Home Development of alkaline phosphatase-scFv and its use for one-step enzyme-linked immunosorbent assay for His-tagged protein detection
Article Open Access

Development of alkaline phosphatase-scFv and its use for one-step enzyme-linked immunosorbent assay for His-tagged protein detection

  • Shuzhen He , Ruixian Xu , Huashan Yi , Zhixin Chen , Congjie Chen , Qiang Li , Qinqin Han , Xueshan Xia , Yuzhu Song EMAIL logo , Junwei Xu EMAIL logo and Jinyang Zhang EMAIL logo
Published/Copyright: November 11, 2022

Abstract

A histidine (His)-tag is composed of six His residues and typically exerts little influence on the structure and solubility of expressed recombinant fusion proteins. Purification methods for recombinant proteins containing His-tags are relatively well-established, thus His-tags are widely used in protein recombination technology. We established a one-step enzyme-linked immunosorbent assay (ELISA) for His-tagged recombinant proteins. We analyzed variable heavy and light chains of the anti-His-tag monoclonal antibody 4C9 and used BLAST analyses to determine variable zones in light (VL) and heavy chains (VH). VH, VL, and alkaline phosphatase (ALP) regions were connected via a linker sequence and ligated into the pGEX-4T-1 expression vector. Different recombinant proteins with His tags were used to evaluate and detect ALP-scFv activity. Antigen and anti-His-scFv-ALP concentrations for direct ELISA were optimized using the checkerboard method. ZIKV-NS1, CHIKV-E2, SCRV-N, and other His-tag fusion proteins demonstrated specific reactions with anti-His-scFv-ALP, which were accurate and reproducible when the antigen concentration was 50 µg mL−1 and the antibody concentration was 6.25 µg mL−1. For competitive ELISA, we observed a good linear relationship when coating concentrations of recombinant human anti-Müllerian hormone (hAMH) were between 0.78 and 12.5 µg mL−1. Our direct ELISA method is simple, rapid, and accurate. The scFv antibody can be purified using a prokaryotic expression system, which provides uniform product quality and reduces variations between batches.

1 Introduction

The advantages of enzyme-labeled antibodies in disease diagnostics and basic research are evidenced by their broad applications. These conjugates not only provide antibody specificity but also signals can be amplified by enzymatic conversion processes [1,2,3]. Traditional chemical coupling methods are costly, often with large variations between manufactured bioconjugates. Therefore, to reduce cost, polyclonal antiserum is typically used to prepare enzyme-labeled secondary antibodies. However, additional experimental steps prolong times and increase the probability of errors.

Histidine (His)-tags are indispensable tools in many research laboratories, as typically no interactions exist between His-tags and bacterial transcription or translation machinery, so tags exert little effects on target protein characteristics [4,5,6]. The molecular weight of the His-tag is <1 kDa, unlike the maltose binding protein-tag, which is significantly larger and leads to significant changes in fusion protein solubility, and also potential problems with protein expression and purification [7,8,9]. Additionally, His-tags mainly rely on the specificity of adjacent His residues to chelate divalent metal ions during purification processes, which makes His-tagged protein-associated purification processes simple and easy [10]. Recently, Yoshimatsu et al. reported a metal-free synthetic hydrogel copolymer with affinity and selectivity for His6-tagged peptides and proteins [11]. Traditional methods are still widely applied [12,13,14,15]. Indirect enzyme-linked immunosorbent assay (ELISA) is widely used to detect His-tagged proteins, but the process is time-consuming. Therefore, simpler and faster detection techniques are imperative [16].

The single-chain variable fragment (scFv) is a synthetic antibody, which is induced and expressed in Escherichia coli via genetic engineering. Its heavy chain (VH) and light chain variable regions (VL) are connected by a linker. When compared with typical antibodies, scFv has a low molecular weight while retaining high affinity for corresponding antigens [17]. Fortunately, this low molecular weight facilitates easy entry into different cell compartments [18]. The appearance of scFv is due to the possibility of viral contamination and high costs limit the clinical utility of monoclonal antibodies. Through genetic engineering, recombinant enzyme-scFv fusion antibodies have been constructed to avoid issues during second antibody use. Combining the alkaline phosphatase (ALP) gene with scFv has also provided several advantages in disease diagnostics, such as convenience, high stability, and sensitivity [19,20,21,22].

The VH and VL sequences of anti-His monoclonal antibody 4C9 [23] linked to ALP were expressed in a prokaryotic system. After purification, we generated anti-His-scFv-ALP that conveniently detected His-tag-related products in one-step ELISA did not require secondary antibody binding. ELISA is widely used in different detection fields, especially the pharmaceutical industry [24,25]. When compared with indirect ELISA, the one-step procedure saves time and money [26,27,28]. Therefore, anti-His-scFv-ALP was successfully prepared and used to establish a one-step ELISA to detect His-tagged fusion proteins [29]. Our procedure facilitates the rapid detection of related products in the laboratory, provides a reference for the further rapid detection of His-tag related products, and lays the foundation for subsequent studies.

2 Materials and methods

2.1 Materials

The pGEX-4T-1 plasmid, E. coli Rosetta (DE3) strain, ZIKV-NS1 [30,31], CHIKV-E2, and SCRV-N [32] were stored in our laboratory. Para-Nitrophenylphosphate (pNPP) color development reagent was purchased from Makewonder Biotechnology Co., Ltd (Beijing, China). Glutathione S-transferase (GST) purification columns were purchased from Beyotime Biotechnology Co., Ltd (Shanghai, China). Other reagents were analytically pure.

2.2 Methods

2.2.1 Identification and analysis of the variable region of a monoclonal antibody against His-tagged protein

Total RNA was extracted from 4C9 subcloned hybridoma cells using Trizol (Invitrogen, USA). First-strand cDNA was synthesized from total RNA using a reverse transcription kit (Vazyme, China). cDNAs encoding the antibody variable domains (VH and VL) were amplified by polymerase chain reaction (PCR) and cloned into the pMD-19T vector and sent to TSINGKE Biotechnology Co., Ltd (Kunming, China) for sequence analysis. Confirmed cDNA sequences were compared with nucleotide sequences at GenBank (https://www.ncbi.nlm.nih.gov/igblast/igblast.cgi).

2.2.2 ALP-scFv for His-tagged fusion protein was sequenced and synthesized

After total RNA extraction, a cDNA library was generated by reverse transcription. Specific primers amplifying VL (For: GAGATTGTGATCACCCAGACTCCA; Rev: GATGCTGCACCAACTGTATCC) and VH (For: GAAGTCCAGCTGCAGGAGTC; Rev: GCCAAAACGACACCCCCATCTGTCTAT) were designed and synthesized by TSINGKE Biotechnology Co., Ltd (Kunming, China). The target sequence was then amplified by PCR. Heavy and light chains were connected via a linker, which was then conjugated to ALP (Figure 1a) and cloned into the pGEX-4T-1 vector (Figure 1b).

Figure 1 
                     (a) Schematic showing anti-His-scFv-ALP, (b) pGEX-4T-1-anti-His-scFv-ALP, (c) heavy chain variable region sequences of the anti-His monoclonal antibody 4C9, and (d) light chain variable region sequences of the anti-His monoclonal antibody 4C9.
Figure 1

(a) Schematic showing anti-His-scFv-ALP, (b) pGEX-4T-1-anti-His-scFv-ALP, (c) heavy chain variable region sequences of the anti-His monoclonal antibody 4C9, and (d) light chain variable region sequences of the anti-His monoclonal antibody 4C9.

2.2.3 Optimization of anti-His-scFv-ALP expression and purification conditions

pGEX-4T-1-anti-His-scFv-ALP was transformed into E. coli Rosetta cells [33], which were cultured overnight (37°C at 150 rpm) in LB medium plus 100 µg mL−1 ampicillin. Cells were divided into 1 mL aliquots and induced with 1.0 mM isopropyl-1-thio-β-d-galactopyranoside (IPTG) for 16 h at 100 rpm at 20°C or 37°C. Then, uninduced bacteria were supplemented with 0, 0.1, 0.2, 0.3, 0.4, 0.5, and 0.6 mM IPTG for 16 h at 100 rpm at 20°C. To identify ideal induction conditions, 300 mL of LB plus ampicillin was supplemented with 1 mL of overnight bacterial culture and cultured in a shaking incubator at 37°C and 180 rpm until the OD600nm reached 0.6. Anti-His-scFv-ALP fusion protein expression was induced by adding 0.5 mM IPTG at 20°C for 16 h at 100 rpm. Cells were collected by centrifugation (5,000 rpm for 10 min at 4°C) and resuspended in 40 mL of 0.01 M phosphate buffered saline (PBS) at pH 7.4. Cells were lysed by ultrasonication (200 W for 30 min), after which the lysate was centrifuged (10,000 rpm for 20 min at 4°C). The supernatant was collected and defined as the soluble protein fraction. The pellet was washed in 3 M urea (1 L 0.01 M PBS plus 3 M urea) and centrifuged for 20 min at 12,000 rpm at 4°C. The supernatant was discarded, and an appropriate volume of 1 L 0.01 M PBS plus 8 M urea was added to the pellet at 4°C until dissolution [34,35]. The volume was added to a dialysis bag, and precooled 0.01 M PBS plus 8, 6, 4, 2, and 0 M urea was used for dialysis at 4°C for 3–5 h, respectively, during which time solutions were replaced 2–3 times [36]. The supernatants and precipitates after renaturation were purified on a GST column (Beyotime, China), equilibrated in 20 mL of PBS and washed with 10 mL of elution buffer containing 20 mM Tris-HCl, 10 mM GSH, 1 mM DDT, pH 8.0 [37,38]. The anti-His-scFv-ALP conjugate was analyzed using the Bradford Protein Assay and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

2.2.4 Western blotting

Purified anti-His-scFv-ALP (GST-tag) from SDS-PAGE was transferred to a nitrocellulose membrane and non-specific sites blocked by soaking in 5% skimmed milk at 37°C for 2 h. The membrane was then washed five times in phosphate buffered saline tween-20 (PBST), incubated for 2 h with an anti-GST antibody at 37°C, washed, incubated with IgG-HRP for 1 h, and washed three times in PBST. Super enhanced chemiluminescent western blotting substrate (Biobest, Australian) was added and membrane signals observed under chemiluminescence imaging.

ZIKV-NS1 (His-tag) and JEV-NS1 (GST-tag) protein bands were similarly treated. Blots were incubated for 2 h with anti-His-scFv-ALP (10 µg mL−1) at 37°C, washed in PBST, and incubated with BCIP/NBT reagent (Beyotime, China) for 30 min in the dark, and signals observed directly.

2.2.5 Dot blot analysis

A grid was marked on a nitrocellulose membrane to indicate the blotting region. Using a narrow-mouth pipette tip, 2 μg ZIKV-NS1 (His-tag) and CHIKV-E2 (His-tag) were spotted to determine anti-His-scFv-ALP activity, while JEV-NS1 (GST-tag) and PBS were used as negative controls. After the membrane was dry, non-specific sites were blocked by soaking membranes in PBST plus skimmed milk at 37°C for 2 h. The membrane was incubated with anti-His-scFv-ALP (10 µg mL−1) in 5% skimmed milk for 2 h at 37°C, washed in PBST, incubated with BCIP/NBT reagent for 30 min in the dark, and signals observed directly.

2.2.6 Optimization of the direct ELISA method

Antigen and antibody concentrations were optimized using the checkerboard method. ZIKV-NS1 (His-tag), CHIKV-E2 (His-tag), and SCRV-N (His-tag) underwent a two-fold serial dilution in 50 mM carbonate coating buffer (pH 9.6) from 100 to 0.78 µg mL−1. Then 100 μL was added to wells in a 96-well plate and incubated at 37°C for 2 h using JEV-NS1 (GST-tag) as a negative control. The coating liquid was removed and washed with PBST for three times. PBST aliquots (200 μL) plus skimmed milk were used to block well for 2 h at 37°C. After buffer removal, purified anti-His-scFv-ALP was diluted in skimmed milk from 100 to 0.78 µg mL−1, after which 100 μL was added to wells and incubated at 37°C for 2 h. The antibody was removed and washed with PBST for three times. Then pNPP was added to wells and the plate incubated in the dark for 30 min, after which 50 μL of 2 N NaOH was added to quench reactions. The OD405nm was determined using a microplate reader. To reduce experimental error, experiments were performed three times (n = 3) and the data averaged.

2.2.7 Optimization of the competitive ELISA method

ZIKV-NS1 (His-tag) was diluted in 50 mM carbonate coating buffer (pH 9.6) to 10 µg mL−1, with 100 μL added to wells in a 96-well plate and incubated at 37°C for 2 h. JEV-NS1 (GST-tag) was used as a negative control. The coating liquid was removed and washed with PBST for three times. PBST aliquots (200 μL) plus skimmed milk were added to wells and blocking performed for 2 h at 37°C. After buffer was removed, human anti-Müllerian hormone (hAMH, His-tag) [39] was diluted from 100 to 0.78 µg mL−1. A 50 μL aliquot was then mixed with 50 μL anti-His-scFv-ALP (25 µg mL−1) and added to wells and incubated for 2 h at 37°C. Then, the solution was removed and washed with PBST for three times. pNPP was then added and the plate incubated in the dark for 30 min, after which 50 μL of 2 N NaOH was added to quench reactions. The OD405nm was determined using a microplate reader. To reduce experimental error, experiments were performed three times (n = 3) and the data averaged.

2.2.8 Statistical analysis

ELISA results underwent relative linear regression analysis in Graphpad Prism software, while one-way analysis of variance results were represented as mean ± standard deviation.

3 Results

3.1 Analysis of variable region sequences of heavy chain and light chain of anti-his monoclonal antibody

Antibody variable regions are divided into framework regions and complementarity determining regions. Our sequence analysis of VH and VL of the anti-His-tagged protein monoclonal antibody 4C9 is shown in Figure 1c and d. The antigen-binding sites of antibody 4C9 were successfully determined. Sequences were truncated as required to facilitate scFv construction and expression.

3.2 Optimization of anti-His-scFv-ALP expression and purification

After comparing different temperatures (Figure 2a) and IPTG concentrations (Figure 2b), 20°C and 0.5 mM IPTG were selected. Although inclusion body purification took longer, the yield was significantly higher when compared with supernatants (Figure 2c). Ultimately, a large amount of anti-His-scFv-ALP was obtained.

Figure 2 
                  Optimization of anti-His-scFv-ALP expression. (a) Induction temperature; (b) inducer concentrations; and (c) purification results: (1) marker, (2) supernatant after ultrasonic treatment, (3) precipitate after ultrasonic treatment, (4) the first fractions of anti-His-scFv-ALP purified from supernatant, (5) the second fractions of anti-His-scFv-ALP purified from supernatant, (6) the third fractions of anti-His-scFv-ALP purified in supernatant, (7) the first fractions of anti-His-scFv-ALP purified from precipitate, (8) the second fractions of anti-His-scFv-ALP purified from precipitate, (9) the third fractions of anti-His-scFv-ALP purified from precipitate, and (10) the fourth fractions of anti-His-scFv-ALP purified from precipitate.
Figure 2

Optimization of anti-His-scFv-ALP expression. (a) Induction temperature; (b) inducer concentrations; and (c) purification results: (1) marker, (2) supernatant after ultrasonic treatment, (3) precipitate after ultrasonic treatment, (4) the first fractions of anti-His-scFv-ALP purified from supernatant, (5) the second fractions of anti-His-scFv-ALP purified from supernatant, (6) the third fractions of anti-His-scFv-ALP purified in supernatant, (7) the first fractions of anti-His-scFv-ALP purified from precipitate, (8) the second fractions of anti-His-scFv-ALP purified from precipitate, (9) the third fractions of anti-His-scFv-ALP purified from precipitate, and (10) the fourth fractions of anti-His-scFv-ALP purified from precipitate.

3.3 Western blot and dot blot analyses

Western blot and dot blot are used to determine protein molecular weight and expression, especially for genetically engineered fusion proteins. Anti-GST antibody was used as the primary antibody in western blot analysis to identify anti-His-scFv-ALP (GST-tag). The target band had a molecular weight of 107 kDa, which indicated successful scFv purification (Figure 3a). ZIKV-NS1 (58 kDa, His-tag) could be observed, indicating that Anti-His-scFv-ALP is active (Figure 3b). We generated the same results by dot blot. A color reaction was determined on nitrocellulose membranes where His-tagged proteins such as ZIKV-NS1 and CHIKV-E2 were present, but nothing was observed for PBS or JEV-NS1 (Figure 3c). These results indicated that anti-His-scFv-ALP successfully bound to His-tagged proteins.

Figure 3 
                  Identification and characterization of anti-His-scFv-ALP. (a) Western blot, (b) direct western blot, and (c) dot blot. M, Marker: (1) loading sample is anti-His-scFv-ALP; (2) loading sample is ZIKV-NS1 (His-tag); (3) coating antigen is JEV-NS1 (GST-tag); (4) coating antigen is ZIKV-NS1 (His-tag); (5) coating antigen is PBS; (6) coating antigen is CHIKV-E2 (His-tag); and (7) coating antigen is JEV-NS1 (GST-tag).
Figure 3

Identification and characterization of anti-His-scFv-ALP. (a) Western blot, (b) direct western blot, and (c) dot blot. M, Marker: (1) loading sample is anti-His-scFv-ALP; (2) loading sample is ZIKV-NS1 (His-tag); (3) coating antigen is JEV-NS1 (GST-tag); (4) coating antigen is ZIKV-NS1 (His-tag); (5) coating antigen is PBS; (6) coating antigen is CHIKV-E2 (His-tag); and (7) coating antigen is JEV-NS1 (GST-tag).

3.4 Determination of anti-His-scFv-ALP activity using direct ELISA

The direct ELISA principle using ALP is shown in Figure 4a. Anti-His-scFv-ALP identified His-tagged proteins such as ZIKV-NS1, CHIKV-E2, and SCRV-N, which is shown in Figure 4b–d. When the antibody concentration was 6.25 µg mL−1, it effectively recognized several His-tagged proteins. As concentrations increased, the OD value did not significantly change. This suggested that at 6.25 µg mL−1, the antibody tended to saturate the system and detection results were more stable. When the antigen concentration was 50 µg mL−1 and the OD value > 0.8, this facilitated His-tagged protein detection. When antigen concentration was 50 µg mL−1, the OD value at an antibody concentration of 6.25 µg mL−1 was extremely significantly different from the OD value at an antibody concentration of 0.7825 µg mL−1, p < 0.0001. The OD value at an antibody concentration of 6.25 µg mL−1 was compared with the OD value at an antibody concentration of 100 µg mL−1, p < 0.01. Therefore, the antibody concentration of 6.25 µg mL−1was chosen as the best value to ensure the experimental results and save cost. A standard curve showed an R 2 value of >0.99, indicating good linear relativity. The linear equation from the standard curve was used to measure His-tagged protein concentrations by diluting reagents within the linear range and slotting values into the equation to calculate target protein concentrations.

Figure 4 
                  Direct anti-His-scFv-ALP ELISA. (a) Sketch map, (b) detection of His-tagged recombinant protein SCRV-N, (c) detection of His-tagged recombinant protein ZIKV-NS1, and (d) detection of His-tagged recombinant protein CHIKV-E2.
Figure 4

Direct anti-His-scFv-ALP ELISA. (a) Sketch map, (b) detection of His-tagged recombinant protein SCRV-N, (c) detection of His-tagged recombinant protein ZIKV-NS1, and (d) detection of His-tagged recombinant protein CHIKV-E2.

3.5 Development of a competitive ELISA method

Competitive ELISA principles using ALP are shown in Figure 5a. A standard curve was constructed using hAMH concentrations on the x-axis and hAMH OD405 nm values on the y-axis. When hAMH concentrations were between 0.78 and 12.5 µg mL−1, the absorbance had a linear relationship with concentration, with a large slope. Therefore, this region was selected for linear regression analysis (Figure 5b), with the fitting curve showing strong linearity in this region. Finally, a standard curve was constructed over this concentration range (Figure 5c); the standard curve equation was Y = −0.03971 × X + 1.734 (R 2 = 0.9773). This indicated that competitive ELISA results were more accurate when antigen concentrations were within this range.

Figure 5 
                  Competitive anti-His-scFv-ALP ELISA. (a) Sketch map, (b) detection of His-tagged recombinant protein hAMH, and (c) standard curve using His-tagged recombinant protein hAMH as a coating protein.
Figure 5

Competitive anti-His-scFv-ALP ELISA. (a) Sketch map, (b) detection of His-tagged recombinant protein hAMH, and (c) standard curve using His-tagged recombinant protein hAMH as a coating protein.

4 Discussion

The pGEX-4T-1 vector expressed a GST tag with a molecular weight of 26 kDa. The molecular weight of the GST tag recombinant protein was too large to form a soluble protein. Some methods can be used to increase soluble expression, reducing protein synthesis rates, changing the medium, co-expressing proteins with molecular chaperones, and allowing proteins to unfold and refold. We showed that recombinant anti-His-scFv-ALP was induced at a low temperature, produced poorly soluble expression products in E coli, with purified scFv failing to meet our study requirements. Therefore, we purified scFv from inclusion bodies using gradient urea renaturation. Dilution refolding, gradient dialysis, molecular sieve chromatography, and ion-exchange chromatography can be used to facilitate protein refolding [40]. When a high urea concentration is used for cracking and refolding, fusion proteins can be easily deactivated. After denaturing in urea, we used gradient dialysis to refold the anti-His-scFv-ALP. However, some shortcomings were observed [41]. Because antibody storage at 4°C causes activity loss over time, study manipulations were performed rapidly on ice.

Due to their short operating times and low costs, we used direct and competitive ELISA to identify proteins. However, reaction conditions required optimization. The checkerboard method was used to optimize antigen coating concentrations and optimal antibody working concentrations. These steps ensured that our method is more reliable for detecting His-tagged fusion proteins. Although several traditional methods have been used to detect His-tagged fusion proteins, e.g., western blotting or indirect ELISA, new methods have been developed and include immunosensors [42] or UVHis-PAGE [43], but these are expensive and require complex instrumentation. Our antibodies could be faster and more inexpensive for biosensor applications if material costs could be reduced. ELISA is a highly accurate and rapid method; it is effective, specific, and generates virtually no matrix effects in hybrid samples. Additionally, direct ELISA does not require secondary antibodies, which not only reduces costs but also shortens detection times. One-step western blots and dot blots have the same benefits. Thus, we showed that one-step ELISA is a promising detection tool, whereas anti-His-scFv-ALP is used to detect His-tagged proteins. Although similar antibodies are available [44], no in-depth method optimization has been performed. Our remit was to establish a method for the rapid detection of His-tagged proteins.

5 Conclusions

Due to high anti-His 4C9 potency, single-chain antibodies were prepared and purified to generate pure antibodies with good reactivity in both direct and competitive ELISA. The R 2 value was >0.97. Our method was rapid and straightforward and provided accurate and reproducible results. We focused on the establishment of different detection methods based on purified single-chain antibodies. Commercially available antibodies require the addition of HRP secondary antibodies, while anti-His tag-scFv-ALP directly uses ALP for color development, thereby reducing experimental steps and generating quicker results. Our next step is to generate efficient kits.


# These authors contributed equally to this work.

tel: +86-871-65939528

  1. Funding information: This work was supported by National Natural Science Foundation of China (Grant number 81860625) and Chongqing Basic Research Program (Grant number cstc2018jcyjAX0615).

  2. Author contributions: J.Z. conceived and designed the experiments. S.H., H.Y, R.X., and Z.C. performed the experiments. C.C. and Q.L. analyzed the data. Y.S., Q.H., X.X., and J.X. contributed reagents/materials/analysis tools. S.H. wrote the paper.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Nakane PK, Pierce GBJr. Enzyme-labeled antibodies: preparation and application for the localization of antigens. J Histochem Cytochem. 1966;14(12):929–31.10.1177/14.12.929Search in Google Scholar PubMed

[2] Roberts WS, Davis F, Holmes JL, Collyer SD, Larcombe LD, Morgan SL, et al. Detection and imaging the expression of the trans-membrane protein CD44 in RT112 cells by use of enzyme-labeled antibodies and SECM. Biosens Bioelectron. 2013;41:282–8.10.1016/j.bios.2012.08.038Search in Google Scholar PubMed

[3] Wu W, Li J, Pan D, Li J, Song S, Rong M, et al. Gold nanoparticle-based enzyme-linked antibody-aptamer sandwich assay for detection of Salmonella typhimurium. ACS Appl Mater Interfaces. 2014;6(19):16974–81.10.1021/am5045828Search in Google Scholar PubMed

[4] Wood DW. New trends and affinity tag designs for recombinant protein purification. Curr Opin Struct Biol. 2014;26:54–61.10.1016/j.sbi.2014.04.006Search in Google Scholar PubMed

[5] Young CL, Britton ZT, Robinson AS. Recombinant protein expression and purification: a comprehensive review of affinity tags and microbial applications. Biotechnol J. 2012;7(5):620–34.10.1002/biot.201100155Search in Google Scholar PubMed

[6] Geng WX, Zhang R, Dang JG, Wang Y, Li Z, Li LW. A histidine-rich elastin-like polypeptide functions as a quickly detectable and easily purifiable protein fusion tag. Biochem Biophys Res Commun. 2018;507(1-4):343–7.10.1016/j.bbrc.2018.11.038Search in Google Scholar PubMed

[7] Terpe K. Overview of bacterial expression systems for heterologous protein production: from molecular and biochemical fundamentals to commercial systems. Appl Microbiol Biotechnol. 2006;72(2):211–22.10.1007/s00253-006-0465-8Search in Google Scholar PubMed

[8] Bernier SC, Cantin L, Salesse C. Systematic analysis of the expression, solubility and purification of a passenger protein in fusion with different tags. Protein Expr Purif. 2018;152:92–106.10.1016/j.pep.2018.07.007Search in Google Scholar PubMed

[9] Bell MR, Engleka MJ, Malik A, Strickler JE. To fuse or not to fuse: what is your purpose? Protein Sci. 2013;22(11):1466–77.10.1002/pro.2356Search in Google Scholar PubMed PubMed Central

[10] Lin Z, Zhao Q, Xing L, Zhou B, Wang X. Aggregating tags for column-free protein purification. Biotechnol J. 2015;10(12):1877–86.10.1002/biot.201500299Search in Google Scholar PubMed

[11] Yoshimatsu K, Fruehauf KR, Zhu Q, Weisman A, Fan J. Metal-free polymer-based affinity medium for selective purification of His6-tagged proteins. 2021;22(4):1695–705.10.1021/acs.biomac.1c00119Search in Google Scholar PubMed

[12] Meng L, Liu Y, Yin X, Zhou H, Wu J, Wu M, et al. Effects of His-tag on catalytic activity and enantioselectivity of recombinant transaminases. Appl Biochem Biotechnol. 2020;190(3):880–95.10.1007/s12010-019-03117-8Search in Google Scholar PubMed

[13] de Almeida JM, Moure VR, Müller-Santos M, de Souza EM, Pedrosa FO, Mitchell DA, et al. Tailoring recombinant lipases: keeping the His-tag favors esterification reactions, removing it favors hydrolysis reactions. Sci Rep. 2018;8(1):10000.10.1038/s41598-018-27579-8Search in Google Scholar PubMed PubMed Central

[14] Wang F, Ren XF, Chen Z, Li XL, Zhu HJ, Li S, et al. The N-terminal His-tag affects the triglyceride lipase activity of hormone-sensitive lipase in testis. J Cell Biochem. 2019;120(8):13706–16.10.1002/jcb.28643Search in Google Scholar PubMed

[15] Paul NK, Baksh KA, Arias JF, Zamble DB. The impact of a His-tag on DNA binding by RNA polymerase alpha-C-terminal domain from Helicobacter pylori. Protein Expr Purif. 2020;167:105541.10.1016/j.pep.2019.105541Search in Google Scholar PubMed

[16] Wasowicz M, Milner M, Radecka D, Grzelak K, Radecka H. Immunosensor incorporating anti-His (C-term) IgG F(ab’) fragments attached to gold nanorods for detection of His-tagged proteins in culture medium. Sens (Basel). 2010;10(6):5409–24.10.3390/s100605409Search in Google Scholar PubMed PubMed Central

[17] Vaks L, Benhar I. Production of stabilized scFv antibody fragments in the E. coli bacterial cytoplasm. Methods Mol Biol. 2014;1060:171–84.10.1007/978-1-62703-586-6_10Search in Google Scholar PubMed

[18] Ahmad ZA, Yeap SK, Ali AM, Ho WY, Alitheen NB, Hamid M. scFv antibody: principles and clinical application. Clin Dev Immunol. 2012;2012:980250.10.1155/2012/980250Search in Google Scholar PubMed PubMed Central

[19] He J, Tao X, Wang K, Ding G, Li J, Li QX, et al. One-step immunoassay for the insecticide carbaryl using a chicken single-chain variable fragment (scFv) fused to alkaline phosphatase. Anal Biochem. 2019;572:9–15.10.1016/j.ab.2019.02.022Search in Google Scholar PubMed

[20] Dong JX, Li ZF, Lei HT, Sun YM, Ducancel F, Xu ZL, et al. Development of a single-chain variable fragment-alkaline phosphatase fusion protein and a sensitive direct competitive chemiluminescent enzyme immunoassay for detection of ractopamine in pork. Anal Chim Acta. 2012;736:85–91.10.1016/j.aca.2012.05.033Search in Google Scholar PubMed

[21] Xu ZL, Dong JX, Wang H, Li ZF, Beier RC, Jiang YM, et al. Production and characterization of a single-chain variable fragment linked alkaline phosphatase fusion protein for detection of O,O-diethyl organophosphorus pesticides in a one-step enzyme-linked immunosorbent assay. J Agric Food Chem. 2012;60(20):5076–83.10.1021/jf300570qSearch in Google Scholar PubMed

[22] Aiba H, Nishiya Y, Ojima Y, Azuma M. Over-expression, characterization, and modification of highly active alkaline phosphatase from a Shewanella genus bacterium. Biosci Biotechnol Biochem. 2017;81(10):1994–2001.10.1080/09168451.2017.1356217Search in Google Scholar PubMed

[23] Zhang J, Jin Z, Song Y, Han Q, Chen Q, Xia X. Hybridoma cell line 4C9 and its monoclonal antibody against His tag protein. CN patent 105695419A; 2016.Search in Google Scholar

[24] Ashish Kumar Sharma BPS. Triple verses glimepiride plus metformin therapy on cardiovascular risk biomarkers and diabetic cardiomyopathy in insulin resistance type 2 diabetes mellitus rats. Eur J Pharma Sci. 2009;38(5):433–44.10.1016/j.ejps.2009.09.004Search in Google Scholar PubMed

[25] Ashish Kumar Sharma SKR, Muneem Kumar Kurmi MK, Srinivasan BP. Gemfibrozil and its combination with metformin on pleiotropic effect on IL-10 and adiponectin and anti-atherogenic treatment in insulin resistant type 2 diabetes mellitus rats. Inflammopharmacology. 2013;21:137–45.10.1007/s10787-012-0154-4Search in Google Scholar PubMed

[26] Lequin RM. Enzyme immunoassay (EIA)/enzyme-linked immunosorbent assay (ELISA). Clin Chem. 2005;51(12):2415–8.10.1373/clinchem.2005.051532Search in Google Scholar PubMed

[27] Gan SD, Patel KR. Enzyme immunoassay and enzyme-linked immunosorbent assay. J Invest Dermatol. 2013;133(9):e12.10.1038/jid.2013.287Search in Google Scholar PubMed

[28] Kohl TO, Ascoli CA. Direct Competitive Enzyme-Linked Immunosorbent Assay (ELISA). Cold Spring Harb Protoc. 2017;2017(7):pdb prot093740.10.1101/pdb.prot093740Search in Google Scholar PubMed

[29] Sun H, Wu GM, Chen YY, Tian Y, Yue YH, Zhang GL. Expression, production, and renaturation of a functional single-chain variable antibody fragment (scFv) against human ICAM-1. Braz J Med Biol Res. 2014;47(7):540–7.10.1590/1414-431X20143276Search in Google Scholar PubMed PubMed Central

[30] Zhang L, Chen C, Chen Z, He S, Song Y, Xia X, et al. Generation and characterization of a polyclonal antibody against NS1 protein for detection of Zika Virus. Jundishapur J Microbiol. 2019;12(11):e96070.10.5812/jjm.96070Search in Google Scholar

[31] Zhang L, Du X, Chen C, Chen Z, Zhang L, Han Q, et al. Development and characterization of double-antibody sandwich ELISA for Detection of Zika Virus Infection. Viruses. 2018;10(11):634.10.3390/v10110634Search in Google Scholar PubMed PubMed Central

[32] Chen Z, Gong N, Niu J, Xu R, Yi H, Song Y, et al. Development and evaluation of nucleoprotein-based rapid detection test for Siniperca chuatsi rhabdovirus. Aquaculture. 2022;546:737403.10.1016/j.aquaculture.2021.737403Search in Google Scholar

[33] Bernier SC, Morency L-P, Najmanovich R, Salesse C. Identification of an alternative translation initiation site in the sequence of the commonly used Glutathione S-Transferase tag. J Biotechnol. 2018;286:14–6.10.1016/j.jbiotec.2018.09.003Search in Google Scholar PubMed

[34] Burgess RR. Refolding solubilized inclusion body proteins. Methods Enzymol. 2009;463:259–82.10.1016/S0076-6879(09)63017-2Search in Google Scholar PubMed

[35] Kaplan W, Hüsler P, Klump H, Erhardt J, Sluis-Cremer N, Dirr H. Conformational stability of pGEX-expressed Schistosoma japonicum glutathione S-transferase: a detoxification enzyme and fusion-protein affinity tag. Protein Sci. 1997;6(2):399–406.10.1002/pro.5560060216Search in Google Scholar PubMed PubMed Central

[36] Hashemzadeh MS, Mohammadi M, Ghaleh HEG, Sharti M, Choopani A, Panda AK. Expression, solubilization, refolding and final purification of recombinant proteins as expressed in the form of “classical inclusion bodies” in E. coli. Protein Pept Lett. 2021;28(2):122–30.10.2174/0929866527999200729182831Search in Google Scholar PubMed

[37] Park DW, Kim SS, Nam MK, Kim GY, Kim J, Rhim H. Improved recovery of active GST-fusion proteins from insoluble aggregates: solubilization and purification conditions using PKM2 and HtrA2 as model proteins. BMB Rep. 2011;44(4):279–84.10.5483/BMBRep.2011.44.4.279Search in Google Scholar PubMed

[38] Harper S, Speicher DW. Purification of proteins fused to glutathione S-transferase. 2011;681:259–80.10.1007/978-1-60761-913-0_14Search in Google Scholar PubMed PubMed Central

[39] Chen C, Yi H, Zhang L, Chen Z, He S, Han Q, et al. [Preparation and application of anti-Mullerian hormone immunomagnetic beads]. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2020;36(4):310–6.Search in Google Scholar

[40] Sarker A, Rathore AS, Gupta RD. Evaluation of scFv protein recovery from E. coli by in vitro refolding and mild solubilization process. Microb Cell Fact. 2019;18(1):5.10.1186/s12934-019-1053-9Search in Google Scholar PubMed PubMed Central

[41] Yamaguchi H, Miyazaki M. Refolding techniques for recovering biologically active recombinant proteins from inclusion bodies. Biomolecules. 2014;4(1):235–51.10.3390/biom4010235Search in Google Scholar PubMed PubMed Central

[42] Ren R, Lu D, Pang G. Development of a new and simple method for the detection of histidine-tagged proteins based on thionine-chitosan/gold anoparticles/horseradish peroxidase. Biomed Microdevices. 2020;22(1):11.10.1007/s10544-019-0464-zSearch in Google Scholar PubMed

[43] Raducanu VS, Isaioglou I, Raducanu DV, Merzaban JS, Hamdan SM. Simplified detection of polyhistidine-tagged proteins in gels and membranes using a UV-excitable dye and a multiple chelator head pair. J Biol Chem. 2020;295(34):12214–23.10.1074/jbc.RA120.014132Search in Google Scholar PubMed PubMed Central

[44] Lindner P, Bauer K, Krebber A, Nieba L, Kremmer E, Krebber C, et al. Specific detection of his-tagged proteins with recombinant anti-his tag scFv-phosphatase or scFv-phage fusions. BioTech. 1997;22:140–9.10.2144/97221rr01Search in Google Scholar PubMed

Received: 2022-07-16
Revised: 2022-09-12
Accepted: 2022-09-26
Published Online: 2022-11-11

© 2022 Shuzhen He et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Effects of direct oral anticoagulants dabigatran and rivaroxaban on the blood coagulation function in rabbits
  3. The mother of all battles: Viruses vs humans. Can humans avoid extinction in 50–100 years?
  4. Knockdown of G1P3 inhibits cell proliferation and enhances the cytotoxicity of dexamethasone in acute lymphoblastic leukemia
  5. LINC00665 regulates hepatocellular carcinoma by modulating mRNA via the m6A enzyme
  6. Association study of CLDN14 variations in patients with kidney stones
  7. Concanavalin A-induced autoimmune hepatitis model in mice: Mechanisms and future outlook
  8. Regulation of miR-30b in cancer development, apoptosis, and drug resistance
  9. Informatic analysis of the pulmonary microecology in non-cystic fibrosis bronchiectasis at three different stages
  10. Swimming attenuates tumor growth in CT-26 tumor-bearing mice and suppresses angiogenesis by mediating the HIF-1α/VEGFA pathway
  11. Characterization of intestinal microbiota and serum metabolites in patients with mild hepatic encephalopathy
  12. Functional conservation and divergence in plant-specific GRF gene family revealed by sequences and expression analysis
  13. Application of the FLP/LoxP-FRT recombination system to switch the eGFP expression in a model prokaryote
  14. Biomedical evaluation of antioxidant properties of lamb meat enriched with iodine and selenium
  15. Intravenous infusion of the exosomes derived from human umbilical cord mesenchymal stem cells enhance neurological recovery after traumatic brain injury via suppressing the NF-κB pathway
  16. Effect of dietary pattern on pregnant women with gestational diabetes mellitus and its clinical significance
  17. Potential regulatory mechanism of TNF-α/TNFR1/ANXA1 in glioma cells and its role in glioma cell proliferation
  18. Effect of the genetic mutant G71R in uridine diphosphate-glucuronosyltransferase 1A1 on the conjugation of bilirubin
  19. Quercetin inhibits cytotoxicity of PC12 cells induced by amyloid-beta 25–35 via stimulating estrogen receptor α, activating ERK1/2, and inhibiting apoptosis
  20. Nutrition intervention in the management of novel coronavirus pneumonia patients
  21. circ-CFH promotes the development of HCC by regulating cell proliferation, apoptosis, migration, invasion, and glycolysis through the miR-377-3p/RNF38 axis
  22. Bmi-1 directly upregulates glucose transporter 1 in human gastric adenocarcinoma
  23. Lacunar infarction aggravates the cognitive deficit in the elderly with white matter lesion
  24. Hydroxysafflor yellow A improved retinopathy via Nrf2/HO-1 pathway in rats
  25. Comparison of axon extension: PTFE versus PLA formed by a 3D printer
  26. Elevated IL-35 level and iTr35 subset increase the bacterial burden and lung lesions in Mycobacterium tuberculosis-infected mice
  27. A case report of CAT gene and HNF1β gene variations in a patient with early-onset diabetes
  28. Study on the mechanism of inhibiting patulin production by fengycin
  29. SOX4 promotes high-glucose-induced inflammation and angiogenesis of retinal endothelial cells by activating NF-κB signaling pathway
  30. Relationship between blood clots and COVID-19 vaccines: A literature review
  31. Analysis of genetic characteristics of 436 children with dysplasia and detailed analysis of rare karyotype
  32. Bioinformatics network analyses of growth differentiation factor 11
  33. NR4A1 inhibits the epithelial–mesenchymal transition of hepatic stellate cells: Involvement of TGF-β–Smad2/3/4–ZEB signaling
  34. Expression of Zeb1 in the differentiation of mouse embryonic stem cell
  35. Study on the genetic damage caused by cadmium sulfide quantum dots in human lymphocytes
  36. Association between single-nucleotide polymorphisms of NKX2.5 and congenital heart disease in Chinese population: A meta-analysis
  37. Assessment of the anesthetic effect of modified pentothal sodium solution on Sprague-Dawley rats
  38. Genetic susceptibility to high myopia in Han Chinese population
  39. Potential biomarkers and molecular mechanisms in preeclampsia progression
  40. Silencing circular RNA-friend leukemia virus integration 1 restrained malignancy of CC cells and oxaliplatin resistance by disturbing dyskeratosis congenita 1
  41. Endostar plus pembrolizumab combined with a platinum-based dual chemotherapy regime for advanced pulmonary large-cell neuroendocrine carcinoma as a first-line treatment: A case report
  42. The significance of PAK4 in signaling and clinicopathology: A review
  43. Sorafenib inhibits ovarian cancer cell proliferation and mobility and induces radiosensitivity by targeting the tumor cell epithelial–mesenchymal transition
  44. Characterization of rabbit polyclonal antibody against camel recombinant nanobodies
  45. Active legumain promotes invasion and migration of neuroblastoma by regulating epithelial-mesenchymal transition
  46. Effect of cell receptors in the pathogenesis of osteoarthritis: Current insights
  47. MT-12 inhibits the proliferation of bladder cells in vitro and in vivo by enhancing autophagy through mitochondrial dysfunction
  48. Study of hsa_circRNA_000121 and hsa_circRNA_004183 in papillary thyroid microcarcinoma
  49. BuyangHuanwu Decoction attenuates cerebral vasospasm caused by subarachnoid hemorrhage in rats via PI3K/AKT/eNOS axis
  50. Effects of the interaction of Notch and TLR4 pathways on inflammation and heart function in septic heart
  51. Monosodium iodoacetate-induced subchondral bone microstructure and inflammatory changes in an animal model of osteoarthritis
  52. A rare presentation of type II Abernethy malformation and nephrotic syndrome: Case report and review
  53. Rapid death due to pulmonary epithelioid haemangioendothelioma in several weeks: A case report
  54. Hepatoprotective role of peroxisome proliferator-activated receptor-α in non-cancerous hepatic tissues following transcatheter arterial embolization
  55. Correlation between peripheral blood lymphocyte subpopulations and primary systemic lupus erythematosus
  56. A novel SLC8A1-ALK fusion in lung adenocarcinoma confers sensitivity to alectinib: A case report
  57. β-Hydroxybutyrate upregulates FGF21 expression through inhibition of histone deacetylases in hepatocytes
  58. Identification of metabolic genes for the prediction of prognosis and tumor microenvironment infiltration in early-stage non-small cell lung cancer
  59. BTBD10 inhibits glioma tumorigenesis by downregulating cyclin D1 and p-Akt
  60. Mucormycosis co-infection in COVID-19 patients: An update
  61. Metagenomic next-generation sequencing in diagnosing Pneumocystis jirovecii pneumonia: A case report
  62. Long non-coding RNA HOXB-AS1 is a prognostic marker and promotes hepatocellular carcinoma cells’ proliferation and invasion
  63. Preparation and evaluation of LA-PEG-SPION, a targeted MRI contrast agent for liver cancer
  64. Proteomic analysis of the liver regulating lipid metabolism in Chaohu ducks using two-dimensional electrophoresis
  65. Nasopharyngeal tuberculosis: A case report
  66. Characterization and evaluation of anti-Salmonella enteritidis activity of indigenous probiotic lactobacilli in mice
  67. Aberrant pulmonary immune response of obese mice to periodontal infection
  68. Bacteriospermia – A formidable player in male subfertility
  69. In silico and in vivo analysis of TIPE1 expression in diffuse large B cell lymphoma
  70. Effects of KCa channels on biological behavior of trophoblasts
  71. Interleukin-17A influences the vulnerability rather than the size of established atherosclerotic plaques in apolipoprotein E-deficient mice
  72. Multiple organ failure and death caused by Staphylococcus aureus hip infection: A case report
  73. Prognostic signature related to the immune environment of oral squamous cell carcinoma
  74. Primary and metastatic squamous cell carcinoma of the thyroid gland: Two case reports
  75. Neuroprotective effects of crocin and crocin-loaded niosomes against the paraquat-induced oxidative brain damage in rats
  76. Role of MMP-2 and CD147 in kidney fibrosis
  77. Geometric basis of action potential of skeletal muscle cells and neurons
  78. Babesia microti-induced fulminant sepsis in an immunocompromised host: A case report and the case-specific literature review
  79. Role of cerebellar cortex in associative learning and memory in guinea pigs
  80. Application of metagenomic next-generation sequencing technique for diagnosing a specific case of necrotizing meningoencephalitis caused by human herpesvirus 2
  81. Case report: Quadruple primary malignant neoplasms including esophageal, ureteral, and lung in an elderly male
  82. Long non-coding RNA NEAT1 promotes angiogenesis in hepatoma carcinoma via the miR-125a-5p/VEGF pathway
  83. Osteogenic differentiation of periodontal membrane stem cells in inflammatory environments
  84. Knockdown of SHMT2 enhances the sensitivity of gastric cancer cells to radiotherapy through the Wnt/β-catenin pathway
  85. Continuous renal replacement therapy combined with double filtration plasmapheresis in the treatment of severe lupus complicated by serious bacterial infections in children: A case report
  86. Simultaneous triple primary malignancies, including bladder cancer, lymphoma, and lung cancer, in an elderly male: A case report
  87. Preclinical immunogenicity assessment of a cell-based inactivated whole-virion H5N1 influenza vaccine
  88. One case of iodine-125 therapy – A new minimally invasive treatment of intrahepatic cholangiocarcinoma
  89. S1P promotes corneal trigeminal neuron differentiation and corneal nerve repair via upregulating nerve growth factor expression in a mouse model
  90. Early cancer detection by a targeted methylation assay of circulating tumor DNA in plasma
  91. Calcifying nanoparticles initiate the calcification process of mesenchymal stem cells in vitro through the activation of the TGF-β1/Smad signaling pathway and promote the decay of echinococcosis
  92. Evaluation of prognostic markers in patients infected with SARS-CoV-2
  93. N6-Methyladenosine-related alternative splicing events play a role in bladder cancer
  94. Characterization of the structural, oxidative, and immunological features of testis tissue from Zucker diabetic fatty rats
  95. Effects of glucose and osmotic pressure on the proliferation and cell cycle of human chorionic trophoblast cells
  96. Investigation of genotype diversity of 7,804 norovirus sequences in humans and animals of China
  97. Characteristics and karyotype analysis of a patient with turner syndrome complicated with multiple-site tumors: A case report
  98. Aggravated renal fibrosis is positively associated with the activation of HMGB1-TLR2/4 signaling in STZ-induced diabetic mice
  99. Distribution characteristics of SARS-CoV-2 IgM/IgG in false-positive results detected by chemiluminescent immunoassay
  100. SRPX2 attenuated oxygen–glucose deprivation and reperfusion-induced injury in cardiomyocytes via alleviating endoplasmic reticulum stress-induced apoptosis through targeting PI3K/Akt/mTOR axis
  101. Aquaporin-8 overexpression is involved in vascular structure and function changes in placentas of gestational diabetes mellitus patients
  102. Relationship between CRP gene polymorphisms and ischemic stroke risk: A systematic review and meta-analysis
  103. Effects of growth hormone on lipid metabolism and sexual development in pubertal obese male rats
  104. Cloning and identification of the CTLA-4IgV gene and functional application of vaccine in Xinjiang sheep
  105. Antitumor activity of RUNX3: Upregulation of E-cadherin and downregulation of the epithelial–mesenchymal transition in clear-cell renal cell carcinoma
  106. PHF8 promotes osteogenic differentiation of BMSCs in old rat with osteoporosis by regulating Wnt/β-catenin pathway
  107. A review of the current state of the computer-aided diagnosis (CAD) systems for breast cancer diagnosis
  108. Bilateral dacryoadenitis in adult-onset Still’s disease: A case report
  109. A novel association between Bmi-1 protein expression and the SUVmax obtained by 18F-FDG PET/CT in patients with gastric adenocarcinoma
  110. The role of erythrocytes and erythroid progenitor cells in tumors
  111. Relationship between platelet activation markers and spontaneous abortion: A meta-analysis
  112. Abnormal methylation caused by folic acid deficiency in neural tube defects
  113. Silencing TLR4 using an ultrasound-targeted microbubble destruction-based shRNA system reduces ischemia-induced seizures in hyperglycemic rats
  114. Plant Sciences
  115. Seasonal succession of bacterial communities in cultured Caulerpa lentillifera detected by high-throughput sequencing
  116. Cloning and prokaryotic expression of WRKY48 from Caragana intermedia
  117. Novel Brassica hybrids with different resistance to Leptosphaeria maculans reveal unbalanced rDNA signal patterns
  118. Application of exogenous auxin and gibberellin regulates the bolting of lettuce (Lactuca sativa L.)
  119. Phytoremediation of pollutants from wastewater: A concise review
  120. Genome-wide identification and characterization of NBS-encoding genes in the sweet potato wild ancestor Ipomoea trifida (H.B.K.)
  121. Alleviative effects of magnetic Fe3O4 nanoparticles on the physiological toxicity of 3-nitrophenol to rice (Oryza sativa L.) seedlings
  122. Selection and functional identification of Dof genes expressed in response to nitrogen in Populus simonii × Populus nigra
  123. Study on pecan seed germination influenced by seed endocarp
  124. Identification of active compounds in Ophiopogonis Radix from different geographical origins by UPLC-Q/TOF-MS combined with GC-MS approaches
  125. The entire chloroplast genome sequence of Asparagus cochinchinensis and genetic comparison to Asparagus species
  126. Genome-wide identification of MAPK family genes and their response to abiotic stresses in tea plant (Camellia sinensis)
  127. Selection and validation of reference genes for RT-qPCR analysis of different organs at various development stages in Caragana intermedia
  128. Cloning and expression analysis of SERK1 gene in Diospyros lotus
  129. Integrated metabolomic and transcriptomic profiling revealed coping mechanisms of the edible and medicinal homologous plant Plantago asiatica L. cadmium resistance
  130. A missense variant in NCF1 is associated with susceptibility to unexplained recurrent spontaneous abortion
  131. Assessment of drought tolerance indices in faba bean genotypes under different irrigation regimes
  132. The entire chloroplast genome sequence of Asparagus setaceus (Kunth) Jessop: Genome structure, gene composition, and phylogenetic analysis in Asparagaceae
  133. Food Science
  134. Dietary food additive monosodium glutamate with or without high-lipid diet induces spleen anomaly: A mechanistic approach on rat model
  135. Binge eating disorder during COVID-19
  136. Potential of honey against the onset of autoimmune diabetes and its associated nephropathy, pancreatitis, and retinopathy in type 1 diabetic animal model
  137. FTO gene expression in diet-induced obesity is downregulated by Solanum fruit supplementation
  138. Physical activity enhances fecal lactobacilli in rats chronically drinking sweetened cola beverage
  139. Supercritical CO2 extraction, chemical composition, and antioxidant effects of Coreopsis tinctoria Nutt. oleoresin
  140. Functional constituents of plant-based foods boost immunity against acute and chronic disorders
  141. Effect of selenium and methods of protein extraction on the proteomic profile of Saccharomyces yeast
  142. Microbial diversity of milk ghee in southern Gansu and its effect on the formation of ghee flavor compounds
  143. Ecology and Environmental Sciences
  144. Effects of heavy metals on bacterial community surrounding Bijiashan mining area located in northwest China
  145. Microorganism community composition analysis coupling with 15N tracer experiments reveals the nitrification rate and N2O emissions in low pH soils in Southern China
  146. Genetic diversity and population structure of Cinnamomum balansae Lecomte inferred by microsatellites
  147. Preliminary screening of microplastic contamination in different marine fish species of Taif market, Saudi Arabia
  148. Plant volatile organic compounds attractive to Lygus pratensis
  149. Effects of organic materials on soil bacterial community structure in long-term continuous cropping of tomato in greenhouse
  150. Effects of soil treated fungicide fluopimomide on tomato (Solanum lycopersicum L.) disease control and plant growth
  151. Prevalence of Yersinia pestis among rodents captured in a semi-arid tropical ecosystem of south-western Zimbabwe
  152. Effects of irrigation and nitrogen fertilization on mitigating salt-induced Na+ toxicity and sustaining sea rice growth
  153. Bioengineering and Biotechnology
  154. Poly-l-lysine-caused cell adhesion induces pyroptosis in THP-1 monocytes
  155. Development of alkaline phosphatase-scFv and its use for one-step enzyme-linked immunosorbent assay for His-tagged protein detection
  156. Development and validation of a predictive model for immune-related genes in patients with tongue squamous cell carcinoma
  157. Agriculture
  158. Effects of chemical-based fertilizer replacement with biochar-based fertilizer on albic soil nutrient content and maize yield
  159. Genome-wide identification and expression analysis of CPP-like gene family in Triticum aestivum L. under different hormone and stress conditions
  160. Agronomic and economic performance of mung bean (Vigna radiata L.) varieties in response to rates of blended NPS fertilizer in Kindo Koysha district, Southern Ethiopia
  161. Influence of furrow irrigation regime on the yield and water consumption indicators of winter wheat based on a multi-level fuzzy comprehensive evaluation
  162. Discovery of exercise-related genes and pathway analysis based on comparative genomes of Mongolian originated Abaga and Wushen horse
  163. Lessons from integrated seasonal forecast-crop modelling in Africa: A systematic review
  164. Evolution trend of soil fertility in tobacco-planting area of Chenzhou, Hunan Province, China
  165. Animal Sciences
  166. Morphological and molecular characterization of Tatera indica Hardwicke 1807 (Rodentia: Muridae) from Pothwar, Pakistan
  167. Research on meat quality of Qianhua Mutton Merino sheep and Small-tail Han sheep
  168. SI: A Scientific Memoir
  169. Suggestions on leading an academic research laboratory group
  170. My scientific genealogy and the Toronto ACDC Laboratory, 1988–2022
  171. Erratum
  172. Erratum to “Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study”
  173. Erratum to “A two-microRNA signature predicts the progression of male thyroid cancer”
  174. Retraction
  175. Retraction of “Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis”
Downloaded on 21.10.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0521/html?licenseType=open-access
Scroll to top button