobose, immersed, brown to black, ostiolate, with circular opening, mature pycnidia that form a black mass of conidia on the surface of wood, (2) Conidia 37.5–46 × 13–18 µm, muriform, with (3-) 5 (-7) transverse septa and (0-) 1 (-2) longitudinal septa, clavate, with rounded apex and acute or truncate basal end acute or truncate, at first yellowish to olivaceous-brown, becoming brown at maturity, constricted at the central septum and slightly at the other septa, smooth with a gelatinous, striated, regular cap and sheath; the sheath is multilayered in young conidia, swelling and forming fibrillary material in water and eventually dissolving (Figure 1).

Figure 1 (a–e) A. solium. (a and b) Dissecting micrographs of the distribution of Pycnidia in a mangrove wood sample at different magnification. (c–i) Bright field light micrographs (from the holotype, mounted in water). (c) Longitudinal section of pycnidium bars: C = 50 μm. (d–i) Conidia at different developmental stages, taking various shapes. Bars: d–i = 5 µm. (j–k) SEM. (j) Rough-walled conidia. (k) Magnified conidia. Bars: a–e = 10 µm.
Figure 1

(a–e) A. solium. (a and b) Dissecting micrographs of the distribution of Pycnidia in a mangrove wood sample at different magnification. (c–i) Bright field light micrographs (from the holotype, mounted in water). (c) Longitudinal section of pycnidium bars: C = 50 μm. (d–i) Conidia at different developmental stages, taking various shapes. Bars: d–i = 5 µm. (j–k) SEM. (j) Rough-walled conidia. (k) Magnified conidia. Bars: a–e = 10 µm.

3.2 Phylogenetic analysis

3.2.1 Small subunit data set

A. solium proved to be a member of the Pleosporales Incertae-sedis family and formed a sister taxon to A. solium Abdel-Wahab, Hodhod, Bahkali, and K.D. Hyde. Forming a well-supported clade in the SSU data set (100/100 for ML/MP, respectively). The collected dataset included the query sequence and 20 taxa of which one belongs to the same order Pleosporales Incertae-sedis and includes three taxa from the closest families Massariaceae and Montagnulaceae. Two taxa of the order Dothideales were used as outgroup taxa. The small subunit dataset consisted of 1,828 total characters. The three most parsimonious trees were produced using a heuristic search; all produced trees with a tree length of 347 steps, a consistency index of 0.650943, a retention index of (0.753333), and the composite index is 0.592680 (0.490377) for all sites and parsimony-informative sites. The ML analysis produced one tree (–ln likelihood = 4603.62). ML and MP analyses produced trees with similar topologies (Figure 2).

Figure 2 Phylogenetic tree of A. solium and related taxa, based on the nucleotide sequences of the small subunit sequence (SSU) gene. Numbers are bootstrap support for ML and MP, respectively. The fungus, A. solium, is highlighted.
Figure 2

Phylogenetic tree of A. solium and related taxa, based on the nucleotide sequences of the small subunit sequence (SSU) gene. Numbers are bootstrap support for ML and MP, respectively. The fungus, A. solium, is highlighted.

3.2.2 Large subunit data set

A. solium proved to be a member of the Pleosporales Incertae-sedis family and formed a sister taxon to A. solium Abdel-Wahab, Hodhod, Bahkali, and K.D. Hyde. Forming a well- supported clade in the LSU data set (100/100 for ML/MP, respectively). The collected data set included the query sequence 37 taxa of which one belonging to the same order Pleosporales Incertae-sedis includes eight taxa from the closest family Trematosphaeriaceae. Two taxa from the order Dothideales were used as outgroup taxa. The large subunit data set consisted of 1,488 total characters. The three most parsimonious trees were produced using a heuristic search, all trees produced with a tree length of 1,129 steps, a consistency index of 0.482197, a retention index of (0.692447), and the composite index is 0.380263 (0.333896) for all sites and parsimony-informative sites. Maximum likelihood analysis produced one tree (–ln likelihood = 8444.79). The ML and MP analyzes produced trees with similar topologies (Figure 3).

Figure 3 Phylogenetic tree of A. solium and related taxa, based on the nucleotide sequences of the large subunit sequence (LSU) gene. Numbers are bootstrap support for ML and MP, respectively. The fungus, A. solium, is highlighted.
Figure 3

Phylogenetic tree of A. solium and related taxa, based on the nucleotide sequences of the large subunit sequence (LSU) gene. Numbers are bootstrap support for ML and MP, respectively. The fungus, A. solium, is highlighted.

3.2.3 Biosynthesis of AgNPs

Initial observation revealed the development of a dark brown color in the solution, indicating the bioreduction of the metal salt into AgNPs using the cell-free filtrate (CFF) of A. solium. Further confirmation of AgNP biosynthesis using ultraviolet–visible (UV–vis) spectroscopy with optical density ranging from 300 to 800 nm showed a large peak at 425 nm (Figure 4).

Figure 4 UV–vis spectra of silver nanoparticles synthesized using A. solium CFF of A. solium (orange curve), and the control group is represented herein by the (blue curve).
Figure 4

UV–vis spectra of silver nanoparticles synthesized using A. solium CFF of A. solium (orange curve), and the control group is represented herein by the (blue curve).

3.3 Factors affecting AgNP biosynthesis and optimization of its production

3.3.1 Effect of temperature

The silver (Ag) metal nanoparticle yield rate was directly affected by the change in temperature. AgNO3 was incubated at different temperatures (20, 30, and 40°C). The metal nanoparticle yield showed a dramatic decrease when subjected to a low temperature of 20°C, while it showed the highest rates at 30°C. For a high temperature of 40°C, the result yield was slightly decreased compared to middle temperature trials.

3.3.2 Effect of metal salt concentration (mM)

The optimization experiment was designed to subject A. solium to different concentrations of metal salt (AgNO3); concentrations applied were (0.5, 1, 1.5, and 2 mM). The fungi showed an increase in the yield rates until 1.5 mM, while 2 mM did not show any significant change in the bioreduction rate, the biosynthesized nanoparticles for silver were monitored using UV–vis spectral analysis, which provided evidence that the concentration of an increase in the metal salts is directly proportional to the result yield.

3.3.3 Effect of pH

A. solium sowed different responses along the pH gradient (3, 7, and 9), as biosynthesis levels showed their lowest levels at pH 3, while they showed their highest production levels at pH 7, yield at pH 9 showed a slight decrease in metal reduction compared to the pH 7 results.

3.3.4 Optimization of AgNPs

The optimum conditions (i.e., temperature, metal salt concentration [mM], and pH) for maximizing the yield (mg/mL) of biosynthesized nanoparticles were investigated from 27 experiments designed from all expected possibilities (Table 3). A. solium CFF showed a significant increase in yield (118.6 μg/mL) using the productive conditions in experiment 15 (pH = 7, temperature = 30°C and metal salt concentration = (mM) = 1.5); while the minimum yield (115.5 μg/mL) was recorded in experiment 7 (pH = 3, temperature = 40°C and metal salt concentration [mM] = 0.5) (Figure 5).

Table 3

Trials and results of three factorial combinations of pH, temperature, and metal concentration

R1 R1 R2 R2 R3 R3
Experiment pH Temperature Concentration Result/OD μg/mL Result/OD μg/mL Result/OD μg/mL
1 3 20 0.5 0.387 115.772 0.382 115.767 0.281 115.666
2 3 20 1 0.629 116.014 0.587 115.972 0.676 116.061
3 3 20 1.5 0.763 116.148 0.737 116.122 0.689 116.074
4 3 30 0.5 0.349 115.734 0.316 115.701 0.377 115.762
5 3 30 1 0.673 116.058 0.665 116.050 0.682 116.067
6 3 30 1.5 0.743 116.128 0.779 116.164 0.728 116.113
7 3 40 0.5 0.149 115.534 0.127 115.512 0.136 115.521
8 3 40 1 0.301 115.686 0.315 115.700 0.294 115.679
9 3 40 1.5 0.446 115.831 0.459 115.844 0.468 115.853
10 7 20 0.5 1.057 116.442 1.076 116.461 1.014 116.399
11 7 20 1 2.181 117.566 2.165 117.550 2.144 117.529
12 7 20 1.5 2.627 118.012 2.553 117.938 2.725 118.110
13 7 30 0.5 1.280 116.665 1.226 116.611 1.245 116.630
14 7 30 1 2.401 117.786 2.443 117.828 2.386 117.771
15 7 30 1.5 3.221 118.606 3.320 118.705 3.198 118.583
16 7 40 0.5 0.999 116.384 1.084 116.469 1.106 116.491
17 7 40 1 2.077 117.462 2.093 117.478 2.062 117.447
18 7 40 1.5 2.501 117.886 2.488 117.873 2.479 117.864
19 9 20 0.5 0.967 116.352 1.018 116.403 1.003 116.388
20 9 20 1 2.079 117.464 2.138 117.523 2.009 117.394
21 9 20 1.5 2.438 117.823 2.276 117.661 2.507 117.892
22 9 30 0.5 1.262 116.647 1.280 116.665 1.273 116.658
23 9 30 1 2.391 117.776 2.376 117.761 2.401 117.786
24 9 30 1.5 2.731 118.116 2.697 118.082 2.743 118.128
25 9 40 0.5 0.884 116.269 0.876 116.261 0.891 116.276
26 9 40 1 1.912 117.297 2.003 117.388 1.936 117.321
27 9 40 1.5 2.239 117.624 2.198 117.583 2.222 117.607
Figure 5 Means ± standard deviation of the yield (mg/mL) of AgNP produced from 27 experiments designed from all expected possibilities for temperature, metal salt concentration (mM), and pH. The green and red stars indicate the maximum and minimum significant production, respectively (P < 0.05).
Figure 5

Means ± standard deviation of the yield (mg/mL) of AgNP produced from 27 experiments designed from all expected possibilities for temperature, metal salt concentration (mM), and pH. The green and red stars indicate the maximum and minimum significant production, respectively (P < 0.05).

3.4 Characterization of AgNPs

3.4.1 XRD

The XRD of AgNPs corresponded to the characteristic face-centered cubic (FCC) silver lines indexed as (2.832), (1.987), (1.280), and (1.248) that were observed in these samples at diffraction angles of 32.6°, 46.1°, 74.7°, and 77.6°, respectively (Figure 6). The Scherer equation in the XRD data calculated the mean size of the AgNPs to be 20 nm.

Figure 6 XRD pattern of silver nanoparticles synthesized by A. solium.
Figure 6

XRD pattern of silver nanoparticles synthesized by A. solium.

3.4.2 TEM

The results of the synthesized m-NP revealed their surface characteristics and morphology based on shape and size. AgNPs under optimized conditions appeared to be spherical in shape with an average mean size of 12 nm (Figure 7).

Figure 7 TEM micrograph of silver nanoparticles demonstrating shape and particle size estimation, where silver has a spherical form with an average mean size of 12 nm.
Figure 7

TEM micrograph of silver nanoparticles demonstrating shape and particle size estimation, where silver has a spherical form with an average mean size of 12 nm.

3.4.3 FTIR spectroscopy

FTIR spectroscopy on AgNP showed absorbance at frequencies of 3,431, 2,919, 2,854, 1,624, 1,539, and 1,399 cm−1 (Figure 8).

Figure 8 FTIR spectrum of the synthesized silver nanoparticles.
Figure 8

FTIR spectrum of the synthesized silver nanoparticles.

3.4.4 Antibacterial activity

High antibacterial activity was shown against all Gram-positive and -negative bacteria, including sensitive and resistant species, at an MIC of 9.375 μg/mL (Figure 9). The output data were analyzed using a one-way ANOVA test that did not show a degree of significance among all bacterial strains in sensitivity to the synthesized AgNPs (Figure 10).

Figure 9 Microplate dilution was used to determine the MIC of the synthesized silver nanoparticles.
Figure 9

Microplate dilution was used to determine the MIC of the synthesized silver nanoparticles.

Figure 10 Mean plot of one-way MIC analysis of the synthesized silver nanoparticles.
Figure 10

Mean plot of one-way MIC analysis of the synthesized silver nanoparticles.

4 Discussion

4.1 Fungal isolation and identification

The results of the morphological features of A. solium resembled that was shown by Hodhod et al. [31], in which the conidia are characterized by their large size along with an apical appendage. However, this study showed Pycnidia 330–380 µm high, 210–245 µm in diameter, and Conidia 37.5–46 × 13–18 µm, which is slightly different from the previous study, which showed Pycnidia 320–400 μm high and Conidia with 35–50 × 12.5–20 μm (Hodhod et al. [31]). Phylogenetic analysis placed the isolated fungus as a member of the Pleosporales Incertae-sedis family and formed a sister taxon of A. solium Abdel-Wahab, Hodhod, Bahkali, and K.D. Hyde. Forming a well-supported clade in both LSU and SSU data sets (100/100 for ML/MP, respectively).

4.2 AgNP synthesis

A. solium has been tested for its ability to biosynthesize AgNPs through an extracellular synthesis pathway, which depends on fungal secretions of bioactive molecules and enzymes in surrounding media [32,33,34,35,36]. Visual observation of silver metal bioreduction was observed due to color exchange from opaque to dark brown, as a result of excitation of free electrons in nanoparticles (Mohd Yusof et al., 2020). The emergence of a significant peak at 425 nm via UV–vis spectroscopy reveals the presence of a surface plasmon resonance, demonstrating that the silver metal was reduced to less than 100 nm. The shift in absorbance value suggests that the nanoparticles created are of various forms and/or sizes [37]. The heat treatment trials of the extracellular broth showed no sign of nanoparticle production in contrast to normal conditions because of the inhibition of bioactive extracellular compounds responsible for the biosynthesis of nanoparticles.

4.3 Factors affecting AgNP production

Optimization reactions applied during this study work aimed to support better growth of fungi, as well as enhance better yields of different m-NP, in which the best conditions will be further recommended for small-scale production. The factorial experiment design included three factors (temperature, metal salt concentration [mM], and pH) with three levels for each factor was carried out not only to study each factor as an individual parameter but also to observe the interaction between various factors combinations that will give the highest yield. Nanoparticle synthesis and the absorbance were applied as response variables [28].

4.4 Effect of temperature

The results of temperature optimization revealed that it plays a key role in metal reduction, where the optimal temperature was 30°C with the maximum synthesis of AgNP, which remained stable for a longer period of time indicated a stabilized synthesis. The optimization reaction witnessed that manglicolous fungi favor medium heat temperatures of 30°C, which reflects the temperature of their original habitats, as marine environment from which it has been isolated the water temperature at the intertidal zone ranges from 25°C at night till 35°C in a day [38]. Unlike its terrestrial counterparts, which favor high temperatures, which can reach 80°C, as high degrees increase its kinetic energy and lead to a faster synthesis rate of metal biosynthesis rate for these species [39].

In general, the temperature of the reaction plays an important role in the characteristics and yield (%) of nanoparticles [40] and, furthermore, Lee et al. [41] reported that there is a significant association between the temperature and the time required for nanoparticle biosynthesis. The present findings correspond exactly to those reported in previous works on the role of temperature in the biosynthesis of nanoparticles.

4.5 Effect of metal salt concentration (mM)

The results of this study perfectly with several other studies which have shown that nanoparticles biosynthesis rate of nanoparticles increases with the metal salt concentration. Examples of these studies include the use of Penicillium sp. in AgNP biosynthesis, the maximum production rate was reached when the concentration of metal salt concentration was elevated from 0.2 to 2 mM [42]. Sclerotinia sclerotiorum, a plant pathogenic fungus, also registered the highest yield in an optimization reaction study for AgNP synthesis, when yield production increased along with metal concentration [29]. AgNPs produced by F. oxysporum in another study have also shown that its production rates increased with the addition of different concentrations of metal salts, starting from 1 up to 10 mM [43]. All of the above studies along with the current one revealed that metal salt concentration plays a key role in m-NP synthesis. The rate of bioreduction is directly proportional to the substrate concentration, as the reaction kinetics and morphology of the produced nanoparticle were directly affected by the concentration of the precursor solution (i.e., AgNO3) [44,45,46].

4.6 Effect of pH

The results of the experiment help indicate that marine and coastal waters have relatively stable pH value within a small range from 7.6 to 8.3 (i.e., alkaline). Therefore, manglicolous fungi were in favor of pH levels giving higher yield within alkaline media [47]. The study showed that pH is one of the key factors in the synthesis of different nanoparticles, since color formation was rapid at alkaline pH (7 and 9) compared to acidic pH [3]. Many studies confirmed the same result, including the optimization work made by [48]. Their work focused on the use of F. oxysporum in the biosynthesis of AgNPs; the results of this research showed that alkaline medium is more suitable for the synthesis of silver nitrate than low acidic pH, since the reduction rate of silver ions was higher at pH 8. Other fungal species showed the same results including P. aeruginosa, S. sclerotiorum, and Trichoderma viride; the results of all these studies revealed that alkaline pH is an essential factor that affects AgNP production, as high pH favors complete reduction of Ag+ into AgNP by providing electrons [29,49].

4.7 Optimization of AgNP synthesis

Optimization work was carried out to support better fungal growth and to improve the yield of different m-NP. Metal biosynthesis conditions, including metal concentration, pH, and temperature, were optimized throughout multiple trials. Maximum yield production was reached at conditions of (pH = 7, temperature = 30°C, and metal salt concentration [mM] = 1.5). The optimization work results correlate with many studies in regard to metal salts, as maximum production was obtained for AgNPs synthesized by A. solium with an increasing metal concentration. The same results were observed with S. sclerotiorum MTCC 8785, which was subjected to different concentrations of silver metal salts starting from 0.2 to 2 mM, the results of this study provided evidence that the increase in concentration up to 2 mM resulted in a complete reduction [29]. Similar observations have been reported with the results of Singh et al. [42] results, which showed maximum AgNP synthesis at 2 mM AgNO3 concentration using Penicillium species. The pH conditions showed similar observations during the optimization process, as A. solium favored medium to basic pH (7 and 9) for stable metal bioreduction, which is correlated with other reported studies, including that in the case of P. aeruginosa [50] and T. viride [49], the results of both studies revealed that stable m-NP and their complete reduction occur in medium to basic medium, in which electrons are provided to mediate the reaction. However, the temperature conditions showed irrelevant results, since maximum production was obtained at a medium temperature of (30°C). Many studies have reported maximum biosynthesis at elevated temperatures, such as that conducted by Saxena et al. [29] who evaluated the effect of temperature on AgNP production by S. sclerotiorum, as reactions were incubated at different temperatures from 20 to 80°C with a difference of 20°C and then monitored for AgNPs synthesis. The results of that study observed the maximum synthesis of AgNP at 80°C, which remained stable for a long period. In another case study, high temperature was found to impart increased kinetic energy and lead to a faster synthesis rate [39]. The results of the current study showed stable and maximum production at normal temperature, thus an advantageous condition resulting in cost-effective production. The minimum production of yield was observed under the conditions (pH = 3, temperature = 40°C and metal salt concentration [mM] = 0.5). These results resemble those observed by many studies [29,39,49].

Optimization outcome results recommend the utilization of manglicolous fungi for nanoparticles production because of many advantageous characteristics and potentials possessed by this fascinating group of fungi, including ease in maintaining, control, and containment. A. solium showed a fast-growing and producing nanofactory, which reflects its ability to accumulate massive amounts of metals. Furthermore, the medium was easily filtered to obtain cell-free filtration (CFF), making the entire process very easy; this will be more cost-effective on the industrial scale [9].

4.8 Characterization of AgNPs

XRD of AgNPs peaks reflected on the characteristic FCC silver lines indexed as (2.832), (1.987), (1.280), and (1.248) that were observed in these samples at diffraction angles of 32.6°, 46.1°, 74.7°, and 77.6°, respectively. The AgNPs calculated by XRD data had a mean size of 20 nm. The acquired AgNP data fitted the database of Joint Committee on Powder Diffraction Standards (JCPDS) file No. 04-0783 completely [51]. The TEM data revealed only a spherical shape with an average size of 12 nm, indicating that A. solium has silver reduction potentials. Both XRD and TEM data agreed exactly, validating the features and properties [52,53].

The apparent existence of proteins surrounding and encapsulating produced AgNPs was verified by FTIR analysis, which acts as a reducing and stabilizing agent throughout the biosynthesis process [29,54]. The findings of the AgNP characterization were consistent with those of other research. The absorbance of AgNPs was detected at 380, 400, 413, 425, and 430 nm, which was within the range of previously reported data [29,55,56,57]. The variation in absorbance value suggests that the generated nanoparticles are of various forms and/or sizes [37].

The XRD results of the AgNP data obtained were perfectly matched with the database of JCPDS file No. 04-0783 [51]; this was further documented in other studies at kind of different angles (Mechouche [55,58]). The TEM results for AgNP from A. solium appeared with only spherical shape and an average size of 12 nm, which was not comparable to many studies related to fungi due to its small size but more similar to nanoparticles synthesized by plants, such as those observed in Lantana camara, which reduced the silver metal salt to 14 nm [56]. FTIR examination verified the existence of proteins surrounding and coating the produced AgNPs, which is consistent with the findings of much other research [54,55].

4.9 Antibacterial activity

In the current study, AgNPs synthesized by A. solium showed very promising wide-range activity results, reflecting its great potentials, and high antibacterial activity was shown against all Gram-positive and -negative bacteria, including sensitive and resistant species at a concentration of 9.375 μg/mL. The results demonstrated that the produced m-NP played a critical role in inflicting significant damage to bacterial cells, with the tiny AgNPs (i.e., 12 nm) demonstrating superior antibacterial activity. The increased surface area of Ag+ small particles resulted in better surface contact with bacteria and, thus, a higher bactericidal action [35,59,60].

Ag+ ions are thought to form an electrical interaction with the bacterial outer surface, and upon contact, the bacterial cells are quickly oxidized and destroyed. This occurs given that AgNPs unleash their ions, which react directly with the thiol (–SH) group of proteins in the bacterial cell and protrude across the cell membrane. As a result, inhibiting membrane permeability causes bacterial cell death [61].

Finally, the results of this study recommend the application of AgNPs synthesized by A. solium in the pharmaceutical industry. Furthermore, the demonstration of the produced nanoparticles against other pathogenic bacteria alone or with antibiotics [62], to observe any other activities.

5 Conclusion

The cost-effective green synthesis of stable AgNPs through the utilization of marine fungi as a new biological resource showed great potential during the current study. Culture extract of A. solium used herein as a reducing agent in the nanoparticle synthesis process; optimization work to obtain better fungal growth revealed its effectiveness; thus, it could be scaled up for commercial production on an industrial level due to promising criteria that showed of time savings, low cost, and also a nonhazardous effect on the environment. The characterization of the size and shape was carried out via XRD and TEM, which proved to be valuable tools to demonstrate the small-sized 12 nm, which possesses a spherical shape structure. FTIR analysis revealed that the proteins surrounding the synthesized AgNPs play a crucial role in stabilizing them during the biosynthesis process. The nanoparticles produced were confirmed to have promising antibacterial activity and hence could be implemented in various biomedical approaches. Finally, other locations and other substrates should be investigated for marine fungi to be utilized in different biotechnological applications.

tel: +966-540329167

# Both Mohamed S. Hodhod, Abdel-Rhman Z. Gaafar are considered as first co-authors.

Acknowledgements

The authors extend their appreciation to the Researchers Supporting Project number RSPD2024R686, King Saud University, Riyadh, Saudi Arabia.

  1. Funding information: The research was financially supported by Researchers Supporting Project number RSPD2024R686, King Saud University, Riyadh, Saudi Arabia.

  2. Author contributions: All authors contributed to the preparation of the manuscript and discussion.

  3. Conflict of interest: On behalf of all authors, the corresponding author states that there is no conflict of interest.

  4. Ethical approval: The conducted research is not related to either human or animal use.

  5. Data availability statement: Derived data supporting the findings of this study are available from the corresponding author on request.

References

[1] Basak S, Singh P, Rajurkar M. Multidrug resistant and extensively drug resistant bacteria: a study. J Pathog. 2016;2016:4065603.10.1155/2016/4065603Search in Google Scholar PubMed PubMed Central

[2] Hall W, McDonnell A, O’Neill J. Superbugs: An arms race against bacteria. Cambridge, Massachusetts, United States: Harvard University Press; 2018.10.4159/9780674985094Search in Google Scholar

[3] van den Brink R. The end of an antibiotic era. New York, NY, USA: Springer; 2021 p. 15–45.10.1007/978-3-030-70723-1_2Search in Google Scholar

[4] Wang L, Hu C, Shao L. The antimicrobial activity of nanoparticles: present situation and prospects for the future. Int J Nanomed. 2017;12:1227–49.10.2147/IJN.S121956Search in Google Scholar PubMed PubMed Central

[5] Nachiyar V, Sunkar S, Prakash P. Biological synthesis of gold nanoparticles using endophytic fungi. Der Pharma Chem. 2015;7(11):31–8.Search in Google Scholar

[6] Ottoni CA, Simões MF, Fernandes S, Dos Santos JG, Da Silva ES, de Souza RFB, et al. Screening of filamentous fungi for antimicrobial silver nanoparticles synthesis. AMB Express. 2017;7(1):31.10.1186/s13568-017-0332-2Search in Google Scholar PubMed PubMed Central

[7] Shende S, Ingle AP, Gade A, Rai M. Green synthesis of copper nanoparticles by Citrus medica Linn.(Idilimbu) juice and its antimicrobial activity. World J Microbiol Biotechnol. 2015;31(6):865–73.10.1007/s11274-015-1840-3Search in Google Scholar PubMed

[8] Mandal D, Bolander ME, Mukhopadhyay D, Sarkar G, Mukherjee P. The use of microorganisms for the formation of metal nanoparticles and their application. Appl microbiol Biotechnol. 2006;69(5):485–92.10.1007/s00253-005-0179-3Search in Google Scholar PubMed

[9] Rahimi G, Alizadeh F, Khodavandi A. Mycosynthesis of silver nanoparticles from Candida albicans and its antibacterial activity against Escherichia coli and Staphylococcus aureus. Trop J Pharm Res. 2016;15(2):371–5.10.4314/tjpr.v15i2.21Search in Google Scholar

[10] Lekha DC, Shanmugam R, Madhuri K, Dwarampudi LP, Bhaskaran M, Kongara D, et al. Review on silver nanoparticle synthesis method, antibacterial activity, drug delivery vehicles, and toxicity pathways: recent advances and future aspects. J Nanomater. 2021;2021:1–11.10.1155/2021/4401829Search in Google Scholar

[11] Devika R, Elumalai S, Manikandan E, Eswaramoorthy D. Biosynthesis of silver nanoparticles using the fungus Pleurotus ostreatus and their antibacterial activity. Open Access Sci Rep. 2012;1:557.Search in Google Scholar

[12] Akter S, Huq MA. Biologically rapid synthesis of silver nanoparticles by Sphingobium sp. MAH-11T and their antibacterial activity and mechanisms investigation against drug-resistant pathogenic microbes. Artif Cells Nanomed Biotechnol. 2020;48(1):672–82.10.1080/21691401.2020.1730390Search in Google Scholar PubMed

[13] Hamouda RA, Hussein MH, Abo-Elmagd RA, Bawazir SS. Synthesis and biological characterization of silver nanoparticles derived from the cyanobacterium Oscillatoria limnetica. Sci Rep. 2019;9(1):13071.10.1038/s41598-019-49444-ySearch in Google Scholar PubMed PubMed Central

[14] Huq MA. Green synthesis of silver nanoparticles using Pseudoduganella eburnea MAHUQ-39 and their antimicrobial mechanisms investigation against drug resistant human pathogens. Int J Mol Sci. 2020;21(4):1510.10.3390/ijms21041510Search in Google Scholar PubMed PubMed Central

[15] Rafique M, Sadaf I, Rafique MS, Tahir MB. A review on green synthesis of silver nanoparticles and their applications. Artif Cells Nanomed Biotechnol. 2017;45(7):1272–91.10.1080/21691401.2016.1241792Search in Google Scholar PubMed

[16] Salem SS, Fouda A. Green synthesis of metallic nanoparticles and their prospective biotechnological applications: an overview. Biol Trace Elem Res. 2021;199:344–70.10.1007/s12011-020-02138-3Search in Google Scholar PubMed

[17] Jones EG. Marine fungi: some factors influencing biodiversity. Fungal Diversity. 2000;4(193):53–73.Search in Google Scholar

[18] Thatoi H, Behera BC, Mishra RR, Dutta SK. Biodiversity and biotechnological potential of microorganisms from mangrove ecosystems: a review. Ann Microbiol. 2013;63(1):1–19.10.1007/s13213-012-0442-7Search in Google Scholar

[19] Jones EG, Suetrong S, Sakayaroj J, Bahkali AH, Abdel-Wahab MA, Boekhout T, et al. Classification of marine ascomycota, basidiomycota, blastocladiomycota and chytridiomycota. Fungal Diversity. 2015;73(1):1–72.10.1007/s13225-015-0339-4Search in Google Scholar

[20] Abdel-Wahab MA, Bahkali AH, Jones EG, Elgorban AM, Abdel-Aziz FA, Hodhod MS, et al. Two new species of Kallichroma (Bionectriaceae, Hypocreales) from Saudi Arabian mangroves. Phytotaxa. 2016;260(1):66–74.10.11646/phytotaxa.260.1.7Search in Google Scholar

[21] Vilgalys R, Hester M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J Bacteriol. 1990;172(8):4238–46.10.1128/jb.172.8.4238-4246.1990Search in Google Scholar PubMed PubMed Central

[22] White T. Analysis of phylogenetic relationships by amplification and direct sequencing of ribosomal genes. PCR Protocols: A Guide Methods Appl. 1990;315–22.10.1016/B978-0-12-372180-8.50042-1Search in Google Scholar

[23] Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25(24):4876–82.10.1093/nar/25.24.4876Search in Google Scholar PubMed PubMed Central

[24] Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35(6):1547.10.1093/molbev/msy096Search in Google Scholar PubMed PubMed Central

[25] Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. 1985;39(4):783–91.10.1111/j.1558-5646.1985.tb00420.xSearch in Google Scholar PubMed

[26] Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evolution. 1993;10(3):512–26.Search in Google Scholar

[27] Das VL, Thomas R, Varghese RT, Soniya E, Mathew J, Radhakrishnan E. Extracellular synthesis of silver nanoparticles by the Bacillus strain CS 11 isolated from industrialized area. 3 Biotech. 2014;4(2):121–6.10.1007/s13205-013-0130-8Search in Google Scholar PubMed PubMed Central

[28] Saha N, Gupta SD. Biogenic synthesis and structural characterization of polyshaped gold nanoparticles using leaf extract of Swertia chirata along with process optimization by response surface methodology (RSM). J Clust Sci. 2016;27(4):1419–37.10.1007/s10876-016-1009-8Search in Google Scholar

[29] Saxena J, Sharma PK, Sharma MM, Singh A. Process optimization for green synthesis of silver nanoparticles by Sclerotinia sclerotiorum MTCC 8785 and evaluation of its antibacterial properties. SpringerPlus. 2016;5(1):861.10.1186/s40064-016-2558-xSearch in Google Scholar PubMed PubMed Central

[30] Cullity BD. Elements of X-ray diffraction. Addison. Wesley Mass; 1978.Search in Google Scholar

[31] Hodhod MS, Abdel-Wahab MA, Bahkali AH, Hyde KD. Amarenographium solium sp. nov. from Yanbu mangroves in the Kingdom of Saudi Arabia. Cryptogam Mycol. 2012;33(3):285–94.10.7872/crym.v33.iss3.2012.285Search in Google Scholar

[32] Durán N, Marcato PD, Durán M, Yadav A, Gade A, Rai M. Mechanistic aspects in the biogenic synthesis of extracellular metal nanoparticles by peptides, bacteria, fungi, and plants. Appl Microbiol Biotechnol. 2011;90(5):1609–24.10.1007/s00253-011-3249-8Search in Google Scholar PubMed

[33] Li X, Xu H, Chen Z-S, Chen G. Biosynthesis of nanoparticles by microorganisms and their applications. J Nanomater. 2011;2011:270974.10.1155/2011/270974Search in Google Scholar

[34] Mohanpuria P, Rana NK, Yadav SK. Biosynthesis of nanoparticles: technological concepts and future applications. J Nanopart Res. 2008;10(3):507–17.10.1007/s11051-007-9275-xSearch in Google Scholar

[35] Prabhu S, Poulose EK. Silver nanoparticles: mechanism of antimicrobial action, synthesis, medical applications, and toxicity effects. Int Nano Lett. 2012;2(1):32.10.1186/2228-5326-2-32Search in Google Scholar

[36] Sathiyanarayanan G, Dineshkumar K, Yang Y-H. Microbial exopolysaccharide-mediated synthesis and stabilization of metal nanoparticles. Crit Rev Microbiology. 2017;43(6):731–52.10.1080/1040841X.2017.1306689Search in Google Scholar PubMed

[37] Desai R, Mankad V, Gupta SK, Jha PK. Size distribution of silver nanoparticles: UV-visible spectroscopic assessment. Nanosci Nanotechnol Lett. 2012;4(1):30–4.10.1166/nnl.2012.1278Search in Google Scholar

[38] El-Sharouny H, Raheem A, Abdel-Wahab M. Manglicolous fungi of the red sea in upper Egypt. Microbiol Res. 1998;153(1):81–96.10.1016/S0944-5013(98)80025-6Search in Google Scholar

[39] Birla SS, Gaikwad SC, Gade AK, Rai MK. Rapid synthesis of silver nanoparticles from Fusarium oxysporum by optimizing physicocultural conditions. Sci World J. 2013;2013:796018.10.1155/2013/796018Search in Google Scholar PubMed PubMed Central

[40] Jiang X, Chen W, Chen C, Xiong S, Yu A. Role of temperature in the growth of silver nanoparticles through a synergetic reduction approach. Nanoscale Res Lett. 2011;6(1):32.10.1007/s11671-010-9780-1Search in Google Scholar PubMed PubMed Central

[41] Lee S-W, Chang S-H, Lai Y-S, Lin C-C, Tsai C-M, Lee Y-C, et al. Effect of temperature on the growth of silver nanoparticles using plasmon-mediated method under the irradiation of green LEDs. Materials. 2014;7(12):7781–98.10.3390/ma7127781Search in Google Scholar PubMed PubMed Central

[42] Singh P, Kim Y-J, Zhang D, Yang D-C. Biological synthesis of nanoparticles from plants and microorganisms. Trends Biotechnol. 2016;34(7):588–99.10.1016/j.tibtech.2016.02.006Search in Google Scholar PubMed

[43] Korbekandi H, Ashari Z, Iravani S, Abbasi S. Optimization of biological synthesis of silver nanoparticles using Fusarium oxysporum. Iran J Pharm Res: IJPR. 2013;12(3):289.Search in Google Scholar

[44] Christensen L, Vivekanandhan S, Misra M, Mohanty AK. Biosynthesis of silver nanoparticles using murraya koenigii (curry leaf): an investigation on the effect of broth concentration in reduction mechanism and particle size. Adv Mater Lett. 2011;2(6):429–34.10.5185/amlett.2011.4256Search in Google Scholar

[45] Khan M, Khan M, Adil SF, Tahir MN, Tremel W, Alkhathlan HZ, et al. Green synthesis of silver nanoparticles mediated by Pulicaria glutinosa extract. Int J Nanomed. 2013;8:1507.10.2147/IJN.S43309Search in Google Scholar PubMed PubMed Central

[46] Singh AK, Talat M, Singh D, Srivastava O. Biosynthesis of gold and silver nanoparticles by natural precursor clove and their functionalization with amine group. J Nanopart Res. 2010;12(5):1667–75.10.1007/s11051-009-9835-3Search in Google Scholar

[47] Brotowidjoyo MD, Tribawono D, Mulbyantoro E. Introduction to water environmental and aquaculture. Yogyakarta, Indonesia: Publisher Liberty; 1995. Search in Google Scholar

[48] Khan N, Jamme J. Optimization of reaction parameters for silver nanoparticles synthesis from Fusarium Oxysporum and determination of silver nanoparticles concentration. J Mater Sci Eng. 2016;5(283):2169-0022.1000283.Search in Google Scholar

[49] Chitra K, Annadurai G. Bioengineered silver nanobowls using Trichoderma viride and its antibacterial activity against gram-positive and gram-negative bacteria. J Nanostruct Chem. 2013;3(1):9.10.1186/2193-8865-3-9Search in Google Scholar

[50] Mohammadinia M, Rahmani S, Eslami G, Ghassemi-Broumand M, Amiri MA, Aghaie G, et al. Contact lens disinfecting solutions antibacterial efficacy: comparison between clinical isolates and the standard ISO ATCC strains of Pseudomonas aeruginosa and Staphylococcus aureus. Eye. 2012;26(2):327.10.1038/eye.2011.284Search in Google Scholar PubMed PubMed Central

[51] Krishnaraj C, Ramachandran R, Mohan K, Kalaichelvan P. Optimization for rapid synthesis of silver nanoparticles and its effect on phytopathogenic fungi. Spectrochim Acta Part A: Mol Biomol Spectrosc. 2012;93:95–9.10.1016/j.saa.2012.03.002Search in Google Scholar PubMed

[52] Chicea D, Indrea E, Cretu C. Assesing Fe3O4 nanoparticle size by DLS, XRD and AFM. J Optoelectron Adv Mater. 2012;14(5):460.Search in Google Scholar

[53] Hu C, Zhang Z, Liu H, Gao P, Wang ZL. Direct synthesis and structure characterization of ultrafine CeO2 nanoparticles. Nanotechnology. 2006;17(24):5983.10.1088/0957-4484/17/24/013Search in Google Scholar

[54] Daima HK, Selvakannan P, Shukla R, Bhargava SK, Bansal V. Fine-tuning the antimicrobial profile of biocompatible gold nanoparticles by sequential surface functionalization using polyoxometalates and lysine. PLoS one. 2013;8(10):e79676.10.1371/journal.pone.0079676Search in Google Scholar PubMed PubMed Central

[55] Abdel-Hadi AM, Awad MF, Abo-Dahab NF, ElKady MF. Extracellular synthesis of silver nanoparticles by Aspergillus terreus: biosynthesis, characterization and biological activity. Biosci Biotechnol Res Asia. 2014;11(3):1179–86.10.13005/bbra/1503Search in Google Scholar

[56] Ajitha B, Reddy YAK, Reddy PS. Green synthesis and characterization of silver nanoparticles using Lantana camara leaf extract. Mater Sci Eng: C. 2015;49:373–81.10.1016/j.msec.2015.01.035Search in Google Scholar PubMed

[57] Aromal SA, Philip D. Green synthesis of gold nanoparticles using Trigonella foenum-graecum and its size-dependent catalytic activity. Spectrochim Acta Part A: Mol Biomol Spectrosc. 2012;97:1–5.10.1016/j.saa.2012.05.083Search in Google Scholar PubMed

[58] Zayed MF, Eisa WH. Phoenix dactylifera L. leaf extract phytosynthesized gold nanoparticles; controlled synthesis and catalytic activity. Spectrochim Acta Part A: Mol Biomol Spectrosc. 2014;121:238–44.10.1016/j.saa.2013.10.092Search in Google Scholar PubMed

[59] Cho K-H, Park J-E, Osaka T, Park S-G. The study of antimicrobial activity and preservative effects of nanosilver ingredient. Electrochim Acta. 2005;51(5):956–60.10.1016/j.electacta.2005.04.071Search in Google Scholar

[60] Panyala NR, Peña-Méndez EM, Havel J. Silver or silver nanoparticles: a hazardous threat to the environment and human health? J Appl Biomed. 2008;6(3):117–29.10.32725/jab.2008.015Search in Google Scholar

[61] Zhang H, Chen G. Potent antibacterial activities of Ag/TiO2 nanocomposite powders synthesized by a one-pot sol−gel method. Environ Sci Technol. 2009;43(8):2905–10.10.1021/es803450fSearch in Google Scholar PubMed

[62] Ganie MA, Khurana ML, Nisar S, Shah PA, Shah ZA, Kulshrestha B, et al. Improved efficacy of low-dose spironolactone and metformin combination than either drug alone in the management of women with polycystic ovary syndrome (PCOS): a six-month, open-label randomized study. J Clin Endocrinol Metab. 2013;98(9):3599–607.10.1210/jc.2013-1040Search in Google Scholar PubMed

Received: 2023-09-19
Revised: 2023-11-29
Accepted: 2023-12-02
Published Online: 2024-02-12

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Regular Articles
  2. Porous silicon nanostructures: Synthesis, characterization, and their antifungal activity
  3. Biochar from de-oiled Chlorella vulgaris and its adsorption on antibiotics
  4. Phytochemicals profiling, in vitro and in vivo antidiabetic activity, and in silico studies on Ajuga iva (L.) Schreb.: A comprehensive approach
  5. Synthesis, characterization, in silico and in vitro studies of novel glycoconjugates as potential antibacterial, antifungal, and antileishmanial agents
  6. Sonochemical synthesis of gold nanoparticles mediated by potato starch: Its performance in the treatment of esophageal cancer
  7. Computational study of ADME-Tox prediction of selected phytochemicals from Punica granatum peels
  8. Phytochemical analysis, in vitro antioxidant and antifungal activities of extracts and essential oil derived from Artemisia herba-alba Asso
  9. Two triazole-based coordination polymers: Synthesis and crystal structure characterization
  10. Phytochemical and physicochemical studies of different apple varieties grown in Morocco
  11. Synthesis of multi-template molecularly imprinted polymers (MT-MIPs) for isolating ethyl para-methoxycinnamate and ethyl cinnamate from Kaempferia galanga L., extract with methacrylic acid as functional monomer
  12. Nutraceutical potential of Mesembryanthemum forsskaolii Hochst. ex Bioss.: Insights into its nutritional composition, phytochemical contents, and antioxidant activity
  13. Evaluation of influence of Butea monosperma floral extract on inflammatory biomarkers
  14. Cannabis sativa L. essential oil: Chemical composition, anti-oxidant, anti-microbial properties, and acute toxicity: In vitro, in vivo, and in silico study
  15. The effect of gamma radiation on 5-hydroxymethylfurfural conversion in water and dimethyl sulfoxide
  16. Hollow mushroom nanomaterials for potentiometric sensing of Pb2+ ions in water via the intercalation of iodide ions into the polypyrrole matrix
  17. Determination of essential oil and chemical composition of St. John’s Wort
  18. Computational design and in vitro assay of lantadene-based novel inhibitors of NS3 protease of dengue virus
  19. Anti-parasitic activity and computational studies on a novel labdane diterpene from the roots of Vachellia nilotica
  20. Microbial dynamics and dehydrogenase activity in tomato (Lycopersicon esculentum Mill.) rhizospheres: Impacts on growth and soil health across different soil types
  21. Correlation between in vitro anti-urease activity and in silico molecular modeling approach of novel imidazopyridine–oxadiazole hybrids derivatives
  22. Spatial mapping of indoor air quality in a light metro system using the geographic information system method
  23. Iron indices and hemogram in renal anemia and the improvement with Tribulus terrestris green-formulated silver nanoparticles applied on rat model
  24. Integrated track of nano-informatics coupling with the enrichment concept in developing a novel nanoparticle targeting ERK protein in Naegleria fowleri
  25. Cytotoxic and phytochemical screening of Solanum lycopersicum–Daucus carota hydro-ethanolic extract and in silico evaluation of its lycopene content as anticancer agent
  26. Protective activities of silver nanoparticles containing Panax japonicus on apoptotic, inflammatory, and oxidative alterations in isoproterenol-induced cardiotoxicity
  27. pH-based colorimetric detection of monofunctional aldehydes in liquid and gas phases
  28. Investigating the effect of resveratrol on apoptosis and regulation of gene expression of Caco-2 cells: Unravelling potential implications for colorectal cancer treatment
  29. Metformin inhibits knee osteoarthritis induced by type 2 diabetes mellitus in rats: S100A8/9 and S100A12 as players and therapeutic targets
  30. Effect of silver nanoparticles formulated by Silybum marianum on menopausal urinary incontinence in ovariectomized rats
  31. Synthesis of new analogs of N-substituted(benzoylamino)-1,2,3,6-tetrahydropyridines
  32. Response of yield and quality of Japonica rice to different gradients of moisture deficit at grain-filling stage in cold regions
  33. Preparation of an inclusion complex of nickel-based β-cyclodextrin: Characterization and accelerating the osteoarthritis articular cartilage repair
  34. Empagliflozin-loaded nanomicelles responsive to reactive oxygen species for renal ischemia/reperfusion injury protection
  35. Preparation and pharmacodynamic evaluation of sodium aescinate solid lipid nanoparticles
  36. Assessment of potentially toxic elements and health risks of agricultural soil in Southwest Riyadh, Saudi Arabia
  37. Theoretical investigation of hydrogen-rich fuel production through ammonia decomposition
  38. Biosynthesis and screening of cobalt nanoparticles using citrus species for antimicrobial activity
  39. Investigating the interplay of genetic variations, MCP-1 polymorphism, and docking with phytochemical inhibitors for combatting dengue virus pathogenicity through in silico analysis
  40. Ultrasound induced biosynthesis of silver nanoparticles embedded into chitosan polymers: Investigation of its anti-cutaneous squamous cell carcinoma effects
  41. Copper oxide nanoparticles-mediated Heliotropium bacciferum leaf extract: Antifungal activity and molecular docking assays against strawberry pathogens
  42. Sprouted wheat flour for improving physical, chemical, rheological, microbial load, and quality properties of fino bread
  43. Comparative toxicity assessment of fisetin-aided artificial intelligence-assisted drug design targeting epibulbar dermoid through phytochemicals
  44. Acute toxicity and anti-inflammatory activity of bis-thiourea derivatives
  45. Anti-diabetic activity-guided isolation of α-amylase and α-glucosidase inhibitory terpenes from Capsella bursa-pastoris Linn.
  46. GC–MS analysis of Lactobacillus plantarum YW11 metabolites and its computational analysis on familial pulmonary fibrosis hub genes
  47. Green formulation of copper nanoparticles by Pistacia khinjuk leaf aqueous extract: Introducing a novel chemotherapeutic drug for the treatment of prostate cancer
  48. Improved photocatalytic properties of WO3 nanoparticles for Malachite green dye degradation under visible light irradiation: An effect of La doping
  49. One-pot synthesis of a network of Mn2O3–MnO2–poly(m-methylaniline) composite nanorods on a polypyrrole film presents a promising and efficient optoelectronic and solar cell device
  50. Groundwater quality and health risk assessment of nitrate and fluoride in Al Qaseem area, Saudi Arabia
  51. A comparative study of the antifungal efficacy and phytochemical composition of date palm leaflet extracts
  52. Processing of alcohol pomelo beverage (Citrus grandis (L.) Osbeck) using saccharomyces yeast: Optimization, physicochemical quality, and sensory characteristics
  53. Specialized compounds of four Cameroonian spices: Isolation, characterization, and in silico evaluation as prospective SARS-CoV-2 inhibitors
  54. Identification of a novel drug target in Porphyromonas gingivalis by a computational genome analysis approach
  55. Physico-chemical properties and durability of a fly-ash-based geopolymer
  56. FMS-like tyrosine kinase 3 inhibitory potentials of some phytochemicals from anti-leukemic plants using computational chemical methodologies
  57. Wild Thymus zygis L. ssp. gracilis and Eucalyptus camaldulensis Dehnh.: Chemical composition, antioxidant and antibacterial activities of essential oils
  58. 3D-QSAR, molecular docking, ADMET, simulation dynamic, and retrosynthesis studies on new styrylquinolines derivatives against breast cancer
  59. Deciphering the influenza neuraminidase inhibitory potential of naturally occurring biflavonoids: An in silico approach
  60. Determination of heavy elements in agricultural regions, Saudi Arabia
  61. Synthesis and characterization of antioxidant-enriched Moringa oil-based edible oleogel
  62. Ameliorative effects of thistle and thyme honeys on cyclophosphamide-induced toxicity in mice
  63. Study of phytochemical compound and antipyretic activity of Chenopodium ambrosioides L. fractions
  64. Investigating the adsorption mechanism of zinc chloride-modified porous carbon for sulfadiazine removal from water
  65. Performance repair of building materials using alumina and silica composite nanomaterials with electrodynamic properties
  66. Effects of nanoparticles on the activity and resistance genes of anaerobic digestion enzymes in livestock and poultry manure containing the antibiotic tetracycline
  67. Effect of copper nanoparticles green-synthesized using Ocimum basilicum against Pseudomonas aeruginosa in mice lung infection model
  68. Cardioprotective effects of nanoparticles green formulated by Spinacia oleracea extract on isoproterenol-induced myocardial infarction in mice by the determination of PPAR-γ/NF-κB pathway
  69. Anti-OTC antibody-conjugated fluorescent magnetic/silica and fluorescent hybrid silica nanoparticles for oxytetracycline detection
  70. Curcumin conjugated zinc nanoparticles for the treatment of myocardial infarction
  71. Identification and in silico screening of natural phloroglucinols as potential PI3Kα inhibitors: A computational approach for drug discovery
  72. Exploring the phytochemical profile and antioxidant evaluation: Molecular docking and ADMET analysis of main compounds from three Solanum species in Saudi Arabia
  73. Unveiling the molecular composition and biological properties of essential oil derived from the leaves of wild Mentha aquatica L.: A comprehensive in vitro and in silico exploration
  74. Analysis of bioactive compounds present in Boerhavia elegans seeds by GC-MS
  75. Homology modeling and molecular docking study of corticotrophin-releasing hormone: An approach to treat stress-related diseases
  76. LncRNA MIR17HG alleviates heart failure via targeting MIR17HG/miR-153-3p/SIRT1 axis in in vitro model
  77. Development and validation of a stability indicating UPLC-DAD method coupled with MS-TQD for ramipril and thymoquinone in bioactive SNEDDS with in silico toxicity analysis of ramipril degradation products
  78. Biosynthesis of Ag/Cu nanocomposite mediated by Curcuma longa: Evaluation of its antibacterial properties against oral pathogens
  79. Development of AMBER-compliant transferable force field parameters for polytetrafluoroethylene
  80. Treatment of gestational diabetes by Acroptilon repens leaf aqueous extract green-formulated iron nanoparticles in rats
  81. Development and characterization of new ecological adsorbents based on cardoon wastes: Application to brilliant green adsorption
  82. A fast, sensitive, greener, and stability-indicating HPLC method for the standardization and quantitative determination of chlorhexidine acetate in commercial products
  83. Assessment of Se, As, Cd, Cr, Hg, and Pb content status in Ankang tea plantations of China
  84. Effect of transition metal chloride (ZnCl2) on low-temperature pyrolysis of high ash bituminous coal
  85. Evaluating polyphenol and ascorbic acid contents, tannin removal ability, and physical properties during hydrolysis and convective hot-air drying of cashew apple powder
  86. Development and characterization of functional low-fat frozen dairy dessert enhanced with dried lemongrass powder
  87. Scrutinizing the effect of additive and synergistic antibiotics against carbapenem-resistant Pseudomonas aeruginosa
  88. Preparation, characterization, and determination of the therapeutic effects of copper nanoparticles green-formulated by Pistacia atlantica in diabetes-induced cardiac dysfunction in rat
  89. Antioxidant and antidiabetic potentials of methoxy-substituted Schiff bases using in vitro, in vivo, and molecular simulation approaches
  90. Anti-melanoma cancer activity and chemical profile of the essential oil of Seseli yunnanense Franch
  91. Molecular docking analysis of subtilisin-like alkaline serine protease (SLASP) and laccase with natural biopolymers
  92. Overcoming methicillin resistance by methicillin-resistant Staphylococcus aureus: Computational evaluation of napthyridine and oxadiazoles compounds for potential dual inhibition of PBP-2a and FemA proteins
  93. Exploring novel antitubercular agents: Innovative design of 2,3-diaryl-quinoxalines targeting DprE1 for effective tuberculosis treatment
  94. Drimia maritima flowers as a source of biologically potent components: Optimization of bioactive compound extractions, isolation, UPLC–ESI–MS/MS, and pharmacological properties
  95. Estimating molecular properties, drug-likeness, cardiotoxic risk, liability profile, and molecular docking study to characterize binding process of key phyto-compounds against serotonin 5-HT2A receptor
  96. Fabrication of β-cyclodextrin-based microgels for enhancing solubility of Terbinafine: An in-vitro and in-vivo toxicological evaluation
  97. Phyto-mediated synthesis of ZnO nanoparticles and their sunlight-driven photocatalytic degradation of cationic and anionic dyes
  98. Monosodium glutamate induces hypothalamic–pituitary–adrenal axis hyperactivation, glucocorticoid receptors down-regulation, and systemic inflammatory response in young male rats: Impact on miR-155 and miR-218
  99. Quality control analyses of selected honey samples from Serbia based on their mineral and flavonoid profiles, and the invertase activity
  100. Eco-friendly synthesis of silver nanoparticles using Phyllanthus niruri leaf extract: Assessment of antimicrobial activity, effectiveness on tropical neglected mosquito vector control, and biocompatibility using a fibroblast cell line model
  101. Green synthesis of silver nanoparticles containing Cichorium intybus to treat the sepsis-induced DNA damage in the liver of Wistar albino rats
  102. Quality changes of durian pulp (Durio ziberhinus Murr.) in cold storage
  103. Study on recrystallization process of nitroguanidine by directly adding cold water to control temperature
  104. Determination of heavy metals and health risk assessment in drinking water in Bukayriyah City, Saudi Arabia
  105. Larvicidal properties of essential oils of three Artemisia species against the chemically insecticide-resistant Nile fever vector Culex pipiens (L.) (Diptera: Culicidae): In vitro and in silico studies
  106. Design, synthesis, characterization, and theoretical calculations, along with in silico and in vitro antimicrobial proprieties of new isoxazole-amide conjugates
  107. The impact of drying and extraction methods on total lipid, fatty acid profile, and cytotoxicity of Tenebrio molitor larvae
  108. A zinc oxide–tin oxide–nerolidol hybrid nanomaterial: Efficacy against esophageal squamous cell carcinoma
  109. Research on technological process for production of muskmelon juice (Cucumis melo L.)
  110. Physicochemical components, antioxidant activity, and predictive models for quality of soursop tea (Annona muricata L.) during heat pump drying
  111. Characterization and application of Fe1−xCoxFe2O4 nanoparticles in Direct Red 79 adsorption
  112. Torilis arvensis ethanolic extract: Phytochemical analysis, antifungal efficacy, and cytotoxicity properties
  113. Magnetite–poly-1H pyrrole dendritic nanocomposite seeded on poly-1H pyrrole: A promising photocathode for green hydrogen generation from sanitation water without using external sacrificing agent
  114. HPLC and GC–MS analyses of phytochemical compounds in Haloxylon salicornicum extract: Antibacterial and antifungal activity assessment of phytopathogens
  115. Efficient and stable to coking catalysts of ethanol steam reforming comprised of Ni + Ru loaded on MgAl2O4 + LnFe0.7Ni0.3O3 (Ln = La, Pr) nanocomposites prepared via cost-effective procedure with Pluronic P123 copolymer
  116. Nitrogen and boron co-doped carbon dots probe for selectively detecting Hg2+ in water samples and the detection mechanism
  117. Heavy metals in road dust from typical old industrial areas of Wuhan: Seasonal distribution and bioaccessibility-based health risk assessment
  118. Phytochemical profiling and bioactivity evaluation of CBD- and THC-enriched Cannabis sativa extracts: In vitro and in silico investigation of antioxidant and anti-inflammatory effects
  119. Investigating dye adsorption: The role of surface-modified montmorillonite nanoclay in kinetics, isotherms, and thermodynamics
  120. Antimicrobial activity, induction of ROS generation in HepG2 liver cancer cells, and chemical composition of Pterospermum heterophyllum
  121. Study on the performance of nanoparticle-modified PVDF membrane in delaying membrane aging
  122. Impact of cholesterol in encapsulated vitamin E acetate within cocoliposomes
  123. Review Articles
  124. Structural aspects of Pt(η3-X1N1X2)(PL) (X1,2 = O, C, or Se) and Pt(η3-N1N2X1)(PL) (X1 = C, S, or Se) derivatives
  125. Biosurfactants in biocorrosion and corrosion mitigation of metals: An overview
  126. Stimulus-responsive MOF–hydrogel composites: Classification, preparation, characterization, and their advancement in medical treatments
  127. Electrochemical dissolution of titanium under alternating current polarization to obtain its dioxide
  128. Special Issue on Recent Trends in Green Chemistry
  129. Phytochemical screening and antioxidant activity of Vitex agnus-castus L.
  130. Phytochemical study, antioxidant activity, and dermoprotective activity of Chenopodium ambrosioides (L.)
  131. Exploitation of mangliculous marine fungi, Amarenographium solium, for the green synthesis of silver nanoparticles and their activity against multiple drug-resistant bacteria
  132. Study of the phytotoxicity of margines on Pistia stratiotes L.
  133. Special Issue on Advanced Nanomaterials for Energy, Environmental and Biological Applications - Part III
  134. Impact of biogenic zinc oxide nanoparticles on growth, development, and antioxidant system of high protein content crop (Lablab purpureus L.) sweet
  135. Green synthesis, characterization, and application of iron and molybdenum nanoparticles and their composites for enhancing the growth of Solanum lycopersicum
  136. Green synthesis of silver nanoparticles from Olea europaea L. extracted polysaccharides, characterization, and its assessment as an antimicrobial agent against multiple pathogenic microbes
  137. Photocatalytic treatment of organic dyes using metal oxides and nanocomposites: A quantitative study
  138. Antifungal, antioxidant, and photocatalytic activities of greenly synthesized iron oxide nanoparticles
  139. Special Issue on Phytochemical and Pharmacological Scrutinization of Medicinal Plants
  140. Hepatoprotective effects of safranal on acetaminophen-induced hepatotoxicity in rats
  141. Chemical composition and biological properties of Thymus capitatus plants from Algerian high plains: A comparative and analytical study
  142. Chemical composition and bioactivities of the methanol root extracts of Saussurea costus
  143. In vivo protective effects of vitamin C against cyto-genotoxicity induced by Dysphania ambrosioides aqueous extract
  144. Insights about the deleterious impact of a carbamate pesticide on some metabolic immune and antioxidant functions and a focus on the protective ability of a Saharan shrub and its anti-edematous property
  145. A comprehensive review uncovering the anticancerous potential of genkwanin (plant-derived compound) in several human carcinomas
  146. A study to investigate the anticancer potential of carvacrol via targeting Notch signaling in breast cancer
  147. Assessment of anti-diabetic properties of Ziziphus oenopolia (L.) wild edible fruit extract: In vitro and in silico investigations through molecular docking analysis
  148. Optimization of polyphenol extraction, phenolic profile by LC-ESI-MS/MS, antioxidant, anti-enzymatic, and cytotoxic activities of Physalis acutifolia
  149. Phytochemical screening, antioxidant properties, and photo-protective activities of Salvia balansae de Noé ex Coss
  150. Antihyperglycemic, antiglycation, anti-hypercholesteremic, and toxicity evaluation with gas chromatography mass spectrometry profiling for Aloe armatissima leaves
  151. Phyto-fabrication and characterization of gold nanoparticles by using Timur (Zanthoxylum armatum DC) and their effect on wound healing
  152. Does Erodium trifolium (Cav.) Guitt exhibit medicinal properties? Response elements from phytochemical profiling, enzyme-inhibiting, and antioxidant and antimicrobial activities
  153. Integrative in silico evaluation of the antiviral potential of terpenoids and its metal complexes derived from Homalomena aromatica based on main protease of SARS-CoV-2
  154. 6-Methoxyflavone improves anxiety, depression, and memory by increasing monoamines in mice brain: HPLC analysis and in silico studies
  155. Simultaneous extraction and quantification of hydrophilic and lipophilic antioxidants in Solanum lycopersicum L. varieties marketed in Saudi Arabia
  156. Biological evaluation of CH3OH and C2H5OH of Berberis vulgaris for in vivo antileishmanial potential against Leishmania tropica in murine models
https://doi.org/10.1515/chem-2023-0184
Keywords for this article
marine fungi; silver nanoparticles; biosynthesis; characterization; optimization; antibacterial activity
Creative Commons
BY 4.0

Articles in the same Issue

  1. Regular Articles
  2. Porous silicon nanostructures: Synthesis, characterization, and their antifungal activity
  3. Biochar from de-oiled Chlorella vulgaris and its adsorption on antibiotics
  4. Phytochemicals profiling, in vitro and in vivo antidiabetic activity, and in silico studies on Ajuga iva (L.) Schreb.: A comprehensive approach
  5. Synthesis, characterization, in silico and in vitro studies of novel glycoconjugates as potential antibacterial, antifungal, and antileishmanial agents
  6. Sonochemical synthesis of gold nanoparticles mediated by potato starch: Its performance in the treatment of esophageal cancer
  7. Computational study of ADME-Tox prediction of selected phytochemicals from Punica granatum peels
  8. Phytochemical analysis, in vitro antioxidant and antifungal activities of extracts and essential oil derived from Artemisia herba-alba Asso
  9. Two triazole-based coordination polymers: Synthesis and crystal structure characterization
  10. Phytochemical and physicochemical studies of different apple varieties grown in Morocco
  11. Synthesis of multi-template molecularly imprinted polymers (MT-MIPs) for isolating ethyl para-methoxycinnamate and ethyl cinnamate from Kaempferia galanga L., extract with methacrylic acid as functional monomer
  12. Nutraceutical potential of Mesembryanthemum forsskaolii Hochst. ex Bioss.: Insights into its nutritional composition, phytochemical contents, and antioxidant activity
  13. Evaluation of influence of Butea monosperma floral extract on inflammatory biomarkers
  14. Cannabis sativa L. essential oil: Chemical composition, anti-oxidant, anti-microbial properties, and acute toxicity: In vitro, in vivo, and in silico study
  15. The effect of gamma radiation on 5-hydroxymethylfurfural conversion in water and dimethyl sulfoxide
  16. Hollow mushroom nanomaterials for potentiometric sensing of Pb2+ ions in water via the intercalation of iodide ions into the polypyrrole matrix
  17. Determination of essential oil and chemical composition of St. John’s Wort
  18. Computational design and in vitro assay of lantadene-based novel inhibitors of NS3 protease of dengue virus
  19. Anti-parasitic activity and computational studies on a novel labdane diterpene from the roots of Vachellia nilotica
  20. Microbial dynamics and dehydrogenase activity in tomato (Lycopersicon esculentum Mill.) rhizospheres: Impacts on growth and soil health across different soil types
  21. Correlation between in vitro anti-urease activity and in silico molecular modeling approach of novel imidazopyridine–oxadiazole hybrids derivatives
  22. Spatial mapping of indoor air quality in a light metro system using the geographic information system method
  23. Iron indices and hemogram in renal anemia and the improvement with Tribulus terrestris green-formulated silver nanoparticles applied on rat model
  24. Integrated track of nano-informatics coupling with the enrichment concept in developing a novel nanoparticle targeting ERK protein in Naegleria fowleri
  25. Cytotoxic and phytochemical screening of Solanum lycopersicum–Daucus carota hydro-ethanolic extract and in silico evaluation of its lycopene content as anticancer agent
  26. Protective activities of silver nanoparticles containing Panax japonicus on apoptotic, inflammatory, and oxidative alterations in isoproterenol-induced cardiotoxicity
  27. pH-based colorimetric detection of monofunctional aldehydes in liquid and gas phases
  28. Investigating the effect of resveratrol on apoptosis and regulation of gene expression of Caco-2 cells: Unravelling potential implications for colorectal cancer treatment
  29. Metformin inhibits knee osteoarthritis induced by type 2 diabetes mellitus in rats: S100A8/9 and S100A12 as players and therapeutic targets
  30. Effect of silver nanoparticles formulated by Silybum marianum on menopausal urinary incontinence in ovariectomized rats
  31. Synthesis of new analogs of N-substituted(benzoylamino)-1,2,3,6-tetrahydropyridines
  32. Response of yield and quality of Japonica rice to different gradients of moisture deficit at grain-filling stage in cold regions
  33. Preparation of an inclusion complex of nickel-based β-cyclodextrin: Characterization and accelerating the osteoarthritis articular cartilage repair
  34. Empagliflozin-loaded nanomicelles responsive to reactive oxygen species for renal ischemia/reperfusion injury protection
  35. Preparation and pharmacodynamic evaluation of sodium aescinate solid lipid nanoparticles
  36. Assessment of potentially toxic elements and health risks of agricultural soil in Southwest Riyadh, Saudi Arabia
  37. Theoretical investigation of hydrogen-rich fuel production through ammonia decomposition
  38. Biosynthesis and screening of cobalt nanoparticles using citrus species for antimicrobial activity
  39. Investigating the interplay of genetic variations, MCP-1 polymorphism, and docking with phytochemical inhibitors for combatting dengue virus pathogenicity through in silico analysis
  40. Ultrasound induced biosynthesis of silver nanoparticles embedded into chitosan polymers: Investigation of its anti-cutaneous squamous cell carcinoma effects
  41. Copper oxide nanoparticles-mediated Heliotropium bacciferum leaf extract: Antifungal activity and molecular docking assays against strawberry pathogens
  42. Sprouted wheat flour for improving physical, chemical, rheological, microbial load, and quality properties of fino bread
  43. Comparative toxicity assessment of fisetin-aided artificial intelligence-assisted drug design targeting epibulbar dermoid through phytochemicals
  44. Acute toxicity and anti-inflammatory activity of bis-thiourea derivatives
  45. Anti-diabetic activity-guided isolation of α-amylase and α-glucosidase inhibitory terpenes from Capsella bursa-pastoris Linn.
  46. GC–MS analysis of Lactobacillus plantarum YW11 metabolites and its computational analysis on familial pulmonary fibrosis hub genes
  47. Green formulation of copper nanoparticles by Pistacia khinjuk leaf aqueous extract: Introducing a novel chemotherapeutic drug for the treatment of prostate cancer
  48. Improved photocatalytic properties of WO3 nanoparticles for Malachite green dye degradation under visible light irradiation: An effect of La doping
  49. One-pot synthesis of a network of Mn2O3–MnO2–poly(m-methylaniline) composite nanorods on a polypyrrole film presents a promising and efficient optoelectronic and solar cell device
  50. Groundwater quality and health risk assessment of nitrate and fluoride in Al Qaseem area, Saudi Arabia
  51. A comparative study of the antifungal efficacy and phytochemical composition of date palm leaflet extracts
  52. Processing of alcohol pomelo beverage (Citrus grandis (L.) Osbeck) using saccharomyces yeast: Optimization, physicochemical quality, and sensory characteristics
  53. Specialized compounds of four Cameroonian spices: Isolation, characterization, and in silico evaluation as prospective SARS-CoV-2 inhibitors
  54. Identification of a novel drug target in Porphyromonas gingivalis by a computational genome analysis approach
  55. Physico-chemical properties and durability of a fly-ash-based geopolymer
  56. FMS-like tyrosine kinase 3 inhibitory potentials of some phytochemicals from anti-leukemic plants using computational chemical methodologies
  57. Wild Thymus zygis L. ssp. gracilis and Eucalyptus camaldulensis Dehnh.: Chemical composition, antioxidant and antibacterial activities of essential oils
  58. 3D-QSAR, molecular docking, ADMET, simulation dynamic, and retrosynthesis studies on new styrylquinolines derivatives against breast cancer
  59. Deciphering the influenza neuraminidase inhibitory potential of naturally occurring biflavonoids: An in silico approach
  60. Determination of heavy elements in agricultural regions, Saudi Arabia
  61. Synthesis and characterization of antioxidant-enriched Moringa oil-based edible oleogel
  62. Ameliorative effects of thistle and thyme honeys on cyclophosphamide-induced toxicity in mice
  63. Study of phytochemical compound and antipyretic activity of Chenopodium ambrosioides L. fractions
  64. Investigating the adsorption mechanism of zinc chloride-modified porous carbon for sulfadiazine removal from water
  65. Performance repair of building materials using alumina and silica composite nanomaterials with electrodynamic properties
  66. Effects of nanoparticles on the activity and resistance genes of anaerobic digestion enzymes in livestock and poultry manure containing the antibiotic tetracycline
  67. Effect of copper nanoparticles green-synthesized using Ocimum basilicum against Pseudomonas aeruginosa in mice lung infection model
  68. Cardioprotective effects of nanoparticles green formulated by Spinacia oleracea extract on isoproterenol-induced myocardial infarction in mice by the determination of PPAR-γ/NF-κB pathway
  69. Anti-OTC antibody-conjugated fluorescent magnetic/silica and fluorescent hybrid silica nanoparticles for oxytetracycline detection
  70. Curcumin conjugated zinc nanoparticles for the treatment of myocardial infarction
  71. Identification and in silico screening of natural phloroglucinols as potential PI3Kα inhibitors: A computational approach for drug discovery
  72. Exploring the phytochemical profile and antioxidant evaluation: Molecular docking and ADMET analysis of main compounds from three Solanum species in Saudi Arabia
  73. Unveiling the molecular composition and biological properties of essential oil derived from the leaves of wild Mentha aquatica L.: A comprehensive in vitro and in silico exploration
  74. Analysis of bioactive compounds present in Boerhavia elegans seeds by GC-MS
  75. Homology modeling and molecular docking study of corticotrophin-releasing hormone: An approach to treat stress-related diseases
  76. LncRNA MIR17HG alleviates heart failure via targeting MIR17HG/miR-153-3p/SIRT1 axis in in vitro model
  77. Development and validation of a stability indicating UPLC-DAD method coupled with MS-TQD for ramipril and thymoquinone in bioactive SNEDDS with in silico toxicity analysis of ramipril degradation products
  78. Biosynthesis of Ag/Cu nanocomposite mediated by Curcuma longa: Evaluation of its antibacterial properties against oral pathogens
  79. Development of AMBER-compliant transferable force field parameters for polytetrafluoroethylene
  80. Treatment of gestational diabetes by Acroptilon repens leaf aqueous extract green-formulated iron nanoparticles in rats
  81. Development and characterization of new ecological adsorbents based on cardoon wastes: Application to brilliant green adsorption
  82. A fast, sensitive, greener, and stability-indicating HPLC method for the standardization and quantitative determination of chlorhexidine acetate in commercial products
  83. Assessment of Se, As, Cd, Cr, Hg, and Pb content status in Ankang tea plantations of China
  84. Effect of transition metal chloride (ZnCl2) on low-temperature pyrolysis of high ash bituminous coal
  85. Evaluating polyphenol and ascorbic acid contents, tannin removal ability, and physical properties during hydrolysis and convective hot-air drying of cashew apple powder
  86. Development and characterization of functional low-fat frozen dairy dessert enhanced with dried lemongrass powder
  87. Scrutinizing the effect of additive and synergistic antibiotics against carbapenem-resistant Pseudomonas aeruginosa
  88. Preparation, characterization, and determination of the therapeutic effects of copper nanoparticles green-formulated by Pistacia atlantica in diabetes-induced cardiac dysfunction in rat
  89. Antioxidant and antidiabetic potentials of methoxy-substituted Schiff bases using in vitro, in vivo, and molecular simulation approaches
  90. Anti-melanoma cancer activity and chemical profile of the essential oil of Seseli yunnanense Franch
  91. Molecular docking analysis of subtilisin-like alkaline serine protease (SLASP) and laccase with natural biopolymers
  92. Overcoming methicillin resistance by methicillin-resistant Staphylococcus aureus: Computational evaluation of napthyridine and oxadiazoles compounds for potential dual inhibition of PBP-2a and FemA proteins
  93. Exploring novel antitubercular agents: Innovative design of 2,3-diaryl-quinoxalines targeting DprE1 for effective tuberculosis treatment
  94. Drimia maritima flowers as a source of biologically potent components: Optimization of bioactive compound extractions, isolation, UPLC–ESI–MS/MS, and pharmacological properties
  95. Estimating molecular properties, drug-likeness, cardiotoxic risk, liability profile, and molecular docking study to characterize binding process of key phyto-compounds against serotonin 5-HT2A receptor
  96. Fabrication of β-cyclodextrin-based microgels for enhancing solubility of Terbinafine: An in-vitro and in-vivo toxicological evaluation
  97. Phyto-mediated synthesis of ZnO nanoparticles and their sunlight-driven photocatalytic degradation of cationic and anionic dyes
  98. Monosodium glutamate induces hypothalamic–pituitary–adrenal axis hyperactivation, glucocorticoid receptors down-regulation, and systemic inflammatory response in young male rats: Impact on miR-155 and miR-218
  99. Quality control analyses of selected honey samples from Serbia based on their mineral and flavonoid profiles, and the invertase activity
  100. Eco-friendly synthesis of silver nanoparticles using Phyllanthus niruri leaf extract: Assessment of antimicrobial activity, effectiveness on tropical neglected mosquito vector control, and biocompatibility using a fibroblast cell line model
  101. Green synthesis of silver nanoparticles containing Cichorium intybus to treat the sepsis-induced DNA damage in the liver of Wistar albino rats
  102. Quality changes of durian pulp (Durio ziberhinus Murr.) in cold storage
  103. Study on recrystallization process of nitroguanidine by directly adding cold water to control temperature
  104. Determination of heavy metals and health risk assessment in drinking water in Bukayriyah City, Saudi Arabia
  105. Larvicidal properties of essential oils of three Artemisia species against the chemically insecticide-resistant Nile fever vector Culex pipiens (L.) (Diptera: Culicidae): In vitro and in silico studies
  106. Design, synthesis, characterization, and theoretical calculations, along with in silico and in vitro antimicrobial proprieties of new isoxazole-amide conjugates
  107. The impact of drying and extraction methods on total lipid, fatty acid profile, and cytotoxicity of Tenebrio molitor larvae
  108. A zinc oxide–tin oxide–nerolidol hybrid nanomaterial: Efficacy against esophageal squamous cell carcinoma
  109. Research on technological process for production of muskmelon juice (Cucumis melo L.)
  110. Physicochemical components, antioxidant activity, and predictive models for quality of soursop tea (Annona muricata L.) during heat pump drying
  111. Characterization and application of Fe1−xCoxFe2O4 nanoparticles in Direct Red 79 adsorption
  112. Torilis arvensis ethanolic extract: Phytochemical analysis, antifungal efficacy, and cytotoxicity properties
  113. Magnetite–poly-1H pyrrole dendritic nanocomposite seeded on poly-1H pyrrole: A promising photocathode for green hydrogen generation from sanitation water without using external sacrificing agent
  114. HPLC and GC–MS analyses of phytochemical compounds in Haloxylon salicornicum extract: Antibacterial and antifungal activity assessment of phytopathogens
  115. Efficient and stable to coking catalysts of ethanol steam reforming comprised of Ni + Ru loaded on MgAl2O4 + LnFe0.7Ni0.3O3 (Ln = La, Pr) nanocomposites prepared via cost-effective procedure with Pluronic P123 copolymer
  116. Nitrogen and boron co-doped carbon dots probe for selectively detecting Hg2+ in water samples and the detection mechanism
  117. Heavy metals in road dust from typical old industrial areas of Wuhan: Seasonal distribution and bioaccessibility-based health risk assessment
  118. Phytochemical profiling and bioactivity evaluation of CBD- and THC-enriched Cannabis sativa extracts: In vitro and in silico investigation of antioxidant and anti-inflammatory effects
  119. Investigating dye adsorption: The role of surface-modified montmorillonite nanoclay in kinetics, isotherms, and thermodynamics
  120. Antimicrobial activity, induction of ROS generation in HepG2 liver cancer cells, and chemical composition of Pterospermum heterophyllum
  121. Study on the performance of nanoparticle-modified PVDF membrane in delaying membrane aging
  122. Impact of cholesterol in encapsulated vitamin E acetate within cocoliposomes
  123. Review Articles
  124. Structural aspects of Pt(η3-X1N1X2)(PL) (X1,2 = O, C, or Se) and Pt(η3-N1N2X1)(PL) (X1 = C, S, or Se) derivatives
  125. Biosurfactants in biocorrosion and corrosion mitigation of metals: An overview
  126. Stimulus-responsive MOF–hydrogel composites: Classification, preparation, characterization, and their advancement in medical treatments
  127. Electrochemical dissolution of titanium under alternating current polarization to obtain its dioxide
  128. Special Issue on Recent Trends in Green Chemistry
  129. Phytochemical screening and antioxidant activity of Vitex agnus-castus L.
  130. Phytochemical study, antioxidant activity, and dermoprotective activity of Chenopodium ambrosioides (L.)
  131. Exploitation of mangliculous marine fungi, Amarenographium solium, for the green synthesis of silver nanoparticles and their activity against multiple drug-resistant bacteria
  132. Study of the phytotoxicity of margines on Pistia stratiotes L.
  133. Special Issue on Advanced Nanomaterials for Energy, Environmental and Biological Applications - Part III
  134. Impact of biogenic zinc oxide nanoparticles on growth, development, and antioxidant system of high protein content crop (Lablab purpureus L.) sweet
  135. Green synthesis, characterization, and application of iron and molybdenum nanoparticles and their composites for enhancing the growth of Solanum lycopersicum
  136. Green synthesis of silver nanoparticles from Olea europaea L. extracted polysaccharides, characterization, and its assessment as an antimicrobial agent against multiple pathogenic microbes
  137. Photocatalytic treatment of organic dyes using metal oxides and nanocomposites: A quantitative study
  138. Antifungal, antioxidant, and photocatalytic activities of greenly synthesized iron oxide nanoparticles
  139. Special Issue on Phytochemical and Pharmacological Scrutinization of Medicinal Plants
  140. Hepatoprotective effects of safranal on acetaminophen-induced hepatotoxicity in rats
  141. Chemical composition and biological properties of Thymus capitatus plants from Algerian high plains: A comparative and analytical study
  142. Chemical composition and bioactivities of the methanol root extracts of Saussurea costus
  143. In vivo protective effects of vitamin C against cyto-genotoxicity induced by Dysphania ambrosioides aqueous extract
  144. Insights about the deleterious impact of a carbamate pesticide on some metabolic immune and antioxidant functions and a focus on the protective ability of a Saharan shrub and its anti-edematous property
  145. A comprehensive review uncovering the anticancerous potential of genkwanin (plant-derived compound) in several human carcinomas
  146. A study to investigate the anticancer potential of carvacrol via targeting Notch signaling in breast cancer
  147. Assessment of anti-diabetic properties of Ziziphus oenopolia (L.) wild edible fruit extract: In vitro and in silico investigations through molecular docking analysis
  148. Optimization of polyphenol extraction, phenolic profile by LC-ESI-MS/MS, antioxidant, anti-enzymatic, and cytotoxic activities of Physalis acutifolia
  149. Phytochemical screening, antioxidant properties, and photo-protective activities of Salvia balansae de Noé ex Coss
  150. Antihyperglycemic, antiglycation, anti-hypercholesteremic, and toxicity evaluation with gas chromatography mass spectrometry profiling for Aloe armatissima leaves
  151. Phyto-fabrication and characterization of gold nanoparticles by using Timur (Zanthoxylum armatum DC) and their effect on wound healing
  152. Does Erodium trifolium (Cav.) Guitt exhibit medicinal properties? Response elements from phytochemical profiling, enzyme-inhibiting, and antioxidant and antimicrobial activities
  153. Integrative in silico evaluation of the antiviral potential of terpenoids and its metal complexes derived from Homalomena aromatica based on main protease of SARS-CoV-2
  154. 6-Methoxyflavone improves anxiety, depression, and memory by increasing monoamines in mice brain: HPLC analysis and in silico studies
  155. Simultaneous extraction and quantification of hydrophilic and lipophilic antioxidants in Solanum lycopersicum L. varieties marketed in Saudi Arabia
  156. Biological evaluation of CH3OH and C2H5OH of Berberis vulgaris for in vivo antileishmanial potential against Leishmania tropica in murine models
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 6.12.2025 from https://www.degruyterbrill.com/document/doi/10.1515/chem-2023-0184/html
Scroll to top button