Startseite Population genetics and pedigree geography of Trionychia japonica in the four mountains of Henan Province and the Taihang Mountains
Artikel Open Access

Population genetics and pedigree geography of Trionychia japonica in the four mountains of Henan Province and the Taihang Mountains

  • Hui Zhu EMAIL logo und Zhichao Chen
Veröffentlicht/Copyright: 10. April 2023
Artikel downloaden (PDF)
Veröffentlichen auch Sie bei De Gruyter Brill
Manuskript einreichen Informationen für Autor*innen
Open Geosciences
Aus der Zeitschrift Open Geosciences Band 15 Heft 1

Abstract

Objective

Human activities and climate change have changed the living environment of species, accelerated the rate of species extinction, and global biodiversity is facing a huge threat. The objective of this study is to determine the resource protection strategy of freshwater planarian by systematically exploring the population genetics and pedigree geography of the planarian population in the four mountain systems of Henan Province and Taihang Mountains.

Methods

Taking the Japanese planarian in the four mountain systems of Henan Province and Taihang Mountains as an example, DNA was extracted with the help of mitochondrial cytochrome c oxidase subunit I gene (COI), mitochondrial cytochrome b gene (Cytb), and nuclear gene internal transcribed spacer-1 (ITS-1), amplified by polymerase chain reaction and sequenced, and genetic diversity, genetic structure, and pedigree geographical pattern were analyzed by single-gene analysis and polygene joint analysis.

Results

The corresponding length of Cytb, COI, and nuclear gene ITS-1 sequences in the four mountains of Henan Province is 308, 805, and 632 bp, respectively, and the nucleotide diversity and haplotype diversity are 0.00212 and 0.975, respectively. The gene length of ITS-1 and Cytb in Taihang Mountains is 668 and 315 bp, respectively, with a total length of 984 bp. There are 10 shared haplotypes and 36 unique haplotypes. The values of all nucleic acid diversity and haplotype diversity were 0.00156 and 0.965, respectively, and the genetic variation coefficients between populations and groups were 20.28% and 16.40%, respectively (P < 0.05). Different haplotypes of the four mountain systems in Henan Province and Taihang Mountains are scattered in different geographic populations, and there is no correlation between them and their geographic locations, which is consistent with the results of phylogeny.

Conclusion

The genetic diversity of Trionychia japonica population in the four mountain systems of Henan Province and Taihang Mountains shows high haploid diversity and low nucleotide diversity, and phylogenetic analysis has not found obvious pedigree geographical pattern.

Keywords: Japanese planarian; Henan; four mountain systems; Taihang Mountains; population genetics; pedigree geography; genetic diversity

1 Introduction

In the current era of population growth, urbanization, rapid development of modern industry and agriculture, and increasingly serious environmental pollution, as well as in the context of global warming, drying up of water bodies, and accelerating tourism development, global biodiversity is facing a huge threat. In a large number of medical reports, planarian is used not only as a substitute model for screening chemical poisons, but also as a marker animal for monitoring water quality and as a research model for population genetics and pedigree geography. With the gradual improvement in new generation sequencing methods and molecular marker technology, the ideal model of planarian population genetics and systematic geography is becoming the focus of many medical researchers. Pedigree geography can investigate the genetic diversity and pedigree relationship of species from the perspective of genetics, providing reference for species protection [1,2,3]. The diffusion of individual organisms is an important factor affecting genetic differentiation among populations. In many different freshwater species, the genetic structure within their populations and the gene flow between populations have been studied. The evolutionary significance of gene flow is mainly reflected on the following two aspects: on the one hand, limited gene flow makes local adaptation and microevolutionary changes possible, thus increasing the fitness of local populations; on the other hand, when the population size is small, gene flow is a necessary condition to maintain gene variation. It can be observed that the degree of gene variation and differentiation between populations depends largely on the markers used. At present, pedigree geography is widely used to analyze the distribution pattern, migration, and diffusion of planarian. Mitochondrial genes and some nuclear gene fragments are now commonly used molecular markers for pedigree biogeography.

Maternal inheritance, simple structure, no gene recombination, fast evolution, large copy number, easy extraction, and other characteristics make mitochondrial genes an ideal marker for studying species pedigree geography and population genetic diversity [4,5]. Mitochondrial cytochrome c oxidase subunit I gene (COI) and mitochondrial cytochrome b gene (Cytb) are commonly used to study the genetic diversity of populations. When studying intraspecific and close interspecific relationships, the internal transcribed spacer-1 (ITS-1) of ribosome often has a high proportion of polymorphisms and information sites. Although there is no relevant report in China, studies in some European and American countries and regions have revealed the lineage differentiation model and possible lineage sources of different geographical populations to varying degrees. Henan Province is located in the middle and lower reaches of the Yellow River in the middle east of China and the south of the North China Plain, including the Taihang Mountains, the Taibei Mountains, the Tongbai Mountains, and the Funiu Mountains. Human activities and climate change have changed the living environment of species and accelerated the rate of species extinction. Global biodiversity is facing a huge threat. How to protect biodiversity has become a hot issue of general concern. Therefore, in order to prevent the extinction of species and the destruction of ecological integrity, the population genetics and phylogenetic geography of the four mountain systems in Henan Province and Taihang Mountains were investigated using genetic analysis methods to provide scientific guidance for the protection of freshwater planarian resources.

2 Experimental materials and research methods

2.1 Experimental materials

2.1.1 Sample collection

The population of Trionychia japonica from the four mountain systems of Taihang Mountain, Taibei Mountain, Tongbai Mountain, and Funiu Mountain in Henan Province was taken as sample data, with a total of 36 population types. Table 1 shows the locations of triangular planarian in the four mountain systems in Henan.

Table 1

Location of triangular planarian in the four mountain systems in Henan

Population code Sampling location Longitude and latitude Altitude (m) Collection date (year-month)
Qi Qi County 35°43′ N/114°06′ E 206 2021-9
XW Xiuwu County 35°28′ N/113°20′ E 490 2021-2
JY-1 Jiyuan City 35°15′ N/112°11′ E 791 2021-5
JY-2 Jiyuan City 32°51′ N/112°12′ E 532 2021-9
GS-1 Gushi County 31 °49′ N/115°44′ E 157 2021-8
GS-2 Gushi County 31947′ N/115*45′ E 211 2022-3
SC Shangcheng County 31 °44′ N/115°28′ E 170 2021-8
Xin Xinxian County 31°37′ N/114°49′ E 210 2021-9
XY-1 Xinyang City 31°49′ N/114°3′ E 180 2022-3
XY-2 Xinyang City 31°59′ N/113°51′ E 170 2022-1
TB-1 Tongbai County 32°21′ N/113°23′ E 160 2021-10
TB-2 Tongbai County 32°24′ N/113°16′ E 230 2021-7
WG Wugang City 33°11′ N/113°36′ E 190 2021-8
SP Suiping County 33°11′ N/113°40′ E 150 2021-6
FC Fangcheng County 33°22′ N/1 12956′ E 300 2021-6
NZ Nanzhao County 33°19′ N/112°1 7′ E 350 2021-6
NX Neixiang County 33°22′ N/1 11°54′ E 430 2021-9
XiX Xixia County 33°31′ N/1 11°38′ E 530 2021-7
LuanC Luanchuan County 33°56′ N/1 11°43′ E 430 2021-8
LuS Lushan County 33°46′ N/112°19′ E 190 2021-9

Table 2 shows the location of triangular planarian in the Taihang Mountains. Each sample point has more than 20 samples, with an average of 22. The collected planarians were placed in a collecting bottle and fed in a 13°C incubator. They were fed with fresh beef liver homogenate once a week, and the water was changed every 2–3 days after feeding. The experiment required the living planarian to be hungry for more than 7 days.

Table 2

Location of triangular planarian in the Taihang Mountains

Population code Sampling location Longitude and latitude Altitude (m) Collection date (year-month)
Qi Qi County, Henan Province 35°43′ N/114°06′ E 206 2021-6
XW Xiuwu County, Henan Province 35°28′ N/113°20′ E 490 2021-9
JY-1 Jiyuan City, Henan Province 35°15′ N112°11′E 791 2021-7
JY-2 Jiyuan City, Henan Province 35°25′ N112°12′ E 532 2021-8
XT-1 Xingtai City, Hebei Province 37°20′ N113°54′ E 1,055 2021-9
XT-2 Xingtai City, Hebei Province 37°05′ N113°47′ E 774 2022-3
Y Yi County, Hebei Province 39°23′ N/115°15′E 433 2021-8
QY Quyang County, Hebei Province 38°56′ N114°33′E 71 2021-9
LaiS Laishui County, Hebei Province 39°39′ N/115°23′ E 430 2022-3
LingS Lingshou County, Hebei Province 38°41′ N113°51′E 35 2021-9
PShan Pingshan County, Hebei Province 38°15′ N113°43′ E 20 2021-2
FP Fuping County, Hebei Province 38°55′ N/113°48′ E 840 2021-5
LQ Lingqiu County, Shanxi Province 39°20′ N114°18′ E 1,391 2021-9
WT Wutai County, Shanxi Province 38°54′ N113°38′ E 980 2021-8
Yu Yu County, Shanxi Province 38°12′ N113°19′ E 970 2021-6
ZQ Zuoquan County, Shanxi Province 37°00′ N113°29′ E 813 2021-6
PShun Pingshun County, Shanxi Province 36°12′ N/113°36′ E 622 2021-7
HG Huguan County, Shanxi Province 35°55′ N113°35′ E 575 2021-10
LC Lingchuan County, Shanxi Province 35°32′ N113°26′ E 206 2021-8
YC Yangcheng County, Shanxi Province 35°14′ N/112°26′E 490 2022-3

Figure 1(a) and (b) shows the population distribution map of the Japanese planarian in the four mountain systems of Henan Province and Taihang Mountains, respectively.

Figure 1 Population distribution map of Trionychia japonica. (a) Four mountain systems in Henan and (b) Taihang Mountains.
Figure 1

Population distribution map of Trionychia japonica. (a) Four mountain systems in Henan and (b) Taihang Mountains.

2.1.2 Experimental reagents and instruments

The main reagents used in the experiment are Tris-balanced phenol, TAE buffer of Shanghai Baogui Biotechnology Co., Ltd, Merck KGaA Protease K, agarose Beijing Solabo Technology Co., Ltd, DNeasy Blood & Tissue Kit, 10× loading buffer, sodium dodecyl sulfate, Tris, 2× Taq Plus Master Mix, ethylenediaminetetraacetic acid, absolute ethanol, amyl alcohol, chloroform, gentamycin, and ethidium bromide. The main instruments used in the experiment are the SPH-250 thermostatic biochemical incubator of Shanghai Jinghong Experimental Equipment Co., Ltd, the electronic balance of Shanghai Tianping Instrument Technology Co., Ltd, the vertical high-pressure sterilizer of Beijing Wuzhou Dongfang Technology Development Co., Ltd, the electric blast drying oven of Shanghai Yiheng Scientific Instrument Co., Ltd, the polymerase chain reaction (PCR) instrument of Germany Biometra, PHS-25 precision pH meter of Shanghai Precision Scientific Instrument Co., Ltd, DYCP-31A agarose gel electrophoresis model of Beijing Dayi Biotechnology Co., Ltd, NanoDrop 2000 micro spectrophotometer of Thermo Company of the United States, and SE-93 automatic dual pure water distiller of Shanghai Yarong Biochemical Instrument Factory. The test process followed the manufacturer’s recommendations.

2.2 Research methods

2.2.1 Extraction of genomic deoxyribonucleic acid (DNA)

In the study, genomic DNA was extracted by the DNeasy Blood & Tissue Kit. First, 25 and 35 mL of absolute ethanol were added into AW1 and AW2 buffer solutions, respectively, and a single planarian with a length of about 1.5 cm was washed three times with double distilled water and placed in a 1.5 mL centrifuge tube. Then 20 μL of pyruvate kinase and 200 μL of Buffer ATL were added, and the centrifuge tube was placed in liquid nitrogen for 10 s. The planarian tissue was fully crushed and shaken in the centrifuge tube, and then 200 μL of Buffer ATL was added. The mixture was vortexed and 200 μL of absolute ethanol was added to the vortex again. Then the mixture was moved into a 2 mL collection tube and centrifuged for 1 min. The collection tube and the discard tube were discarded.

2.2.2 Primer synthesis, PCR amplification, and sequencing

The molecular markers selected in the study were mitochondrial gene Cytb, COI, and nuclear gene ITS-1. Reference for amplification primer of ITS-1 can be found in previous studies [6,7]. The amplification primers of Cytb and COI were designed by referring to primers data. Table 3 shows the primers needed, which were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

Table 3

Primers needed in the experiment

Molecular marker Primer sequence Annealing temperature/°C Amplification length/bp
Cytb Forward primer GTAGGTGAACCTGCGGAAGG 45 700
Reverse primer TGCGTTCAAATTGTCAATGATC
COI Forward primer ATGTCTCTTTGAGGAGCTACTGT 47 415
Reverse primer CTAAAAAATACCACTCAGGCTTTAT
ITS-1 Forward primer GATATGGCTTTTCCTCGTGCT 56 1,072
Reverse primer CAGCATAATCACAAATWCGACG

The most all volume of PCR reaction is 30 μL, and the amplification reaction system is 1 μL of DNA, 10 μmol/L of positive reaction primer, respectively 1 μL, 15 μL of TaqMix, 12 μL of sterilized double distilled water. The PCR procedure is as follows: pre-denaturation at 90°C for 5 min, denaturation at 94°C for 40 s, annealing at different primer temperatures for 30 s, and extension and re-extension at 72°C for 1 and 10 min, respectively. Detection and sequencing of PCR products are performed as follows: 0.2 g agarose and 1× TAE buffer solution are taken in a triangular flask, shaken evenly, placed in a microwave oven, and heated until bubbles appear on the page. It is then cooled to 50°C, and ethidium bromide dye is added. It is again cooled into agarose gel and placed in an electrophoresis tank. After electrophoresis is completed, the tailing and clarity of the detection strip are verified. When the obtained product band is the target band, the amplified product has to be returned to the company for sequencing.

2.3 Data processing and analysis methods

2.3.1 Sequence splicing and comparison

The sequencing results of PCR products are spliced and edited by DNAStar software, and the National Biotechnology Information Center determines whether they are target sequences. Cytb and COI genes can judge whether the spliced sequence can be translated into amino acid normally through the online software EMBOSS Transeq. If it can be translated normally, the sequence can be considered to be used normally; otherwise, the sequence will be detected again after reverse complementary operation through the program. After the sequence detection is confirmed to be correct, it is completely compared and cut using the MEGA 7.0 software in the fast format to obtain sequence fragments with the same length. The results after comparison are exported in the fast format.

2.3.2 Population haplotype distribution and genetic analysis

The haplotype was defined by the DNASP5.0 software, and the haplotype diversity and nucleotide diversity were calculated at the same time. Molecular variation analysis was completed using the Arlequin software, and differentiation coefficient F ST between populations was estimated. The neutral test was completed by the DNASP5.0 software to estimate Tajima’s D and Fu’s Fs values.

2.3.3 Haplotype phylogeny and network analysis

Phylogenetic tree analysis selected Dugesia ryukyuensis, a sister species of the Japanese planarian, Ryukyu, as an outgroup pair, based on the maximum parsimony (MP) method, Bayesian inference (BI), and maximum likelihood (ML) to construct MP trees, BI trees, and ML trees, respectively. Using the program jModeltest v2.1.7, the best model of nucleotide substitution for each phylogenetic tree was obtained according to the Akaike information standard. The haplotype network diagram was constructed by the median connection method in Network 10.2.0.0, and then the evolutionary relationship among haplotypes was analyzed. P < 0.05 and P < 0.001 were statistically significant and significant, respectively.

3 Results

3.1 DNA extraction and PCR amplification results

Figure 2 shows the PCR amplification results of three molecular markers by agarose gel electrophoresis. The bands of the three populations are clear and free of tailing. The size of the bands is the same as the theory. It can be concluded that they are all target bands, and they can be sequenced in two directions later. The samples of Figure 2(a)–(c) are from QY, SC, and SP, respectively.

Figure 2 PCR amplification results of three molecular markers by agarose gel electrophoresis. (a) ITS-1, (b) Cytb, and (c) COI.
Figure 2

PCR amplification results of three molecular markers by agarose gel electrophoresis. (a) ITS-1, (b) Cytb, and (c) COI.

3.2 Genetic diversity of the population

A total of 116 mitochondrial gene Cytb, COI, and nuclear gene ITS-1 sequences were obtained from 20 planarian populations in the four mountains of Henan Province. The corresponding lengths of the three genes were 308, 805, and 632 bp, respectively, and the total gene length was 1,745 bp. The nucleotide diversity and haplotype diversity of 116 combined gene sequences were 0.00212 and 0.975, respectively, including 5 shared haplotypes (H1, H21, H55, H67, H69) and 82 exclusive haplotypes (H2–H20, H22–H54, H55–6–H66). Among them, H55 is the most widely distributed area, which is concentrated in six populations, namely JY-1, Lus, LuanC, XiX, NZ, and FC. The value of nucleic acid diversity was 0.00023–0.00314, and the values of NX and Lus were the highest and lowest, respectively. Except Qi, Lus, and LuanC, the haplotype diversity of the remaining 17 geographical regions was 0.900–1.000, and the specific results are shown in Table 4.

Table 4

Genetic diversity of the planarian population in four mountains of Henan Province

Population code Number of samples Number of haplotypes Haplotype Haplotype diversity Nucleotide diversity Tajima’s D Fu’s Fs
GS-1 6 5 H1, H2, H3, H4, H5 1.000 0.00204 0.372 0.307
GS-2 5 4 H1, H6, H7, H8, H9, H10 1.000 0.00257 0.414 0.272
SC 6 6 H11, H12, H13, H14 1.000 0.00092 −1.284** −1.362*
Xin 9 9 H15, H16, H17, H18, H19, H20, H21, H22, H23 1.000 0.00287 −0.408 −0.079
XY-1 5 5 H24, H25, H26, H27, H28 1.000 0.00315 0.185 0.129
XY-2 5 5 H21, H29, H30, H31 1.000 0.00122 0.657 0.665
TB-1 6 4 H32, H33, H34, H35, H36 I.000 0.00179 0.510 0.650
TB-2 4 4 H37, H38, H39, H40 0.952 0.00301 −0.871 −0.948
WG 5 5 H41, H42, H463, H44, H45 0.644 0.00090 1.335 1.509
SP 4 3 H46, H47, H48, H49, H50, H51, H52, H53, H54 0.933 0.00295 0.899 1.325
FC 9 9 H55, H56, H57 1.000 0.00267 −0.874 −0.940*
NZ 5 5 H55, H58, H59, H60, H61 0.900 0.00253 0.074 0.171
NX 5 5 H62, H63, H64, H65, H66 1.000 0.00279 −0.395 −0.324
XiX 10 4 H55, H67, H68, H69, H70 0.933 0.00292 −1.78 −0.465
LuanC 7 5 H55, H67, H69, H71 0.900 0.00121 0.635 1.579
LuS 5 2 H55, H72 1.000 0.00072 −0.815 −0.771
Qi 4 6 H73, H74, H75 0.978 0.00150 −0.446 −0.410
XW 6 3 H76, H77, H78, H79, H80, H81 1.000 0.00058 0.591 1.009
JY-1 6 4 H55, H67, H82, H83 1.000 0.00278 1.031 1.345
JY-2 4 4 H84, H85, H86, H87 1.000 0.00024 −0.854 −0.905
Total 116 87 — 0.975 0.00212 0.921 1.884*

Note: * refers to P < 0.05 and ** refers to P < 0.001.

A total of 120 mitochondrial Cytb and nuclear gene ITS-1 sequences and 116 COI sequences were obtained from 20 populations in Taihang Mountains. According to the joint analysis of ITS-1–Cytb, the gene length of ITS-1 and Cytb is 668 and 315 bp, respectively, with a total length of 984 bp. There are 10 shared haplotypes and 36 unique haplotypes, respectively. The values of all nucleic acid diversity and haplotype diversity were 0.00156 and 0.965, respectively. Table 5 refers to the specific results of ITS-1–Cytb sequence in Taihang Mountains. The length of COI sequence is 789 bp, including 24 unique haplotypes and 8 shared haplotypes. The values of all nucleic acid diversity and haplotype diversity were 0.920 and 0.00082, respectively. Range of nucleic acid diversity is 0-00112, XT-2, Yu, Qi, FP are the highest and lowest respectively.

Table 5

Specific results of ITS-1–Cytb sequences in Taihang Mountains

Population code Number of samples Number of haplotypes Haplotype Haplotype diversity Nucleotide diversity Tajima’s D Fu’s Fs
LaiS 5 3 H1, H5, H6 0.833 0.00093 −1.214 −1.251
Yi 7 2 H2, H3, H4 0.803 0.00130 −0.744 −0.593
QY 4 3 H1, H2 0.652 0.00037 2.351** 2.051**
FP 4 2 H2, H11 1.000 0.00102 −0.858 −0.921
LingS 12 5 H2, H5, H9, H10, H11 0.600 0.00032 −0.920 −1.109
PShan 5 3 H12, H13 0.700 0.00037 1.840* 1.987**
XT-1 4 4 H14, H15, H16, H17 0.476 0.00185 0.598 0.965
XT-2 7 3 H9, H18, H19, H20 0.700 0.00194 0.050 0.461
Qi 4 4 H5, H6, H7, H8 0.714 0.00061 −1.748** −2.023**
XW 9 8 H21, H22, H23, H24, H25, H26, H27, H28, H29 0.607 0.00001 0.864 1.002
JY-1 4 5 H30, H31, H32, H33 0.833 0.00183 0.578 0.925
JY-2 4 3 H16, H34, H35 0.700 0.00147 −0.874 0.926
LQ 8 4 H5, H6, H11 1.000 0.00127 0.675 0.687
WT 4 1 H30, H36 1.000 0.00146 −1.273* −1.384*
Yu 5 1 H30 0 0 0.000 0.000
ZQ 11 4 H8, H30, H37, H38 0.658 0.00146 −2.248** −3.146**
PShun 6 4 H16, H39, H40, H41, H42 1.000 0.00104 −0.865 −0.902
HG 5 3 H29, H43 1.000 0.00045 1.223 1.154
LC 7 3 H6, H45, H46 0.833 0.00161 −1.273* −1.387**
YC 5 2 H30, H44 0.648 0.00087 0.973 1.687*
Total 120 46 — 0.965 0.00156 0.250 1.658

Note: * refers to P < 0.05 and ** refers to P < 0.001.

3.3 Population genetic structure and genetic differentiation

According to the geographical region, the four mountain systems in Henan Province are divided into three species groups: the north, the middle, and the south. The molecular variation analysis shows that the F ST value is 0.368, and the difference between populations is statistically significant (P < 0.05). The genetic variation coefficients between populations and groups were 20.28% and 16.40%, respectively. The range of F ST value of ITS-1–Cytb–COI was −0.095–0.9972, and 190 pairs of population showed differences (P < 0.05). The variability between Lus and Qi populations and between Qi and JY-2 populations was the largest and smallest, respectively, with F ST values of 0.997 and 0.095 (P < 0.05). Table 6 refers to the F ST values of ITS-1–Cytb–COI of the four mountain systems in Henan.

Table 6

F ST values of ITS-1–Cytb–COI in four mountain systems in Henan Province

Population code GS-1 GS-2 SC Xin XY-1 XY-2 TB-1 TB-2 WG SP FC NZ NX XiX LuanC LuS Qi XW JY-1 JY-2
GS-1 0.000 — — — — — — — — — — — — — — — — — — —
GS-2 0.208* 0.000 — — — — — — — — — — — — — — — — — —
SC 0349* 0.025 0.000 — — — — — — — — — — — — — — — — —
Xin 0.009 0.091 0.252* 0.000 — — — — — — — — — — — — — — — —
XY-1 0.142 0.127 0.241 0.086 0.000 — — — — — — — — — — — — — — —
XY-2 0.284 0.004 -0.07 0.209* 0.251 0.000 — — — — — — — — — — — — — —
TB-1 0574* 0.287 0,2061 0.463* 0.449* 0.189 0.000 — — — — — — — — — — — —
TB-2 0.318* 0.126 0.074 0.192* 0.251* 0.048 0.264 0.000 — — — — — — — — — — — —
WG 0.583* 0.395* 0.280* 0.470* 0.550* 0.233* 0.492* 0.336* 0.000 — — — — — — — — — — —
SP 0.057 0.060 0.117 0.051 −0.045 0.128 0387* 0.171 0.397* 0.000 — — — — — — — — — —
FC 0.548* 0.240 −0.057 0.457* 0.467* 0.125 0.331 0.257* 0.513* 0.336* 0.000 — — — — — — — — —
NZ 0.268* −0.048 −0.089 0.118 0.148* 0.034 0.205* 0.009 0.331* 0.07 0.026 0.000 — — — — — — — —
NX 0.405* 0.170 0.086 0.287* 0.242* 0.09 0.192 0.027 0.357* 0.224* 0.213 0.061 0.000 — — — — — — —
XiX 0.55 1* 0.369* 0.048 0.458* 0.508* 0.114 0.423* 0.310* 0.404* 0.344中 0.148 0.214 0.322* 0.000 — — — — — —
LuanC 0.59 1* 0.341* 0.008 0.491* 0.525* 0.142 0.381* 0.32* 0.410* 0.375* 0.075 0.157 0.310* −0.045 0.000 — — — — —
LuS 0.676 0.355* 0.084 0.525* 0597* 0.277* 0.550* 0.447* 0.693* 0.421* 0.062 0.168 0.433* 0.284* 0.062 0.000 — — — —
Qi 0.680* 0.605* 0.437* 0.587* 0.658* 0.397* 0.721* 0.577* 0.757* 0.472* 0.794* 0.536* 0.576* 0.284* 0.449* 0.876* 0.000 — — —
XW 0.544* 0.324* 0.118 0.401 0.516* 0. 140 0388 * 0.142 0.361* 0.360* 0.264* 0.178 0.273* 0.156 0.178 0.375* 0.527* 0.000 — —
JY-1 0.471* 0.269* 0.035 0.370* 0.449* 0.039 0.356 * −0.008 0.311* 0.278 0.227 0.123 0.212 0.033 0.105 0396* 0.468* −0.055 0.000 —
JY-2 0.603* 0.398* 0317* 0.457* 0.543* 0.256* 0.508* −0.057 0.575* 0.427* 0.576* 0.298* 0.298* 0.487* 0.496* 0.807* 0.883* 0.251* 0.074 0.000

Note: * refers to P < 0.05.

The F ST value of COI in Taihang Mountains was 0.480, with significant statistical significance (P < 0.01). According to its geographical location, it can be divided into two subgroups, namely, north and south subgroups. The genetic variation between groups and within populations was 49.25 and 52.31%, respectively. Table 7 refers to the F ST values of ITS-1–Cytb in Taihang Mountains. The F ST value in this area was 0.404, and the difference was statistically significant (P < 0.01). The genetic variation among groups, between populations, and within populations was 3.94, 36.54 and 59.52%, respectively. The range of F ST value of ITS-1–Cytb was −0.292–0.926190, among which 118 pairs showed differences (P < 0.05). XT-1 and JY-1 and PShan and HG had the smallest and largest genetic variation, respectively.

Table 7

F ST value of ITS-1–Cytb in Taihang Mountains

Population code LaiS Yi QY FP LingS PShan XT-1 XT-2 Qi XW JY-1 JY-2 LQ WT Yu ZQ PShun HG LC YC
LaiS 0.000 — — — — — — — — — — — — — — — — — — —
Yi 0.8142* 0.000 — — — — — — — — — — — — — — — — — —
QY 0.3364* 0.3821* 0.000 — — — — — — — — — — — — — — — — —
FP 0.0722 0.8723* 0.515* 0.000 — — — — — — — — — — — — — — — —
LingS 0.5874* 0.8712* 0.649* 0.055 0.000 — — — — — — — — — — — — — — —
PShan 0.8268* −0.0415 0.724* 0.638* 0.712 0.000 — — — — — — — — — — — — — —
XT-1 0.8768* 0.1785 0.723* −0.022 0.201 0.546 0.000 — — — — — — — — — — — — —
XT-2 0.5446* 0.4573* 0.268* 0.721* 0.845* 0.917* 0.141* 0.000 — — — — — — — — — — — —
Qi 0.4693* 0.4458* 0.521* 0.325* 0.840* 0.605* −0.043 0.745* 0.000 — — — — — — — — — — —
XW −0.0565 0.3587 0.525* 0.141 0.925* 0.312* 0.617* 0.505 0.146* 0.000 — — — — — — — — — —
JY-1 0.3677* 0.4768* 0.392* 0.168 0.008* 0.284* 0.267* 0.267* 0.302* 0.784* 0.000 — — — — — — — — —
JY-2 0.9618* 0.3823 0.165 0.224* 0.711* 0.298* 0.213* 0.212* −0.002 0.403* 0.234* 0.000 — — — — — — — —
LQ 0.3950* 0.4451* 0.692* 0.138 0.315* 0.312* 0.281* 0.284* −0.325 0.345* 0.233 0.234* 0.000 — — — — — — —
WT 0.7504* 0.2143 −0.163 0.458* 0.276* 0.614* 0.211 0.245* 0.058 0.321 0.290* 0.233 0.328* 0.000 — — — — —
Yu 0.5126* 0.6538* 0.07 0.712* 0.298* 0.845* 0.374* 0.374* −0.016 0.337 0.216* 0.290* 0.425* −0.161 0.000 — — — — —
ZQ 0.4693* 0.8206* 0.0612* 0.392* 0.288* 0.841 0.125 0.126 0.224 0.624 0.628* 0.216* 0.016 −2.524 0.311* 0.000 — — — —
PShun 0.5577* 0.8526* 0.059* 0.720* 0.586* 0.925 0.465* 0.456* 0.737* 0.041 0.234* 0.628* 0.015* 0.0151 0.665* 0.842* 0.000 — — —
HG 0.142 0.0625 0.192* 0.328* 0.606 0.811* 0.165* 0.015* 0.647* 0.822* 0.228 −0.051 −0.266 0.404* 0.387* 0.159 0.621* 0.000 —
LC 0.0487 0.0241 1.176 0.14 0.918* 0.735* 0.340* 0.345* 0.787* 0.857* 0.287* 0.454* 0.404* 0.324* 0.379* 0.078* 0.842* 0.624* 0.000 —
YC 0.2257 0.1696 2.168 0.167 0.715* 0.711 0.125* 0.125* 0.648* 0.581* 0.216* 0.301* 0.405* 0.404* 0.385* 0.668* 0.472* 0.061* 0.052* 0.000

Note: * refers to P < 0.05.

3.4 Haploid phylogeny and haplotype network analysis results

The haplotype MP tree and BI number were reconstructed from the combined sequences of three genes in the four mountains of Henan Province, and the topological structures of the two systems were consistent. A total of 87 haplotypes formed 6 haplotype groups, mainly concentrated in 1–3 lines of a total of 5 lines. Branch 1 includes 28 haplotypes of 10 geographic populations; Clade 2 includes 17 haplotypes of 12 geographic populations; clade 3 includes 29 haplotypes of 17 geographic populations. Figure 3 refers to the haplotype network of the four mountain systems in Henan. Since they are scattered in different geographic populations, they should show a correlation with the geographic location.

Figure 3 Haplotype network of four mountain systems in Henan province.
Figure 3

Haplotype network of four mountain systems in Henan province.

The haplotype MP tree and BI number were reconstructed from the COI–Cytb joint sequence in Taihang Mountains, and the topological structures of the two systems were consistent. A total of 46 haplotypes formed 3 haplotype groups, mainly concentrated in 1 line of a total of 3 lines. Figure 4 refers to the haplotype network diagram of Taihang Mountains. The results are consistent with those of phylogeny.

Figure 4 Haplotype network of Taihang Mountain area.
Figure 4

Haplotype network of Taihang Mountain area.

4 Discussion

Because of its unique biological characteristics, experiments on planarian are applicable to experimental animals in many fields. It has a strong regenerative capacity and is praised as an “immortal animal” by the biological community. Asian countries often use planarian japonica as a model animal to complete stem cell regeneration, development, and other research. European and American countries usually use Mediterranean planarian as a model animal for relevant research in these fields. A planarian can grow or regress to its own according to its own nutritional status and has advantages in building a good model of autophagy [8]. In addition, planarian has extremely high sensitivity to harmful substances and low indoor-feeding cost, so it is also considered as an ideal model animal in toxicology research.

It is believed that a clear and separate band of gene DNA of planarian was obtained by electrophoresis detection, indicating that the DNA extraction method with DNeasy Blood & Tissue Kit has high purity and integrity, with ideal extraction performance. However, researchers believe that the improved phenol chloroform method has a good effect on DNA extraction. The research results also found that the corresponding length of the three genes, Cytb, COI, and nuclear gene ITS-1 sequences in the four mountains of Henan Province, were 308, 805, and 632 bp, respectively, and the nucleotide diversity and haplotype diversity were 0.00212 and 0.975 respectively. The gene length of ITS-1 and Cytb in Taihang Mountains is 668 and 315 bp, respectively, with a total length of 984 bp. There are 10 shared haplotypes and 36 unique haplotypes, respectively. The population of the four mountain systems and Taihang Mountains in Henan Province may have experienced a genetic bottleneck, and then the population grew rapidly, but the population expansion period was short, and the accumulation of nucleotide variation was insufficient. A few domestic scholars have studied the population genetics and pedigree geography of species of Mediterranean planarian, namely, the model species for regeneration and development research. Leria et al. analyzed the genetic variation and population parameters of 11 populations of Mediterranean planarian based on mitochondrial gene COI, YB, and nuclear gene N13. The results show that the Mediterranean planarian forms an obvious pedigree pattern in its entire distribution area, namely, three branches in the west, middle, and southeast, and no haplotype is shared among the branches, thus confirming the hypothesis that the current distribution pattern of this species is formed by paleogeological events, and also suggesting the ancient Mediterranean planarian species [9,10,11]. Contrary to the local distribution of Mediterranean planarian, Dugesia sicula is the only worldwide species of the genus Tricerata in the Mediterranean region, and most of its populations are asexual populations that undergo fission reproduction. Researchers such as Harrath et al. evaluated 58 D the COI haplotype and nucleotide diversity of icula population, showed that the haplotype did not show geographical distribution [12,13,14]. The single-gene and joint-gene analysis results of the Japanese triangle planarian in the Taihang Mountains showed that the haplotype diversity of Yu population is 0. The reason may be that the terrain of this area is unique. Yu is located in the southwest of Zhangjiakou City, Hebei Province, at the junction of Mount Hengshan, Mount Taihang, and Mount Yanshan. Due to the development of the Taihang Mountain’s scenic area in recent years, human interference may be of serious concern, limiting the migration ability of the Japanese triangle planarian. The genetic diversity of the population is low [15,16,17]. In the study of the population of Japanese planarian in the four mountain systems of Henan Province, the haplotype phylogenetic tree based on the joint sequence of mitochondrial genes Cytb, COI, and nuclear gene 1ITS-I was basically consistent with the haplotype network diagram [18,19,20]. Similarly, in the study of the population of the Japanese planarian in the Taihang Mountains, the haplotype network diagram based on the COI single-gene sequence and the ITS-I–Cytb joint character sequence showed a genetic structure similar to the corresponding haplotype phylogenetic tree. The haplotype network relationship can directly see the evolutionary relationship between haplotypes. The haplotypes of each population of the four mountain systems in Henan Province and the Taihang Mountains are scattered among different geographic populations, and the haplotype topology does not show the distance relationship corresponding to the geographic location of the population. It shows that there is no obvious pedigree geographical pattern of planarian in the four mountain systems and different geographic populations in Taihang Mountains of Henan Province [21,22,23].

Scheel and other researchers used low-diffusion terrestrial planarian C. Bergi to conduct another comprehensive pedigree geography study. They found that most of the sampled areas have high genetic diversity, and the pedigree of common ancestors can be traced back to the Pleistocene. The values of all nucleic acid diversity and haplotype diversity were 0.00156 and 0.965, respectively. The genetic variation coefficients between populations and groups were 20.28% and 16.40%, respectively. The range of F ST value of ITS-1–Cytb–COI is −0.095–0.99712, and 190 pairs of the population showed differences. The F ST value of ITS-1–Cytb in Taihang Mountains is 0.404, and the difference is statistically significant. The genetic variation between groups, between populations, and within populations is 3.94, 36.54, and 59.52%, respectively. The range of F ST value of ITS-1–Cytb is −0.292–0.926190, and 118 pairs of the population showed differences. The haplotype–network relationship can directly see the evolutionary relationship between haplotypes. Different haplotypes of the four mountain systems in Henan Province and the Taihang Mountains are scattered in different geographic populations, and there is no correlation between the geographic location of and. This result is consistent with the result of phylogeny [24,25]. Species diffusion, geographical isolation, and recent human activities will affect the population structure of species, while geological and agricultural morphological changes such as mountains, plateaus, and basins, bottleneck effects, and other factors will also affect the genetic structure or population of species [26,27,28]. From Dabie Mountain to Tongbai Mountain and then to Funiu Mountain in Henan Province, from southeast to northwest, there are several mountains and rivers, forming a barrier of special geographical environment. Aquatic organizations, especially freshwater aquatic organizations, there are often obvious geographical barriers between different water systems and different geographic populations, and the relatively significant genetic differentiation between populations is usually related to different degrees of isolation, because these isolation will restrict the gene exchange between populations. The Dabie Mountains, Tongbai Mountains, and Funiu Mountains in Henan Province have complex landforms, and the geology has gone through multiple crustal movements and long-term denudation and accumulation, which may cause significant genetic differentiation among populations. Since the Cenozoic, the Taihang Mountains have also experienced multiple geological movements, forming a variety of highly heterogeneous features such as terrain, soil, climate, and vegetation. The unique and complex terrain has also produced isolation effect, which may hinder the genetic exchange between different geographic populations in Taihang Mountains, thus increasing the genetic variation among different populations and promoting the high differentiation of population genes. In addition, the genetic variation of species with strong diffusion ability among different geographic populations is small [29,30]. As a benthic animal, the Japanese planarian moves slowly in the freshwater environment where it lives, which makes it impossible to spread far away from the mouth. Therefore, the weak diffusion ability may be another reason for the great genetic differentiation of the Japanese planarian in the Dabie Mountains, Tongbai Mountains, Funiu Mountains, and Taihang Mountains of Henan Province. The four mountain systems in Henan and Taihang Mountains may be experiencing population decline, although not very significant. Regional climate type, terrain, natural environment, human activities, and other factors will affect the species diversity and population richness of a region. As a species of freshwater planarian, the Japanese planarian mainly lives in freshwater environments such as springs, streams, and lakes. In recent years, with the rapid development of mountain tourism, the freshwater environment where the planarian lives has been polluted or artificially destroyed. In addition, the drying up of water bodies in the context of global warming may be another direct reason for the decline of the population of Japanese planarian in Henan and Taihang Mountains. At the same time, the genetic diversity, population structure, and population history of Rhododendron taihang and the population analysis based on mitochondrial nuclear sequence: the research report on the reason for the decline of Rhododendron taihang in China pointed out the relationship between species and gene evolution, which further demonstrated that gene analysis contributed to the way and type of species change.

The genetic characteristics of the population of Triticollis japonicus in the four mountain systems of Henan Province and the Taihang Mountains show high haploid diversity and low nucleotide diversity. Triticollis japonicus may have experienced rapid population growth, but the expansion history is short and the accumulation of nucleotide variation is insufficient. Most populations have significant genetic differentiation, but phylogenetic analysis has not found obvious pedigree geographical pattern. This neutral experiment showed that population decline of the planarian might occur in the four mountain systems of Henan and Taihang Mountains. Relevant responsible departments need to take effective measures to reduce human interference and environmental pollution and strengthen the protection of Trionychia japonica populations.

  1. Funding information: There is no funding for this article.

  2. Conflict of interest: The authors declare that they have no competing interest.

  3. Data availability statement: The data used to support the findings of this study are available from the corresponding author upon request.

References

[1] Gui Z, Wu L, Cai H, Mu L, Yu JF, Fu SY, et al. Genetic diversity analysis of Dermacentor nuttalli within Inner Mongolia, China. Parasites Vectors. 2021;14(1):1–12.10.1186/s13071-021-04625-5Suche in Google Scholar PubMed PubMed Central

[2] Lampi S, Donner J, Anderson H, Pohjoismäki J. Variation in breeding practices and geographic isolation drive subpopulation differentiation, contributing to the loss of genetic diversity within dog breed lineages. Canine Med Genet. 2020;7(1):1–10.10.1186/s40575-020-00085-9Suche in Google Scholar PubMed PubMed Central

[3] Song CY, Sun ZC, Gao TX, Song N. Structure analysis of mitochondrial DNA control region sequences and its applications for the study of population genetic diversity of Acanthogobius ommaturus. Russ J Mar Biol. 2020;46(4):292–301.10.1134/S1063074020040082Suche in Google Scholar

[4] Gvozdanović K, Škorput D, Kušec ID, Salajpal K, Kušec G. Estimation of population differentiation using pedigree and molecular data in Black Slavonian pig. Acta Fytotechn Zootech. 2020;23:241–9.10.15414/afz.2020.23.mi-fpap.241-249Suche in Google Scholar

[5] Hateley S, Lopez-Izquierdo A, Jou CJ, Cho S, Schraiber JG, Song S, et al. The history and geographic distribution of a KCNQ1 atrial fibrillation risk allele. Nat Commun. 2021;12(1):1–10.10.1038/s41467-021-26741-7Suche in Google Scholar PubMed PubMed Central

[6] Reddien PW. Principles of regeneration revealed by the planarian eye. Curr OpCell Biol. 2021;73:19–25.10.1016/j.ceb.2021.05.001Suche in Google Scholar PubMed

[7] Raz AA, Wurtzel O, Reddien PW. Planarian stem cells specify fate yet retain potency during the cell cycle. Cell Stem Cell. 2021;28(7):1307–22.10.1016/j.stem.2021.03.021Suche in Google Scholar PubMed PubMed Central

[8] Durant F, Bischof J, Fields C, Morokuma J, LaPalme J, Hoi A, et al. The role of early bioelectric signals in the regeneration of planarian anterior/posterior polarity. Biophys J. 2019;116(5):948–61.10.1016/j.bpj.2019.01.029Suche in Google Scholar PubMed PubMed Central

[9] Leria L, Vila-Farré M, Solà E, Riutort M. Outstanding intraindividual genetic diversity in fissiparous planarians (Dugesia, Platyhelminthes) with facultative sex. BMC Evolut Biol. 2019;19(1):1–19.10.1186/s12862-019-1440-1Suche in Google Scholar PubMed PubMed Central

[10] Han Y, Zhang X, Liu P, Xu S, Chen D, Liu JN, et al. Microplastics exposure causes oxidative stress and microbiota dysbiosis in planarian Trionychia japonica. Environ Sci Pollut Res. 2022;29(19):28973–83.10.1007/s11356-022-18547-xSuche in Google Scholar PubMed

[11] Meddeb E, Charni M, Abdallah RB, Raboudi F, Fattouch S. A molecular study of Tunisian populations of Dugesia sicula (Plathelminthes, Tricladida) through an identification of a set of genes. Comptes Rendus Biol. 2019;342(9–10):291–8.10.1016/j.crvi.2019.10.005Suche in Google Scholar PubMed

[12] Harrath AH, Sluys R, Mansour L, Lekeufack Folefack G, Aldahmash W, Alwasel S, et al. Molecular and morphological identification of two new African species of Dugesia (Platyhelminthes, Tricladida, Dugesiidae) from Cameroon. J Nat History. 2019;53(5–6):253–71.10.1080/00222933.2019.1577508Suche in Google Scholar

[13] Cao Z, Rosenkranz D, Wu S, Liu H, Pang Q, Zhang X, et al. Different classes of small RNAs are essential for head regeneration in the planarian Trionychia japonica. BMC Genomics. 2020;21(1):1–11.10.1186/s12864-020-07234-1Suche in Google Scholar PubMed PubMed Central

[14] Stocchino GA, Dols-Serrate D, Sluys R, Riutort M, Onnis C, Manconi R. Amphibioplanidae: a new branch and family on the phylogenetic tree of the triclad flatworms (Platyhelminthes: Tricladida), represented by a species from Sardinian caves with a remarkable lifestyle. Zool J Linn Soc. 2021;193(4):1364–91.10.1093/zoolinnean/zlaa183Suche in Google Scholar

[15] Scheel A, Stevens A, Tenbrock C. Signaling gradients in surface dynamics as basis for planarian regeneration. J Math Biol. 2021;83(1):1–31.10.1007/s00285-021-01627-wSuche in Google Scholar PubMed

[16] Dols-Serrate D, Leria L, Aguilar JP, Stocchino GA, Riutort M. Dugesia hepta and Dugesia benazzii (Platyhelminthes: Tricladida): Two sympatric species with occasional sex? Org Diversity Evol. 2020;20(3):369–86.10.1007/s13127-020-00438-zSuche in Google Scholar

[17] Negrete L, Do Amaral SV, Ribeiro GG, Wolmann Gonçalves J, Valiati VH, Damborenea C, et al. Far away, so close! Integrative taxonomy reveals a new genus and species of land flatworm (Platyhelminthes: Geoplanidae) from southern South America. Zool J Linn Soc. 2020;189(3):722–44.10.1093/zoolinnean/zlz131Suche in Google Scholar

[18] Zhang H, Hu T, Shi C, Chen G, Liu D. Genetic diversity, population structure and demographic history of Dugesia japonica in Taihang mountains. Zool Syst. 2021;46(2):153–62.Suche in Google Scholar

[19] Zhang H. Population analysis based on Mito-nuclear sequences: Implication of Dugesia japonica decline in Taihang Mountains, China. Pak J Zool. 2023;55(2):571–80.10.17582/journal.pjz/20201004031021Suche in Google Scholar

[20] Krishna S, Palakodeti D, Solana J. Post-transcriptional regulation in planarian stem cells. Semin Cell Dev Biol. 2019;87:69–78.10.1016/j.semcdb.2018.05.013Suche in Google Scholar PubMed

[21] Lenguas Francavilla M, Negrete L, Martínez-Aquino A, Damborenea C, Brusa F. Two new freshwater planarian species (Platyhelminthes: Tricladida: Dugesiidae) partially sympatric in Argentinean Patagonia. Can J Zool. 2021;99(4):269–78.10.1139/cjz-2020-0169Suche in Google Scholar

[22] Baguñà J. Planarian regeneration between 1960s and 1990s: From skilful baffled ancestors to bold integrative descendants. A personal account. Semin Cell Dev Biol. 2019;87:3–12.10.1016/j.semcdb.2018.04.011Suche in Google Scholar PubMed

[23] Inoue T, Agata K. Quantification of planarian behaviors. Dev Growth Differ. 2022;64(1):16–37.10.1111/dgd.12765Suche in Google Scholar PubMed

[24] Wang Q, Sun X, Xiao J, Kong Z, Pang L, Dong Z, et al. Djptpn11 is indispensable for planarian regeneration by affecting early wound response genes expression and the Wnt pathway. Biochimie. 2022;201:184–95.10.1016/j.biochi.2022.07.007Suche in Google Scholar PubMed

[25] Inoue K, Pohl AL, Sei M, Lang BK, Berg DJ. Use of species delimitation approaches to assess biodiversity in freshwater planaria (Platyhelminthes, Tricladida) from desert springs. Aquat Conserv Mar Freshw Ecosyst. 2020;30(2):209–18.10.1002/aqc.3273Suche in Google Scholar

[26] García-Castro H, Kenny NJ, Iglesias M, Álvarez-Campos P, Mason V, Elek A, et al. ACME dissociation: A versatile cell fixation-dissociation method for single-cell transcriptomics. Genome Biol. 2021;22(1):1–34.10.1186/s13059-021-02302-5Suche in Google Scholar PubMed PubMed Central

[27] Marques AD, Hartmann A, Valiati VH, Leal-zanchet AM. Two new land planarian species (Platyhelminthes: Tricladida) from the Cerrado biome in southwestern Brazil. Zootaxa. 2022;5205(4):301–30.10.11646/zootaxa.5205.4.1Suche in Google Scholar

[28] Negrete L, Francavilla ML, Damborenea C, Brusa F. A new genus of land planarian (Platyhelminthes, Geoplanidae) for a new ‘blind’ species. Syst Biodivers. 2022;20(1):1–16.10.1080/14772000.2022.2046200Suche in Google Scholar

[29] Zhen H, Deng H, Song Q, Zheng M, Yuan Z, Cao Z, et al. The Wnt/Ca2 + signaling pathway is essential for the regeneration of GABAergic neurons in planarian Dugesia japonica. FASEB J. 2020;34(12):16567–80.10.1096/fj.201903040RRSuche in Google Scholar PubMed

[30] Roberts DM, Boag B, Hunter F, Tarlton J, Mackenzie K, Neilson R. Genetic variability of Arthurdendyus triangulatus (Dendy, 1894), a non-native invasive land planarian. Zootaxa. 2020;4808(1):38–50.10.11646/zootaxa.4808.1.2Suche in Google Scholar PubMed

Received: 2022-12-12
Revised: 2023-02-19
Accepted: 2023-02-21
Published Online: 2023-04-10

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Regular Articles
  2. Diagenesis and evolution of deep tight reservoirs: A case study of the fourth member of Shahejie Formation (cg: 50.4-42 Ma) in Bozhong Sag
  3. Petrography and mineralogy of the Oligocene flysch in Ionian Zone, Albania: Implications for the evolution of sediment provenance and paleoenvironment
  4. Biostratigraphy of the Late Campanian–Maastrichtian of the Duwi Basin, Red Sea, Egypt
  5. Structural deformation and its implication for hydrocarbon accumulation in the Wuxia fault belt, northwestern Junggar basin, China
  6. Carbonate texture identification using multi-layer perceptron neural network
  7. Metallogenic model of the Hongqiling Cu–Ni sulfide intrusions, Central Asian Orogenic Belt: Insight from long-period magnetotellurics
  8. Assessments of recent Global Geopotential Models based on GPS/levelling and gravity data along coastal zones of Egypt
  9. Accuracy assessment and improvement of SRTM, ASTER, FABDEM, and MERIT DEMs by polynomial and optimization algorithm: A case study (Khuzestan Province, Iran)
  10. Uncertainty assessment of 3D geological models based on spatial diffusion and merging model
  11. Evaluation of dynamic behavior of varved clays from the Warsaw ice-dammed lake, Poland
  12. Impact of AMSU-A and MHS radiances assimilation on Typhoon Megi (2016) forecasting
  13. Contribution to the building of a weather information service for solar panel cleaning operations at Diass plant (Senegal, Western Sahel)
  14. Measuring spatiotemporal accessibility to healthcare with multimodal transport modes in the dynamic traffic environment
  15. Mathematical model for conversion of groundwater flow from confined to unconfined aquifers with power law processes
  16. NSP variation on SWAT with high-resolution data: A case study
  17. Reconstruction of paleoglacial equilibrium-line altitudes during the Last Glacial Maximum in the Diancang Massif, Northwest Yunnan Province, China
  18. A prediction model for Xiangyang Neolithic sites based on a random forest algorithm
  19. Determining the long-term impact area of coastal thermal discharge based on a harmonic model of sea surface temperature
  20. Origin of block accumulations based on the near-surface geophysics
  21. Investigating the limestone quarries as geoheritage sites: Case of Mardin ancient quarry
  22. Population genetics and pedigree geography of Trionychia japonica in the four mountains of Henan Province and the Taihang Mountains
  23. Performance audit evaluation of marine development projects based on SPA and BP neural network model
  24. Study on the Early Cretaceous fluvial-desert sedimentary paleogeography in the Northwest of Ordos Basin
  25. Detecting window line using an improved stacked hourglass network based on new real-world building façade dataset
  26. Automated identification and mapping of geological folds in cross sections
  27. Silicate and carbonate mixed shelf formation and its controlling factors, a case study from the Cambrian Canglangpu formation in Sichuan basin, China
  28. Ground penetrating radar and magnetic gradient distribution approach for subsurface investigation of solution pipes in post-glacial settings
  29. Research on pore structures of fine-grained carbonate reservoirs and their influence on waterflood development
  30. Risk assessment of rain-induced debris flow in the lower reaches of Yajiang River based on GIS and CF coupling models
  31. Multifractal analysis of temporal and spatial characteristics of earthquakes in Eurasian seismic belt
  32. Surface deformation and damage of 2022 (M 6.8) Luding earthquake in China and its tectonic implications
  33. Differential analysis of landscape patterns of land cover products in tropical marine climate zones – A case study in Malaysia
  34. DEM-based analysis of tectonic geomorphologic characteristics and tectonic activity intensity of the Dabanghe River Basin in South China Karst
  35. Distribution, pollution levels, and health risk assessment of heavy metals in groundwater in the main pepper production area of China
  36. Study on soil quality effect of reconstructing by Pisha sandstone and sand soil
  37. Understanding the characteristics of loess strata and quaternary climate changes in Luochuan, Shaanxi Province, China, through core analysis
  38. Dynamic variation of groundwater level and its influencing factors in typical oasis irrigated areas in Northwest China
  39. Creating digital maps for geotechnical characteristics of soil based on GIS technology and remote sensing
  40. Changes in the course of constant loading consolidation in soil with modeled granulometric composition contaminated with petroleum substances
  41. Correlation between the deformation of mineral crystal structures and fault activity: A case study of the Yingxiu-Beichuan fault and the Milin fault
  42. Cognitive characteristics of the Qiang religious culture and its influencing factors in Southwest China
  43. Spatiotemporal variation characteristics analysis of infrastructure iron stock in China based on nighttime light data
  44. Interpretation of aeromagnetic and remote sensing data of Auchi and Idah sheets of the Benin-arm Anambra basin: Implication of mineral resources
  45. Building element recognition with MTL-AINet considering view perspectives
  46. Characteristics of the present crustal deformation in the Tibetan Plateau and its relationship with strong earthquakes
  47. Influence of fractures in tight sandstone oil reservoir on hydrocarbon accumulation: A case study of Yanchang Formation in southeastern Ordos Basin
  48. Nutrient assessment and land reclamation in the Loess hills and Gulch region in the context of gully control
  49. Handling imbalanced data in supervised machine learning for lithological mapping using remote sensing and airborne geophysical data
  50. Spatial variation of soil nutrients and evaluation of cultivated land quality based on field scale
  51. Lignin analysis of sediments from around 2,000 to 1,000 years ago (Jiulong River estuary, southeast China)
  52. Assessing OpenStreetMap roads fitness-for-use for disaster risk assessment in developing countries: The case of Burundi
  53. Transforming text into knowledge graph: Extracting and structuring information from spatial development plans
  54. A symmetrical exponential model of soil temperature in temperate steppe regions of China
  55. A landslide susceptibility assessment method based on auto-encoder improved deep belief network
  56. Numerical simulation analysis of ecological monitoring of small reservoir dam based on maximum entropy algorithm
  57. Morphometry of the cold-climate Bory Stobrawskie Dune Field (SW Poland): Evidence for multi-phase Lateglacial aeolian activity within the European Sand Belt
  58. Adopting a new approach for finding missing people using GIS techniques: A case study in Saudi Arabia’s desert area
  59. Geological earthquake simulations generated by kinematic heterogeneous energy-based method: Self-arrested ruptures and asperity criterion
  60. Semi-automated classification of layered rock slopes using digital elevation model and geological map
  61. Geochemical characteristics of arc fractionated I-type granitoids of eastern Tak Batholith, Thailand
  62. Lithology classification of igneous rocks using C-band and L-band dual-polarization SAR data
  63. Analysis of artificial intelligence approaches to predict the wall deflection induced by deep excavation
  64. Evaluation of the current in situ stress in the middle Permian Maokou Formation in the Longnüsi area of the central Sichuan Basin, China
  65. Utilizing microresistivity image logs to recognize conglomeratic channel architectural elements of Baikouquan Formation in slope of Mahu Sag
  66. Resistivity cutoff of low-resistivity and low-contrast pays in sandstone reservoirs from conventional well logs: A case of Paleogene Enping Formation in A-Oilfield, Pearl River Mouth Basin, South China Sea
  67. Examining the evacuation routes of the sister village program by using the ant colony optimization algorithm
  68. Spatial objects classification using machine learning and spatial walk algorithm
  69. Study on the stabilization mechanism of aeolian sandy soil formation by adding a natural soft rock
  70. Bump feature detection of the road surface based on the Bi-LSTM
  71. The origin and evolution of the ore-forming fluids at the Manondo-Choma gold prospect, Kirk range, southern Malawi
  72. A retrieval model of surface geochemistry composition based on remotely sensed data
  73. Exploring the spatial dynamics of cultural facilities based on multi-source data: A case study of Nanjing’s art institutions
  74. Study of pore-throat structure characteristics and fluid mobility of Chang 7 tight sandstone reservoir in Jiyuan area, Ordos Basin
  75. Study of fracturing fluid re-discharge based on percolation experiments and sampling tests – An example of Fuling shale gas Jiangdong block, China
  76. Impacts of marine cloud brightening scheme on climatic extremes in the Tibetan Plateau
  77. Ecological protection on the West Coast of Taiwan Strait under economic zone construction: A case study of land use in Yueqing
  78. The time-dependent deformation and damage constitutive model of rock based on dynamic disturbance tests
  79. Evaluation of spatial form of rural ecological landscape and vulnerability of water ecological environment based on analytic hierarchy process
  80. Fingerprint of magma mixture in the leucogranites: Spectroscopic and petrochemical approach, Kalebalta-Central Anatolia, Türkiye
  81. Principles of self-calibration and visual effects for digital camera distortion
  82. UAV-based doline mapping in Brazilian karst: A cave heritage protection reconnaissance
  83. Evaluation and low carbon ecological urban–rural planning and construction based on energy planning mechanism
  84. Modified non-local means: A novel denoising approach to process gravity field data
  85. A novel travel route planning method based on an ant colony optimization algorithm
  86. Effect of time-variant NDVI on landside susceptibility: A case study in Quang Ngai province, Vietnam
  87. Regional tectonic uplift indicated by geomorphological parameters in the Bahe River Basin, central China
  88. Computer information technology-based green excavation of tunnels in complex strata and technical decision of deformation control
  89. Spatial evolution of coastal environmental enterprises: An exploration of driving factors in Jiangsu Province
  90. A comparative assessment and geospatial simulation of three hydrological models in urban basins
  91. Aquaculture industry under the blue transformation in Jiangsu, China: Structure evolution and spatial agglomeration
  92. Quantitative and qualitative interpretation of community partitions by map overlaying and calculating the distribution of related geographical features
  93. Numerical investigation of gravity-grouted soil-nail pullout capacity in sand
  94. Analysis of heavy pollution weather in Shenyang City and numerical simulation of main pollutants
  95. Road cut slope stability analysis for static and dynamic (pseudo-static analysis) loading conditions
  96. Forest biomass assessment combining field inventorying and remote sensing data
  97. Late Jurassic Haobugao granites from the southern Great Xing’an Range, NE China: Implications for postcollision extension of the Mongol–Okhotsk Ocean
  98. Petrogenesis of the Sukadana Basalt based on petrology and whole rock geochemistry, Lampung, Indonesia: Geodynamic significances
  99. Numerical study on the group wall effect of nodular diaphragm wall foundation in high-rise buildings
  100. Water resources utilization and tourism environment assessment based on water footprint
  101. Geochemical evaluation of the carbonaceous shale associated with the Permian Mikambeni Formation of the Tuli Basin for potential gas generation, South Africa
  102. Detection and characterization of lineaments using gravity data in the south-west Cameroon zone: Hydrogeological implications
  103. Study on spatial pattern of tourism landscape resources in county cities of Yangtze River Economic Belt
  104. The effect of weathering on drillability of dolomites
  105. Noise masking of near-surface scattering (heterogeneities) on subsurface seismic reflectivity
  106. Query optimization-oriented lateral expansion method of distributed geological borehole database
  107. Petrogenesis of the Morobe Granodiorite and their shoshonitic mafic microgranular enclaves in Maramuni arc, Papua New Guinea
  108. Environmental health risk assessment of urban water sources based on fuzzy set theory
  109. Spatial distribution of urban basic education resources in Shanghai: Accessibility and supply-demand matching evaluation
  110. Spatiotemporal changes in land use and residential satisfaction in the Huai River-Gaoyou Lake Rim area
  111. Walkaway vertical seismic profiling first-arrival traveltime tomography with velocity structure constraints
  112. Study on the evaluation system and risk factor traceability of receiving water body
  113. Predicting copper-polymetallic deposits in Kalatag using the weight of evidence model and novel data sources
  114. Temporal dynamics of green urban areas in Romania. A comparison between spatial and statistical data
  115. Passenger flow forecast of tourist attraction based on MACBL in LBS big data environment
  116. Varying particle size selectivity of soil erosion along a cultivated catena
  117. Relationship between annual soil erosion and surface runoff in Wadi Hanifa sub-basins
  118. Influence of nappe structure on the Carboniferous volcanic reservoir in the middle of the Hongche Fault Zone, Junggar Basin, China
  119. Dynamic analysis of MSE wall subjected to surface vibration loading
  120. Pre-collisional architecture of the European distal margin: Inferences from the high-pressure continental units of central Corsica (France)
  121. The interrelation of natural diversity with tourism in Kosovo
  122. Assessment of geosites as a basis for geotourism development: A case study of the Toplica District, Serbia
  123. IG-YOLOv5-based underwater biological recognition and detection for marine protection
  124. Monitoring drought dynamics using remote sensing-based combined drought index in Ergene Basin, Türkiye
  125. Review Articles
  126. The actual state of the geodetic and cartographic resources and legislation in Poland
  127. Evaluation studies of the new mining projects
  128. Comparison and significance of grain size parameters of the Menyuan loess calculated using different methods
  129. Scientometric analysis of flood forecasting for Asia region and discussion on machine learning methods
  130. Rainfall-induced transportation embankment failure: A review
  131. Rapid Communication
  132. Branch fault discovered in Tangshan fault zone on the Kaiping-Guye boundary, North China
  133. Technical Note
  134. Introducing an intelligent multi-level retrieval method for mineral resource potential evaluation result data
  135. Erratum
  136. Erratum to “Forest cover assessment using remote-sensing techniques in Crete Island, Greece”
  137. Addendum
  138. The relationship between heat flow and seismicity in global tectonically active zones
  139. Commentary
  140. Improved entropy weight methods and their comparisons in evaluating the high-quality development of Qinghai, China
  141. Special Issue: Geoethics 2022 - Part II
  142. Loess and geotourism potential of the Braničevo District (NE Serbia): From overexploitation to paleoclimate interpretation
https://doi.org/10.1515/geo-2022-0464
Schlagwörter für diesen Artikel
Japanese planarian; Henan; four mountain systems; Taihang Mountains; population genetics; pedigree geography; genetic diversity
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Regular Articles
  2. Diagenesis and evolution of deep tight reservoirs: A case study of the fourth member of Shahejie Formation (cg: 50.4-42 Ma) in Bozhong Sag
  3. Petrography and mineralogy of the Oligocene flysch in Ionian Zone, Albania: Implications for the evolution of sediment provenance and paleoenvironment
  4. Biostratigraphy of the Late Campanian–Maastrichtian of the Duwi Basin, Red Sea, Egypt
  5. Structural deformation and its implication for hydrocarbon accumulation in the Wuxia fault belt, northwestern Junggar basin, China
  6. Carbonate texture identification using multi-layer perceptron neural network
  7. Metallogenic model of the Hongqiling Cu–Ni sulfide intrusions, Central Asian Orogenic Belt: Insight from long-period magnetotellurics
  8. Assessments of recent Global Geopotential Models based on GPS/levelling and gravity data along coastal zones of Egypt
  9. Accuracy assessment and improvement of SRTM, ASTER, FABDEM, and MERIT DEMs by polynomial and optimization algorithm: A case study (Khuzestan Province, Iran)
  10. Uncertainty assessment of 3D geological models based on spatial diffusion and merging model
  11. Evaluation of dynamic behavior of varved clays from the Warsaw ice-dammed lake, Poland
  12. Impact of AMSU-A and MHS radiances assimilation on Typhoon Megi (2016) forecasting
  13. Contribution to the building of a weather information service for solar panel cleaning operations at Diass plant (Senegal, Western Sahel)
  14. Measuring spatiotemporal accessibility to healthcare with multimodal transport modes in the dynamic traffic environment
  15. Mathematical model for conversion of groundwater flow from confined to unconfined aquifers with power law processes
  16. NSP variation on SWAT with high-resolution data: A case study
  17. Reconstruction of paleoglacial equilibrium-line altitudes during the Last Glacial Maximum in the Diancang Massif, Northwest Yunnan Province, China
  18. A prediction model for Xiangyang Neolithic sites based on a random forest algorithm
  19. Determining the long-term impact area of coastal thermal discharge based on a harmonic model of sea surface temperature
  20. Origin of block accumulations based on the near-surface geophysics
  21. Investigating the limestone quarries as geoheritage sites: Case of Mardin ancient quarry
  22. Population genetics and pedigree geography of Trionychia japonica in the four mountains of Henan Province and the Taihang Mountains
  23. Performance audit evaluation of marine development projects based on SPA and BP neural network model
  24. Study on the Early Cretaceous fluvial-desert sedimentary paleogeography in the Northwest of Ordos Basin
  25. Detecting window line using an improved stacked hourglass network based on new real-world building façade dataset
  26. Automated identification and mapping of geological folds in cross sections
  27. Silicate and carbonate mixed shelf formation and its controlling factors, a case study from the Cambrian Canglangpu formation in Sichuan basin, China
  28. Ground penetrating radar and magnetic gradient distribution approach for subsurface investigation of solution pipes in post-glacial settings
  29. Research on pore structures of fine-grained carbonate reservoirs and their influence on waterflood development
  30. Risk assessment of rain-induced debris flow in the lower reaches of Yajiang River based on GIS and CF coupling models
  31. Multifractal analysis of temporal and spatial characteristics of earthquakes in Eurasian seismic belt
  32. Surface deformation and damage of 2022 (M 6.8) Luding earthquake in China and its tectonic implications
  33. Differential analysis of landscape patterns of land cover products in tropical marine climate zones – A case study in Malaysia
  34. DEM-based analysis of tectonic geomorphologic characteristics and tectonic activity intensity of the Dabanghe River Basin in South China Karst
  35. Distribution, pollution levels, and health risk assessment of heavy metals in groundwater in the main pepper production area of China
  36. Study on soil quality effect of reconstructing by Pisha sandstone and sand soil
  37. Understanding the characteristics of loess strata and quaternary climate changes in Luochuan, Shaanxi Province, China, through core analysis
  38. Dynamic variation of groundwater level and its influencing factors in typical oasis irrigated areas in Northwest China
  39. Creating digital maps for geotechnical characteristics of soil based on GIS technology and remote sensing
  40. Changes in the course of constant loading consolidation in soil with modeled granulometric composition contaminated with petroleum substances
  41. Correlation between the deformation of mineral crystal structures and fault activity: A case study of the Yingxiu-Beichuan fault and the Milin fault
  42. Cognitive characteristics of the Qiang religious culture and its influencing factors in Southwest China
  43. Spatiotemporal variation characteristics analysis of infrastructure iron stock in China based on nighttime light data
  44. Interpretation of aeromagnetic and remote sensing data of Auchi and Idah sheets of the Benin-arm Anambra basin: Implication of mineral resources
  45. Building element recognition with MTL-AINet considering view perspectives
  46. Characteristics of the present crustal deformation in the Tibetan Plateau and its relationship with strong earthquakes
  47. Influence of fractures in tight sandstone oil reservoir on hydrocarbon accumulation: A case study of Yanchang Formation in southeastern Ordos Basin
  48. Nutrient assessment and land reclamation in the Loess hills and Gulch region in the context of gully control
  49. Handling imbalanced data in supervised machine learning for lithological mapping using remote sensing and airborne geophysical data
  50. Spatial variation of soil nutrients and evaluation of cultivated land quality based on field scale
  51. Lignin analysis of sediments from around 2,000 to 1,000 years ago (Jiulong River estuary, southeast China)
  52. Assessing OpenStreetMap roads fitness-for-use for disaster risk assessment in developing countries: The case of Burundi
  53. Transforming text into knowledge graph: Extracting and structuring information from spatial development plans
  54. A symmetrical exponential model of soil temperature in temperate steppe regions of China
  55. A landslide susceptibility assessment method based on auto-encoder improved deep belief network
  56. Numerical simulation analysis of ecological monitoring of small reservoir dam based on maximum entropy algorithm
  57. Morphometry of the cold-climate Bory Stobrawskie Dune Field (SW Poland): Evidence for multi-phase Lateglacial aeolian activity within the European Sand Belt
  58. Adopting a new approach for finding missing people using GIS techniques: A case study in Saudi Arabia’s desert area
  59. Geological earthquake simulations generated by kinematic heterogeneous energy-based method: Self-arrested ruptures and asperity criterion
  60. Semi-automated classification of layered rock slopes using digital elevation model and geological map
  61. Geochemical characteristics of arc fractionated I-type granitoids of eastern Tak Batholith, Thailand
  62. Lithology classification of igneous rocks using C-band and L-band dual-polarization SAR data
  63. Analysis of artificial intelligence approaches to predict the wall deflection induced by deep excavation
  64. Evaluation of the current in situ stress in the middle Permian Maokou Formation in the Longnüsi area of the central Sichuan Basin, China
  65. Utilizing microresistivity image logs to recognize conglomeratic channel architectural elements of Baikouquan Formation in slope of Mahu Sag
  66. Resistivity cutoff of low-resistivity and low-contrast pays in sandstone reservoirs from conventional well logs: A case of Paleogene Enping Formation in A-Oilfield, Pearl River Mouth Basin, South China Sea
  67. Examining the evacuation routes of the sister village program by using the ant colony optimization algorithm
  68. Spatial objects classification using machine learning and spatial walk algorithm
  69. Study on the stabilization mechanism of aeolian sandy soil formation by adding a natural soft rock
  70. Bump feature detection of the road surface based on the Bi-LSTM
  71. The origin and evolution of the ore-forming fluids at the Manondo-Choma gold prospect, Kirk range, southern Malawi
  72. A retrieval model of surface geochemistry composition based on remotely sensed data
  73. Exploring the spatial dynamics of cultural facilities based on multi-source data: A case study of Nanjing’s art institutions
  74. Study of pore-throat structure characteristics and fluid mobility of Chang 7 tight sandstone reservoir in Jiyuan area, Ordos Basin
  75. Study of fracturing fluid re-discharge based on percolation experiments and sampling tests – An example of Fuling shale gas Jiangdong block, China
  76. Impacts of marine cloud brightening scheme on climatic extremes in the Tibetan Plateau
  77. Ecological protection on the West Coast of Taiwan Strait under economic zone construction: A case study of land use in Yueqing
  78. The time-dependent deformation and damage constitutive model of rock based on dynamic disturbance tests
  79. Evaluation of spatial form of rural ecological landscape and vulnerability of water ecological environment based on analytic hierarchy process
  80. Fingerprint of magma mixture in the leucogranites: Spectroscopic and petrochemical approach, Kalebalta-Central Anatolia, Türkiye
  81. Principles of self-calibration and visual effects for digital camera distortion
  82. UAV-based doline mapping in Brazilian karst: A cave heritage protection reconnaissance
  83. Evaluation and low carbon ecological urban–rural planning and construction based on energy planning mechanism
  84. Modified non-local means: A novel denoising approach to process gravity field data
  85. A novel travel route planning method based on an ant colony optimization algorithm
  86. Effect of time-variant NDVI on landside susceptibility: A case study in Quang Ngai province, Vietnam
  87. Regional tectonic uplift indicated by geomorphological parameters in the Bahe River Basin, central China
  88. Computer information technology-based green excavation of tunnels in complex strata and technical decision of deformation control
  89. Spatial evolution of coastal environmental enterprises: An exploration of driving factors in Jiangsu Province
  90. A comparative assessment and geospatial simulation of three hydrological models in urban basins
  91. Aquaculture industry under the blue transformation in Jiangsu, China: Structure evolution and spatial agglomeration
  92. Quantitative and qualitative interpretation of community partitions by map overlaying and calculating the distribution of related geographical features
  93. Numerical investigation of gravity-grouted soil-nail pullout capacity in sand
  94. Analysis of heavy pollution weather in Shenyang City and numerical simulation of main pollutants
  95. Road cut slope stability analysis for static and dynamic (pseudo-static analysis) loading conditions
  96. Forest biomass assessment combining field inventorying and remote sensing data
  97. Late Jurassic Haobugao granites from the southern Great Xing’an Range, NE China: Implications for postcollision extension of the Mongol–Okhotsk Ocean
  98. Petrogenesis of the Sukadana Basalt based on petrology and whole rock geochemistry, Lampung, Indonesia: Geodynamic significances
  99. Numerical study on the group wall effect of nodular diaphragm wall foundation in high-rise buildings
  100. Water resources utilization and tourism environment assessment based on water footprint
  101. Geochemical evaluation of the carbonaceous shale associated with the Permian Mikambeni Formation of the Tuli Basin for potential gas generation, South Africa
  102. Detection and characterization of lineaments using gravity data in the south-west Cameroon zone: Hydrogeological implications
  103. Study on spatial pattern of tourism landscape resources in county cities of Yangtze River Economic Belt
  104. The effect of weathering on drillability of dolomites
  105. Noise masking of near-surface scattering (heterogeneities) on subsurface seismic reflectivity
  106. Query optimization-oriented lateral expansion method of distributed geological borehole database
  107. Petrogenesis of the Morobe Granodiorite and their shoshonitic mafic microgranular enclaves in Maramuni arc, Papua New Guinea
  108. Environmental health risk assessment of urban water sources based on fuzzy set theory
  109. Spatial distribution of urban basic education resources in Shanghai: Accessibility and supply-demand matching evaluation
  110. Spatiotemporal changes in land use and residential satisfaction in the Huai River-Gaoyou Lake Rim area
  111. Walkaway vertical seismic profiling first-arrival traveltime tomography with velocity structure constraints
  112. Study on the evaluation system and risk factor traceability of receiving water body
  113. Predicting copper-polymetallic deposits in Kalatag using the weight of evidence model and novel data sources
  114. Temporal dynamics of green urban areas in Romania. A comparison between spatial and statistical data
  115. Passenger flow forecast of tourist attraction based on MACBL in LBS big data environment
  116. Varying particle size selectivity of soil erosion along a cultivated catena
  117. Relationship between annual soil erosion and surface runoff in Wadi Hanifa sub-basins
  118. Influence of nappe structure on the Carboniferous volcanic reservoir in the middle of the Hongche Fault Zone, Junggar Basin, China
  119. Dynamic analysis of MSE wall subjected to surface vibration loading
  120. Pre-collisional architecture of the European distal margin: Inferences from the high-pressure continental units of central Corsica (France)
  121. The interrelation of natural diversity with tourism in Kosovo
  122. Assessment of geosites as a basis for geotourism development: A case study of the Toplica District, Serbia
  123. IG-YOLOv5-based underwater biological recognition and detection for marine protection
  124. Monitoring drought dynamics using remote sensing-based combined drought index in Ergene Basin, Türkiye
  125. Review Articles
  126. The actual state of the geodetic and cartographic resources and legislation in Poland
  127. Evaluation studies of the new mining projects
  128. Comparison and significance of grain size parameters of the Menyuan loess calculated using different methods
  129. Scientometric analysis of flood forecasting for Asia region and discussion on machine learning methods
  130. Rainfall-induced transportation embankment failure: A review
  131. Rapid Communication
  132. Branch fault discovered in Tangshan fault zone on the Kaiping-Guye boundary, North China
  133. Technical Note
  134. Introducing an intelligent multi-level retrieval method for mineral resource potential evaluation result data
  135. Erratum
  136. Erratum to “Forest cover assessment using remote-sensing techniques in Crete Island, Greece”
  137. Addendum
  138. The relationship between heat flow and seismicity in global tectonically active zones
  139. Commentary
  140. Improved entropy weight methods and their comparisons in evaluating the high-quality development of Qinghai, China
  141. Special Issue: Geoethics 2022 - Part II
  142. Loess and geotourism potential of the Braničevo District (NE Serbia): From overexploitation to paleoclimate interpretation
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 14.9.2025 von https://www.degruyterbrill.com/document/doi/10.1515/geo-2022-0464/html
Button zum nach oben scrollen