Home Life Sciences Cloning and expression analysis of SERK1 gene in Diospyros lotus
Article Open Access

Cloning and expression analysis of SERK1 gene in Diospyros lotus

  • Ruijin Zhou EMAIL logo , Yingying Wang , Xiaona Zhang , Fengqin Jia and Yunli Liu
Published/Copyright: September 26, 2022

Abstract

Somatic embryogenesis receptor-like kinases (SERKs), a subfamily of receptor-like kinases, play important roles in response to abiotic stresses in addition to apomictic reproductive development in numerous plant species. The purpose of the present work was to determine if an ortholog of the SERK gene is present in the Diospyros lotus genome, isolate it and analyze its expression during embryogeny and abiotic stress. An ortholog of the SERK gene was isolated from the D. lotus genome, and designated as DlSERK1. The physical and chemical properties, protein structure, and evolutionary relationship of the DlSERK1 protein were analyzed by bioinformatics methods, and the expression of DlSERK1 gene during embryonic development and under low-temperature, salt, and drought stresses was examined through real-time quantitative PCR analysis. DlSERK1 contained 1,881 bp open reading frame encoding 626 amino acids, with a molecular mass of 69.18 kDa and pI of 5.34. DlSERK1 had strong hydrophilic property, signal peptide cleavage sites, and two transmembrane regions, indicating that DlSERK1 is a secretory protein. The secondary structure of DlSERK1 was consistent with the tertiary structure, both of which were dominated by random curls and alpha-helices. DlSERK1 had the typical structure of SERK proteins, and harbored multiple phosphorylation and glycosylation sites. Quantitative analysis showed that DlSERK1 was expressed during the embryonic development period, and the highest expression level was at 10 days post-flowering. The DlSERK1 expression level was down-regulated under low-temperature stress and up-regulated under drought and salt stresses. Our study showed that DlSERK1 was expressed in embryo development and could respond to low-temperature, drought, and salt stresses, which lays a foundation for further research on the function of SERK1 in the apomixis growth and development of environmental adaptation in D. lotus.

1 Introduction

Apomictic reproduction in plants is a kind of asexual reproduction in which the megaspore mother cell or nucellar cell directly develops into embryos and then forms seeds without the meiosis and double fertilization of sexual reproduction [1]. Apomictic progenies produced by apomixis inherit the same traits as their female parent without character separation, which speeds up the fixation of heterosis [2,3]. Apomictic reproduction could also be applied to cultivate high-quality rootstocks and establish a stable and efficient somatic embryo regeneration and genetic transformation system in vitro [4,5]. Therefore, studying apomictic reproductive characteristics in fruit breeding and production is of great practical value. Apomixis is not only affected by environmental conditions but regulated by multiple genes. At present, many genes related to apomictic reproductive development have been identified, such as SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE (SERK), BABY BOOM (BBM), LEAFY COTYLEDON 2 (LEC2), AGAMOUS-LIKE 15 (AGL15), WUSCHEL (WUS), and FUSCA3. SERK belongs to the leucine-rich repeat sequence receptor-like kinase (LRR-RLK) family [6], widely distributed in plants. Schmidt et al. [7] discovered the first SERK gene (DcSERK) in the hypocotyl of carrot. Subsequently, SERK genes were isolated from Arabidopsis thaliana [8], rice (Oryza sativa) [9], maize (Zea mays) [10], barley (Hordeum vulgare) [11], wheat (Triticum aestivum) [12], grape (Vitis vinifera) [13], and apple (Malus hupehensis) [14], and were shown to play an important role in somatic embryogenesis. In general, the SERK gene consists of 11 exons and 10 introns, and the exons almost correspond to the functional domain of the coding protein, including the leucine-zipper (ZIP), leucine-rich repeat sequence (LRR), proline-rich (SPP), transmembrane (TM), and kinase domains, as well as the N- and C-terminal regions [15,16], which participate in important biological functions [17].

The involvement of the SERK gene in sporophyte development has been reported in A. thaliana. For example, AtSERK1 and AtSERK2 are expressed in both vegetative and reproductive tissues of A. thaliana, but their expression levels are relatively high in flowers and fruit pods, indicating that they may be involved in controlling sporophyte differentiation and thus affecting the development of male gametophytes [18]. At the same time, SERKs may function as coreceptors of GS01/2 to transduce the TWS1 signal and ultimately regulate embryonic cuticle integrity [19]. SERKs play a critical role in regulating zygotic embryo development through controlling the division patterns of vascular precursors and ground tissue stem cells. [20] AtSERK1 is only expressed at the heart-stage during embryo development, which is similar to the expression patterns of DgSERK and DcSERK [8,21]. In addition, SERKs (SERK1 and SERK2) are also involved in microspore embryogenesis in Brassica napus L., and the expression level of BnSERK1 is significantly up-regulated within 1–5 days after microspore-derived embryogenesis, whereas the BnSERK2 expression is increased throughout microspore-derived embryogenesis [22]. It has been reported that expression of genes of the SERK family in maize are associated with embryogenesis induction [10]. Therefore, SERK genes play an important role in microspore development and reproductive development. However, SERKs also show differentiated functions, they play crucial roles in many biological processes such as brassinosteroids (BR) signaling, anther development, stomatal patterning, floral abscission, immune responses, hormone signal transduction, disease defense, and abiotic stress response [20,2332]. For instance, AtSERK3-5 are involved in the regulation of BR signaling, affecting the growth and development of A. thaliana [29,30]. In rice, although OsSERK1 and OsSERK2 are expressed in all tissues, OsSERK1 is mainly expressed in flowers and stems, while OsSERK2 is mainly expressed in leaves. The expression of OsSERK1-2 can also be activated by pathogens, host dead cells, defense signaling molecules (such as salicylic acid), and other stress signals, modulating the immune signaling pathways [9,31]. Under salt stress, the expression of HvSERK1 and HvSERK3 in barley leaves was up-regulated at 12 h, and HvSERK1 remained at a high level until 24 h, while the HvSERK3 expression was decreased to a normal level at 24 h, suggesting that HvSERK1 and HvSERK3 may be involved in the salt tolerance pathway of barley leaves [11].

Diospyros lotus is a dioecious plant. We found that some females of D. lotus have apomixes characteristics [33], this has great application potential for D. lotus breeding research. But the type of apomixes in D. lotus is not clear enough, in particular, the regulatory mechanism of apomixes is unclear. SERK genes have been isolated and identified in many plants, but there are less reports on SERK genes in D. lotus. Lijie et al. [14] found that the SERK1 gene was highly expressed in the ovary at the bud stage of M. hupehensis var. pingyiensis Jiang, while CitSERK1 and CitSERK1-LIKE genes were highly expressed in the somatic embryo induction process of citrus [34,35]. In view of the important role of SERKs and their homologous genes in sporophyte development, reproductive development, and related resistance in higher plants, we cloned SERK homologous genes from D. lotus, and analyzed their expression patterns under somatic embryogenesis, low temperature, drought, and salt stress by reverse transcription quantitative PCR (RT-qPCR). At the same time, the results obtained from bioinformatics analysis lay a foundation for further research on the function of SERK genes and provide theoretical support for the study of the molecular mechanism of SERK genes in the growth and development process and environmental adaptation of D. lotus.

2 Materials and methods

2.1 Plant material

The samples were collected from the perennial D. lotus L. tree grown at the test base of Henan Institute of Science and Technology.

2.2 Sampling during apomictic reproductive development

When D. lotus flowers were not open, the petals changed from green to yellow, the petals surrounding the stigmas were gently removed. Polyvinyl acetate emulsion adhesive was applied evenly on the stigma to completely wrap the stigma [33]. To ensure that pollen did not enter the stigma, each stigma was treated three times at an interval of 12–24 h. The samples were collected 1 day after treatment (as the control). Afterward, samples were taken once every 3 days until white embryos were formed in the fruit of D. lotus. The samples were immediately frozen in liquid nitrogen, brought back to the laboratory, and stored at −80°C.

2.3 Abiotic stress treatment

Sufficient seeds with full grain and uniform size were sown in a nutrient bowl. The treatment was performed on seedlings with three or four leaves. Low-temperature treatment: D. lotus seedlings with the same growth status were placed in an incubator at 4°C, under continuous light supply and normal watering. Drought treatment: root irrigation was applied to robust D. lotus seedlings with same sizes with 20% PEG 6000 until saturation. Salt treatment: root irrigation was applied to healthy D. lotus seedlings with consistent growth with 250 mM NaCl solution until saturation. The third leaf from bottom to top was collected at 0 h (CK), 6 h, 12 h, 1, 3, 5, and 7 days after abiotic treatment, frozen immediately in liquid nitrogen, and stored at −80°C until further use. Three biological replicates were conducted for each treatment. The relative electrical conductivity (REC) of the leaf at each time point was measured by a DDS-307 electrical conductivity meter, and the electrode constant was 0.990. According to the method of Bolat with some modifications [36], the conductivity of sample solution was R 1, and that of deionized water partake solution was R A before boiling. After boiling and cooling, the conductivity of sample solution was R 2, and that of deionized water counterpart solution was R B. Then, REC (%) = (R 1R A)/(R 2R B) × 100%. Three biological replicates were selected at each time point of each treatment.

Total RNA was extracted using the OminiPlant RNA Kit (DNaseI, CW2598S; Kangwei Century Biotechnology Co., Ltd) following the manufacturer’s instructions. cDNA was synthesized by the RevertAid First Strand cDNA Synthesis Kit (#K1622; Thermo Scientific) and stored at −20°C for later use.

2.4 Screening and cloning of SERK in D. lotus

The SERK gene sequence was screened from the genome database of Diospyros oleifera “Youshi,” and specific primers to amplify the full length of the SERK gene were designed (upstream primer: 5′−ATGGAAAGATTGGTGTTGGTGA−3′; downstream primer: 5′−TCACCTGGGCCCTGATAACT−3′). PCR amplification was carried out using cDNA from the leaves of the explants as the template by the homologous cloning method. The PCR reaction system was 20 μL, containing 1 μL of cDNA, 0.5 μL of each primer (10 μM), 10 μL of 2× Es TaqMster Mix (Dye), and 8 μL of ddH2O. The PCR reaction conditions were pre-denaturation at 94°C for 4 min; 94°C for 30 s, 56°C for 30 s, 72°C for 90 s, 35 cycles; extension at 72°C for 5 min. The target fragment was separated by 1.0% agarose gel electrophoresis and recovered by the Agarose gel DNA Recovery Kit. After the pMD18-T vector (TaKaRa) was connected, the plasmid was transformed into Escherichia coli DH5α strain by heat shock (laboratory preservation), and positive clones were identified with sequencing conducted by Sangong Biotech Co., Ltd (Shanghai, China). According to the sequencing results, the recovered fragment was confirmed as the SERK gene based on multiple characteristics of protein and gene structure and was named DlSERK1.

2.5 Bioinformatics analysis of DlSERK1

The online software BLASTP was used for gene sequence search and analysis (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The full-length open reading frame (ORF) was predicted by the online tool ORF-finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). The physicochemical properties and hydrophilicity of the encoded DlSERK1 protein were predicted by ProtParam (http://web.expasy.org/protparam/) and ExPASy (http://web.expasy.org/protscale/). SOPMA (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html) and SWISS-MODEL online tools were used to analyze the secondary structure and three-dimensional structure composition of the DlSERK1 protein. TM helices were analyzed using the TMHMM server (http://www.cbs.dtu.dk/services/TMHMM/). The subcellular localization of DlSERK was predicted using Plant-mPLoc (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/) and PredictProtein (https://predictprotein.org/). Signal peptides were predicted by SignalP v5.0. The Netphos v3.1 server, NetOGlyc v4.0, and NetNGlyc v1.0 software were used to predict phosphorylation and glycosylation sites in DlSERK. The MotifScan program (http://myhits.isb-sib.ch/cgi-bin/motif_scan) was used to analyze the conserved motifs. Sequence alignment was performed using DNAMAN v9.0. Phylogenetic trees were prepared with MEGA v5.0 software using the neighbor-joining (NJ) method. The 2,000-bp sequence upstream of DlSERK1 was regarded as the promoter region and extracted from the D. lotus genome database (http://persimmon.kazusa.or.jp/blast.html) by TBtools and submitted to the Plant CARE database for identifying the cis-acting elements.

2.6 RT-qPCR

The fruits which were capped by white latex for 1, 4, 7, 13, 16, 19, and 22 days and leaves treated with low temperature, drought, and salt stress were used as test materials. RNA was extracted, reverse transcribed to synthesize cDNA, and real-time quantitative PCR was performed. The RT-qPCR was performed on a CFX96 instrument (Bio-Rad), and the PCR reaction was prepared according to the instruction of the SYBR Green qPCR Kit (TaKaRa). Primer sequences were: SERKrt1F, TGCCATCTGAACCACCACTC and SERKrt1R, ACGGCTGTAATGACGTGTGT. The 10-μL PCR reaction system contained 5.0 μL of SYBR Premix Ex Taq II enzyme, 0.7 μL of cDNA, 0.4 μL of each primer (10 μM), and 3.5 μL of ddH2O. The amplification parameters were as follows: 95°C pre-denaturation for 30 s, 1 cycle; 95°C denaturation for 5 s, 56°C renaturation for 30 s, 40 cycles. The comparative threshold 2−ΔΔCT method was applied to quantify the relative expression of target genes [37]. Four independent assays were carried out.

3 Results

3.1 Cloning of the SERK1 gene in D. lotus

cDNA of D. lotus leaves was used as the template for PCR amplification. After cloning and sequencing, the ORF length of DlSERK1 sequence was 1,881 bp (Figure 1). Comparison of nucleotide sequence length showed that the DlSERK1 gene was 72 bp longer than SERK of D. oleifera, and these two sequences length shared 96.17% similarity (Figure 2). Moreover, compared with the homologous SERK sequences in other plants, this fragment showed 100% similarity with tetraploid hybrid offspring of Malus, 100% similarity with PpSERK2, and 98.90% similarity with SERK1 of D. officinale, indicating that the full-length cDNA sequence of DlSERK1 was cloned.

Figure 1 
                  Amplification of DlSERK1. M: DL2000 DNA marker; 1: amplification of full-length cDNA of DlSERK1.
Figure 1

Amplification of DlSERK1. M: DL2000 DNA marker; 1: amplification of full-length cDNA of DlSERK1.

Figure 2 
                  Nucleotide sequences of the SERK gene in D. oleifera Cheng and D. lotus.
Figure 2

Nucleotide sequences of the SERK gene in D. oleifera Cheng and D. lotus.

3.2 Bioinformatics analysis of DlSERK1

3.2.1 Homology of DlSERK1 protein

Through BLASTP searches against the NCBI database, the protein sequence encoded by DlSERK1 showed high similarity with SERKs of other species. The similarities between the DlSERK1 protein with SERKs of Sesamum indicum (XP_011074139.1), Populus euphratica (XP_011002514.1), V. vinifera (XP_002270847.1), Carica papaya (ABS32233.1), and Solanum lycopersicum (NP_001233866.1) were 93.25, 92.27, 91.94, 91.56, and 89.94%, respectively, indicating that the cloned DlSERK1 gene was homologous with SERKs.

3.2.2 Physicochemical properties of DlSERK1

The ORF of DlSERK1 was 1,881 bp in length and encoded a protein of 626 amino acids that had a calculated molecular mass of 69.18 kDa and a predicted pI of 5.34. The molecular formula of the DlSERK1 protein was C3109H4893N839O907S20, its lipid solubility index was 101.37, and its instability coefficient was less than 40 (39.52), belonging to the stable protein. Among the 20 amino acid residues in DlSERK1, leucine was the most (15.5%), followed by glycine (7.8%), while cysteine (1.3%) was the least. The total number of negatively charged residues (Asp + Glu) was 74 and that of positively charged residues (Arg + Lys) was 56. The total average hydrophilic coefficient of DlSERK1 was –0.098, suggesting that DlSERK1 is a hydrophilic protein.

3.2.3 Hydrophilicity of DlSERK1 protein

Analysis by ExPASy software showed that there were several strong hydrophilic regions in the N-terminal, C-terminal, and intermediate regions of DlSERK1 (Figure 3). The site with the strongest hydrophilicity was found at amino acid residue 266 (Lys), with a value of −2.733. The most hydrophobic site was found to be residue 14 (Leu), with a value of 2.867.

Figure 3 
                     Predicted hydrophilic sites of DlSERK1.
Figure 3

Predicted hydrophilic sites of DlSERK1.

3.2.4 Secondary and tertiary structures of DlSERK1 protein

The secondary structure prediction of DlSERK1 (Figure 4) revealed that it was mainly composed of 39.30% alpha-helices (blue line), 4.31% beta-turns (green line), 42.65% random coils (purple line), and 13.74% extended strands (red line). Through homology modeling, it was found that the tertiary structure of DlSERK1 (Figure 5) had the most similarity with the 3tl8.2.A model, and the tertiary structure was dominated by random coils and alpha-helices, which is consistent with the prediction results of secondary structure.

Figure 4 
                     Predicted secondary structure of DlSERK1.
Figure 4

Predicted secondary structure of DlSERK1.

Figure 5 
                     Predicted tertiary structure of DlSERK1.
Figure 5

Predicted tertiary structure of DlSERK1.

3.2.5 Subcellular localization, TM structure, and signal peptide prediction of DlSERK1

DlSERK1 was predicted to be localized to the cell membrane considering the results from both plant-MPLOC and Predict Protein. TM prediction results (Figure 6) showed that DlSERK1 contained two TM domains, i.e., TM helices at amino acid residues 4–26 and 240–262, respectively. Therefore, DlSERK1 was presumed to be a TM protein. The DlSERK1 protein may contain a signal peptide (Sec/SPI), and the cleavage site was between residues 26 and 27, with a probability of 0.98 (CS > 0.5), indicating that the protein belongs to the secretory protein.

Figure 6 
                     Predicted TM domain of DlSERK1.
Figure 6

Predicted TM domain of DlSERK1.

3.2.6 Prediction of phosphorylation and glycosylation sites of DlSERK1 protein

The phosphorylation sites of DlSERK1 were predicted by the NetPhos v3.1 server (Figure 7). The results showed that there were 43 phosphorylation sites in DlSERK1, including 27 serine (Ser) sites, 12 threonine (Thr) sites, and four tyrosine (Tyr) sites. NetOGlyc v4.0 and NetOGlyc v1.0 were used to predict the O-terminal and N-terminal glycosylation sites in DlSERK1. Three O-terminal glycosylation sites were located at residues 394 and 607, respectively, and five N-terminal glycosylation sites were located at residues 115, 150, 163, 184, and 381.

Figure 7 
                     Predicted phosphorylation sites of DlSERK1.
Figure 7

Predicted phosphorylation sites of DlSERK1.

3.2.7 Conserved motif prediction of DlSERK1 protein

Analysis based on MotifScan showed that DlSERK1 contained several typical conserved domains of SERK proteins, including an N-terminal region LRRNT_2 (between residues 26 and 66), a leucine zipper (between residues 33 and 54), four leucine repeats LRR_1 (between residues 94 and 116, 118 and 140, 142 and 164, and 166 and 189), a proline-rich domain with the Ser-Pro-Pro (SPP) motif, a TM domain (between residues 204 and 231), a TM domain (between residues 240 and 262), and a protein kinase active domain comprising 11 sub-domains (between residues 302 and 589). Additionally, a protein kinase ATP-binding site (between residues 308 and 330) and a serine/threonine kinase activation site (between residues 425 and 437) were observed.

3.2.8 Multiple alignment of amino acid sequences and construction of phylogenetic tree

The protein sequences of SERKs from other plant species were downloaded from NCBI, including D. oleifera Cheng (AKN89445.1), S. indicum (XP_011074139.1), P. euphratica (XP_011002514.1), V. vinifera (XP_002270847.1), C. papaya (ABS32233.1), Prunus persica (XP_007201734.1), Theobroma caca (XP_007020220.1), Prunus mume (XP_008245841.1), Nicotiana tabacum (XP_016455663.1), and A. thaliana (ACN59271.1 and CAF33246.1). Multiple sequence alignment was performed by DNAMAN. The results showed that the similarity among these sequences was 90.81%. Among them, DlSERK1 had the highest similarity with D. oleifera SERK2 (94.47%), followed by SiSERK2 (93.25%). Analysis results showed that these sequences had typical structural and functional domains of SERK proteins (Figure 8). This confirms that DlSERK1 is a member of the SERK family and belongs to SERK/LRR-RLK genes.

Figure 8 
                     Multiple sequence alignment of amino acid sequences of DlSERK1 and SERKs in other plants. Conserved sequence characteristics of SERK are indicated with colored underlines (red, signal peptide; orange, leucine zipper; yellow, leucine repeat sequence; green, serine-proline-rich domain; blue, TM domain; and purple, kinase domain).
Figure 8

Multiple sequence alignment of amino acid sequences of DlSERK1 and SERKs in other plants. Conserved sequence characteristics of SERK are indicated with colored underlines (red, signal peptide; orange, leucine zipper; yellow, leucine repeat sequence; green, serine-proline-rich domain; blue, TM domain; and purple, kinase domain).

To explore the evolutionary relationship between DlSERK1 and SERKs from other species, a phylogenetic tree was constructed by MEGA v5.0 based on the NJ method (Figure 9). It was found that DlSERK1 was closest to DolSERK2; the two were clustered in a small clade with VvSERK1 first, and then clustered with SiSERK2, NtSERK, SlSERK1, and SERKs of other dicotyledons. SERK sequences were clustered in different clades of monocotyledonous plants including Brachypodium distachyon and rice, and were relatively distant from each other. The results of the phylogenetic tree were consistent with the homology comparison results. Among dicotyledons, SERKs of peach, plum, and apple of Rosaceae belonged to one group, and those of tobacco, tomato, and potato of Solanaceae belonged to another group. While AtSERK1 and AtSERK2 were clustered to one branch, AtSERK3, AtSERK4, and AtSERK5 were in separate clades, indicating that different SERK proteins in the same plant species can also be divergent.

Figure 9 
                     Phylogenetic tree of DlSERK1 and SERKs in other plants.
Figure 9

Phylogenetic tree of DlSERK1 and SERKs in other plants.

3.2.9 Analysis of regulatory elements in the DlSERK1 promoter

The 2,000 bp nucleotide sequence upstream of the DlSERK1 gene was analyzed by Plant CARE to obtain the regulatory elements (Table 1). The prediction results showed that this sequence contained not only a large number of the core sequence (TATA-box) in the promoter, the CAAT-box in the promoter and enhancer regions, and other basic promoter elements across eukaryotes, but also included nine light-responsive elements (G-box, GATA-motif, TCT-motif, and AE-box), 12 hormone response-related cis-elements (TGACG-motif, CGTCA-motif, ABRE, and P-box), two stress response-related cis-elements (ARE and MBS), and two responsive elements involved in the regulation of corn protein metabolism (O2-site).

Table 1

Cis-acting elements of the DlSERK1 gene

Type of cis-acting element Associated element Number Function of response
Light response-related element G-box Five Light-responsive element
GATA-motif Two Light-responsive element
TCT-motif One Light-responsive element
AE-box One Light-responsive element
Hormone response-related cis-element TGACG-motif Four MeJA responsiveness
CGTCA-motif Four MeJA responsiveness
ABRE Three Abscisic acid responsiveness
P-box One Gibberellin-responsive element
Stress response-related cis-element ARE One Anaerobic-induction element
MBS One MYB binding site involved in drought inducibility
Growth-related cis-element O2-site Two Zein metabolism regulation

3.3 Changes of REC of leaves under abiotic stress

In order to calibrate the degree of cell damage under low temperature, drought, and salt stress at different times, and to determine the rationality of the sampling time of gene expression in the later period, we measured the REC. With the extension of the treatment time, the REC of leaves increased in varying degrees compared with CK (0 h), indicating that the cell membrane was damaged to varying degrees (Figure 10). The REC of leaves increased linearly within 12 h under 4°C and peaked (11.76%) at 12 h, which was increased by 4.96% compared with CK. Although a downward trend was observed after 12 h, the REC was always higher than that of CK. The REC showed a gradual downward trend within 12 h of drought treatment with 20% PEG 6000. At 12 h, the REC of leaves was the lowest (5.74%); it then rose until the maximum value appeared at 5 days (12.32%), which was increased by 4.17% compared to that of CK and 2.15 times relative to that at 12 h. Within 7 days of 250 mM NaCl treatment, the REC first showed an upward trend within 6 h, then decreased to the CK level at 12 h, and then gradually increased. At 5 days, the REC reached a maximum value (9.74%), which was increased by 2.08% compared to CK. The results showed that low-temperature, drought, and salt treatment increased the REC of seedling leaves, and the membrane was damaged under abiotic stress. The damage intensity of the cell membrane under different stresses was in an order of 4°C > 20% PEG 6000 > 250 mM NaCl.

Figure 10 
                  Relationship between treatment time and REC under different stress treatments. Different lowercase letters indicate significant differences at P < 0.05.
Figure 10

Relationship between treatment time and REC under different stress treatments. Different lowercase letters indicate significant differences at P < 0.05.

3.4 Expression analysis of DlSERK1

The expression of DlSERK1 during the ovaries of different flower development stages in D. lotus was analyzed by RT-qPCR (Figure 11). The results showed that DlSERK1 was expressed during the embryonic development period. At 1–3 days post-treatment (DPT), some flowers bloomed, roughly in bud stage. At 4–7 DPT, most flowers bloomed, which was the full flowering stage. About a week after flowering, the stigma turned brown, and the petals gradually withered, which was the late flowering stage. The highest DlSERK1 expression in ovary was observed at 10 days of flowering, which was 1.63 times higher than that at Day 1 of flowering. It was speculated that DlSERK1 may promote the development of somatic embryos.

Figure 11 
                  
                     DlSERK1 gene expression analysis during embryogenesis and abiotic stress.
Figure 11

DlSERK1 gene expression analysis during embryogenesis and abiotic stress.

The expression patterns of DlSERK1 under various abiotic stresses (4°C, PEG, and NaCl) were studied. DlSERK1 was expressed in leaves at low temperature for 7 days, and the expression was almost unchanged after 6 h of treatment. The DlSERK1 expression decreased rapidly after 12 h of treatment, which was less than half of the CK, and remained at a low level until 7 DPT. Under PEG treatment, the expression of DlSERK1 was up-regulated in leaves, and the peak expression appeared at 5 DPT, which was about 2.73 times that of the CK. Under the condition of high-salt treatment, the expression of DlSERK1 in leaves increased first and then decreased. The expression increased significantly within 3 days of treatment, and peaked at 3 DPT, which was about 1.9 times that of CK. However, at 5 DPT, the DlSERK1 expression decreased to the lowest level, and then returned to the normal level at 7 DPT.

4 Discussion

In this study, the full-length cDNA of DlSERK1 (1,881 bp), encoding 626 amino acids, was cloned from the D. lotus leaf. Bioinformatics analysis showed that the DlSERK protein encoded by this gene had high similarities with SERK proteins of other plants. DlSERK also contained common conserved structural domains of SERK proteins, including a signal peptide, leucine zipper structure, proline-rich structure, TM structure, leucine-repeat sequence, and intracellular protein kinase activity domain, which were the typical structural characteristics of the SERK protein family. Therefore, it was speculated that DlSERK was a member of the SERK protein family and was thus named DlSERK1. DlSERK1 had high similarities to other plant SERK proteins in amino acid composition, molecular weight, and pI. For example, DlSERK1, AtSERK1, PpSERK2, MtSERK1, OsSERK1, and CitSERK1 proteins were composed of 626, 625, 626, 627, 628, and 621 amino acids, respectively; their molecular weights were 69.18, 69, 68.99, 69.125, 69.5, and 68.4 kDa, respectively; and their pIs were 5.34, 5.25, 5.38, 5.56, 5.98, and 5.48, respectively [9,18,34,38]. The results showed that SERK proteins of different plants had similar primary structure and physicochemical properties, thus it was speculated that they play similar roles in the process of plant growth and development. The secondary and tertiary structures were consistent with the prediction results, which revealed mainly random coils and alpha-helices. There was a cleavage site of signal peptide between residues 26 and 27. It was speculated that DlSERK1 is a secretory protein with a TM structure located on the cell membrane, and harbors multiple phosphorylation and glycosylation sites, which is consistent with the function of SERK proteins in signal transduction. DlSERK1 had the highest similarity with DolSERK2, was close to SERKs of dicotyledonous plants such as sesame, tobacco, and tomato, and far from SERKs of monocotyledonous plants such as rice and B. distachyon.

The expression level of DlSERK1 was the highest at 10 days after flowering, which was the late flowering stage of D. lotus. The fruit began to expand about half a month after flowering, and the DlSERK1 expression returned to the normal level. According to the DlSERK1 expression at different stages of ovary development, it can be inferred that DlSERK1 may play a certain regulatory role in embryogenesis in D. lotus. This is similar to the results of D. officinale [39], citrus [34], and apple [14]. DoSERK2 was widely expressed at all stages of protocorm development, and the expression was the highest at the stage of seed embryo activation. The expression of DoSERK2 was low and showed little difference from protocorm formation to the seedling stage. The expression signal of CitSERK1 could be detected in flowers and fruits at 30 and 60 days after flowering, but not in fruit at 180 days after flowering. The expression levels of MhSERK1 and MhdSERK1 were the highest in the ovary of M. hupehensis and in the ovary of the hybrid progeny, respectively. The expression of SERK1 was the highest in the ovary of M. hupehensis at the bud stage, while the expression was the highest in the ovary of hybrid progeny at the flowering stage, which may be the main reason for the decline in apomixis ability of hybrid progeny.

A large number of studies have shown that SERK proteins play an important role in the regulation of abiotic stress. Ma et al. found that SERK1 could be induced by low-temperature treatment at 4°C for 24 h in non-embryogenic callus of pineapple [40]. Xuekai et al. found that low-temperature accumulation could induce the PsSERK2 expression in Paeonia suffruticosa “Luhehong,” and PsSERK2 plays a positive regulatory role in sleep release [41]. In this study, we found that the expression level of DlSERK1 decreased significantly with the increase of low-temperature treatment time (low temperature for 12 h) by RT-qPCR technique. DlSERK1 plays a negative regulatory role in low temperature stress. Many gene families play different roles in different plants, such as the MYB gene family has positive and negative regulatory functions [42,43]. Most of the MYBs involved in the control of flavonoid biosynthesis are positive regulators that enhance the expression of the structural flavonoid pathway genes [2]. However, repressors have also been characterized, such as FaMYB1 in strawberry (Fragaria x ananassa Duch.) and VvMYB4 in the berries of grapevine [44,45].The expression level of DlSERK1 was up-regulated at 5 DPT during drought stress, which was similar to that of BnaA07g23390D and BnaA07g29610D in B. napus under drought treatment, with the BnaA07g23390D expression being up-regulated at 1 h of treatment and the BnaA07g29610D expression being up-regulated at 0.5 h [46]. The expression of DlSERK1 was up-regulated after salt treatment, similar to GmSERK16, HvSERK1, HvSERK3, MdSERK4, MdSERK10, BnaC01g43240D, and BnaCnng07810D [32,4749]. The results indicate that DlSERK1 can respond to low-temperature, drought, and salt stress signals. Plant CARE analysis showed that DlSERK1 may be involved in the light-response process, response to the signal regulation of hormones such as MeJA and abscisic acid, and protein metabolism. This indicates that the regulation of gene expression is extremely complex, and DlSERK1 may have multiple functions and participate in various biological processes.

5 Conclusion

In summary, the cloning of SERK has laid a foundation for studying the role of this gene in the development of embryogenesis in D. lotus, and it is of great significance for the in-depth study of the molecular mechanism of embryonic development and the function of environmental adaptability in D. lotus.


tel: +86 15837368125

  1. Funding information: This work was supported by the Henan Provincial Department of Science and Technology Research Project by a grant (192102110044).

  2. Conflict of interest: Authors state no conflict of interest.

  3. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request

References

[1] Bicknell RA, Koltunow AM. Understanding apomixis: recent advances and remaining conundrums. Plant Cell. 2004;16:228–45.10.1105/tpc.017921Search in Google Scholar

[2] Grimanelli D, Leblanc O, Perotti E, Grossniklaus U. Developmental genetics of gametophytic apomixis. Trends Genet. 2001;17(10):597–604.10.1016/S0168-9525(01)02454-4Search in Google Scholar

[3] Hand ML, Koltunow AMG. The genetic control of apomixis: asexual seed formation. Genetics. 2014;197(2):441–50.10.1534/genetics.114.163105Search in Google Scholar PubMed PubMed Central

[4] Wu Y, Xu C, Zhang A. Status and prospect of research in peach tissue culture and genetic transformation. J Fruit Sci. 2002;02:123–7.Search in Google Scholar

[5] Yang F, Liu Z, Kai YI, Mingli HE, Wang D, Yan Z, et al. ‘LZ106’, a new apomixis and semi-dwarfing rootstock for apple. J Fruit Sci. 2017;34(3):379–82.Search in Google Scholar

[6] Gou X, He K, Yang H, Yuan T, Lin H, Clouse SD, et al. Genome-wide cloning and sequence analysis of leucine-rich repeat receptor-like protein kinase genes in Arabidopsis thaliana. BMC Genomics. 2010;11(1):19.10.1186/1471-2164-11-19Search in Google Scholar PubMed PubMed Central

[7] Schmidt ED, Guzzo F, Toonen MA, de Vries SC. A leucine-rich repeat containing receptor-like kinase marks somatic plant cells competent to form embryos. Development. 1997;124(10):2049–62.10.1242/dev.124.10.2049Search in Google Scholar PubMed

[8] Hecht VR, Vielle Calzada JP, Hartog MV, Schmidt EDL, Boutilier K, Grossniklaus U, et al. The arabidopsis somatic embryogenesis receptor kinase 1 gene is expressed in developing ovules and embryos and enhances embryogenic competence in culture. Plant Physiol. 2001;127(3):803–16.10.1104/pp.010324Search in Google Scholar

[9] Hu H, Xiong L, Yang Y. Rice SERK1 gene positively regulates somatic embryogenesis of cultured cell and host defense response against fungal infection. Planta. 2005;222(1):107–17.10.1007/s00425-005-1534-4Search in Google Scholar PubMed

[10] Baudino S, Hansen S, Brettschneider R, Hecht VFG, Dresselhaus T, Lörz H, et al. Molecular characterisation of two novel maize LRR receptor-like kinases, which belong to the SERK gene family. Planta. 2001;213(1):1–10.10.1007/s004250000471Search in Google Scholar PubMed

[11] Li H, Wang Y, Wu M, Li L, Li C, Han Z, et al. Genome-wide identification of AP2/ERF transcription factors in cauliflower and expression profiling of the erf family under salt and drought stresses. Front Plant Sci. 2017;8:946.10.3389/fpls.2017.00946Search in Google Scholar PubMed PubMed Central

[12] Singh A, Khurana P. Ectopic expression of Triticum aestivum SERK genes (TaSERKs) control plant growth and development in Arabidopsis. Sci Rep. 2017;7(1):12368.10.1038/s41598-017-10038-1Search in Google Scholar PubMed PubMed Central

[13] Schellenbaum P, Jacques A, Maillot P, Bertsch C, Mazet F, Farine S, et al. Characterization of VvSERK1, VvSERK2, VvSERK3 and VvL1L genes and their expression during somatic embryogenesis of grapevine (Vitis vinifera L.). Plant Cell Rep. 2008;27(12):1799.10.1007/s00299-008-0588-8Search in Google Scholar

[14] Lijie Z, Hamad M, Wenxuan D, Suman GUO, Qingjiao M. Isolation and bioinformatics analysis of apomicxis SERK1 genes in Malus. For Res. 2016;29(1):67–73.Search in Google Scholar

[15] Shiu SH, Bleecker AB. Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases. Proc Natl Acad Sci. 2001;98(19):10763–8.10.1073/pnas.181141598Search in Google Scholar

[16] Fan M, Wang M, Bai MY. Diverse roles of SERK family genes in plant growth, development and defense response. Sci China Life Sci. 2016;59(9):889–96.10.1007/s11427-016-0048-4Search in Google Scholar

[17] Yang C, Zhao T, Yu D, Gai J. Isolation and functional characterization of a SERK gene from soybean (Glycine max (L.) Merr.). Plant Mol Biol Rep. 2011;29(2):334–44.10.1007/s11105-010-0235-8Search in Google Scholar

[18] Albrecht C, Russinova E, Hecht V, Baaijens E, de Vries S. The Arabidopsis thaliana somatic embryogenesis receptor-like kinases1 and 2 control male sporogenesis. Plant Cell. 2005;17(12):3337–49.10.1105/tpc.105.036814Search in Google Scholar

[19] Zhang H, Li X, Wang W, Li H, Cui Y, Zhu Y, et al. SERKs regulate embryonic cuticle integrity through the TWS1-GSO1/2 signaling pathway in Arabidopsis. N Phytol. 2022;233(1):313–28.10.1111/nph.17775Search in Google Scholar

[20] Li H, Cai Z, Wang X, Li M, Cui Y, Cui N, et al. SERK receptor-like kinases control division patterns of vascular precursors and ground tissue stem cells during embryo development in Arabidopsis. Mol Plant. 2019;12(7):984–1002.10.1016/j.molp.2019.04.011Search in Google Scholar

[21] Somleva MN, Schmidt EDL, de Vries SC. Embryogenic cells in Dactylis glomerata L. (Poaceae) explants identified by cell tracking and by SERK expression. Plant Cell Rep. 2000;19(7):718–26.10.1007/s002999900169Search in Google Scholar

[22] Ahmadi B, Masoomi Aladizgeh F, Shariatpanahi ME, Azadi P, Keshavarz Alizadeh M. Molecular characterization and expression analysis of SERK1 and SERK2 in Brassica napus L.: implication for microspore embryogenesis and plant regeneration. Plant Cell Rep. 2016;35(1):185–93.10.1007/s00299-015-1878-6Search in Google Scholar

[23] Nam KH, Li J. BRI1/BAK1, a receptor kinase pair mediating brassinosteroid signaling. Cell. 2002;110(2):203–12.10.1016/S0092-8674(02)00814-0Search in Google Scholar

[24] Colcombet J, Boisson-Dernier Al, Ros-Palau R, Vera CE, Schroeder JI. Arabidopsis somatic embryogenesis receptor kinases1 and 2 are essential for tapetum development and microspore maturation. Plant Cell. 2005;17(12):3350–61.10.1105/tpc.105.036731Search in Google Scholar PubMed PubMed Central

[25] Chinchilla D, Zipfel C, Robatzek S, Kemmerling B, Nürnberger T, Jones JDG, et al. A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defence. Nature. 2007;448(7152):497–500.10.1038/nature05999Search in Google Scholar PubMed

[26] Meng X, Zhou J, Tang J, Li B, de Oliveira Marcos VV, Chai J, et al. Ligand-induced receptor-like kinase complex regulates floral organ abscission in Arabidopsis. Cell Rep. 2016;14(6):1330–8.10.1016/j.celrep.2016.01.023Search in Google Scholar PubMed PubMed Central

[27] Gou X, Li J. Paired receptor and coreceptor kinases perceive extracellular signals to control plant development. Plant Physiol. 2020;182(4):1667–81.10.1104/pp.19.01343Search in Google Scholar PubMed PubMed Central

[28] Wu Y, Gao Y, Zhan Y, Kui H, Liu H, Yan L, et al. Loss of the common immune coreceptor BAK1 leads to NLR-dependent cell death. Proc Natl Acad Sci. 2020;117(43):27044–53.10.1073/pnas.1915339117Search in Google Scholar PubMed PubMed Central

[29] He K, Gou X, Yuan T, Lin H, Asami T, Yoshida S, et al. BAK1 and BKK1 regulate brassinosteroid-dependent growth and brassinosteroid-independent cell-death pathways. Curr Biol. 2007;17(13):1109–15.10.1016/j.cub.2007.05.036Search in Google Scholar PubMed

[30] Jin YL, Tang RJ, Wang HH, Jiang CM, Bao Y, Yang Y, et al. Overexpression of Populus trichocarpa CYP85A3 promotes growth and biomass production in transgenic trees. Plant Biotechnol J. 2017;15(10):1309–21.10.1111/pbi.12717Search in Google Scholar PubMed PubMed Central

[31] Chen X, Zuo S, Schwessinger B, Chern M, Canlas PE, Ruan D, et al. An XA21-associated kinase (OsSERK2) regulates immunity mediated by the XA21 and XA3 immune receptors. Mol Plant. 2014;7(5):874–92.10.1093/mp/ssu003Search in Google Scholar PubMed PubMed Central

[32] Li Y, Liu C, Guo G, He T, Chen Z, Gao R, et al. Expression analysis of three SERK-like genes in barley under abiotic and biotic stresses. J Plant Interact. 2017;12(1):279–85.10.1080/17429145.2017.1339836Search in Google Scholar

[33] Zhou YF, Mao SL, Zhou RJ, Zhang XN, Zhang P, He YH, et al. The application of pollen isolation in apomixis germplasm identification of date plum (Diospyros lotus) by sealing stigma with white latex. J Fruit Sci. 2022;39(8):1–9.Search in Google Scholar

[34] Shimada T, Hirabayashi T, Endo T, Fujii H, Kita M, Omura M. Isolation and characterization of the somatic embryogenesis receptor-like kinase gene homologue (CitSERK1) from Citrus unshiu Marc. Sci Hortic. 2005;103(2):233–8.10.1016/j.scienta.2004.07.005Search in Google Scholar

[35] Ge XX, Fan GE, Chai LJ, Guo WW. Cloning, molecular characterization and expression analysis of a SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE gene (CitSERK1-like) in Valencia sweet orange. Acta Physiol Plant. 2010;32(6):1197–207.10.1007/s11738-010-0515-9Search in Google Scholar

[36] Bolat I, Dikilitas M, Ercisli S, Ikinci A, Tonkaz T. The effect of water stress on some morphological, physiological, and biochemical characteristics and bud success on apple and quince rootstocks. Sci World J. 2014;2014:769732.10.1155/2014/769732Search in Google Scholar

[37] Li G, Quan R, Cheng S, Hou X, Hu H. An HD-Zip transcription factor, VvHDZ4, in grapes (Vitis vinifera L.) confers enhanced drought tolerance in transgenic tomato. J Berry Res. 2021;11:217–29.10.3233/JBR-200632Search in Google Scholar

[38] Tan B, Chen TX, Han YP, Zhang YR, Zheng XB, Cheng J, et al. Cloning and expression analysis of SERK2 gene in different forms of Calli on peach (Prunus persica L.). Sci Agric Sin. 2019;52(5):882–92.Search in Google Scholar

[39] Yi L, Liangjian L, Linghui M, Chuqi L, Chang L, Wanjun W. Identification and expression analysis of SERK gene in Dendrobium officinale Kimura et Migo. J Biol. 2019;36(2):11.Search in Google Scholar

[40] Ma J, He YH, Hu ZY, Kanakala S, Xu WT, Xia JX, et al. Histological analysis of somatic embryogenesis in pineapple: AcSERK1 and its expression validation under stress conditions. J Plant Biochem Biotechnol. 2016;25(1):49–55.10.1007/s13562-015-0308-8Search in Google Scholar

[41] Xuekai G, Yuxi Z, Chunying L, Baolei D, Shupeng G. Cloning of somatic embryogenesis receptor-like kinase gene PsSERK2 and cell division rate analysis during dormancy release in tree peony (Paeonia suffruticosa). Acta Hortic Sin. 2018;45(3):511–8.Search in Google Scholar

[42] Dubos C, Stracke R, Grotewold E, Weisshaar B, Martin C, Lepiniec L. MYB transcription factors in Arabidopsis. Trends Plant Sci. 2010;15(10):573–81.10.1016/j.tplants.2010.06.005Search in Google Scholar

[43] Stracke R, Werber M, Weisshaar B. The R2R3-MYB gene family in Arabidopsis thaliana. Curr Opin Plant Biol. 2001;4(5):447–56.10.1016/S1369-5266(00)00199-0Search in Google Scholar

[44] Aharoni A, De Vos CHR, Wein M, Sun Z, Greco R, Kroon A, et al. The strawberry FaMYB1 transcription factor suppresses anthocyanin and flavonol accumulation in transgenic tobacco. Plant J. 2001;28(3):319–32.10.1046/j.1365-313X.2001.01154.xSearch in Google Scholar PubMed

[45] Matus JT, Aquea F, Arce-Johnson P. Analysis of the grape MYB R2R3 subfamily reveals expanded wine quality-related clades and conserved gene structure organization across Vitis and Arabidopsis genomes. BMC Plant Biol. 2008;8(1):83.10.1186/1471-2229-8-83Search in Google Scholar PubMed PubMed Central

[46] Gu QM, Zhao YY, Peng AY, Cheng FJ, Luo DF, Tang JT, et al. Genome-wide identification and phylogenetic analysis of SERK gene family in Brassica napus. Chinese J Oil Crop Sci. 2021;43(05):783–94.Search in Google Scholar

[47] Zheng L, Ma J, Mao J, Fan S, Zhang D, Zhao C, et al. Genome-wide identification of SERK genes in apple and analyses of their role in stress responses and growth. BMC Genomics. 2018;19(1):962.10.1186/s12864-018-5342-1Search in Google Scholar PubMed PubMed Central

[48] He FL, Liu X BZ. Bioinformatics identification of SERK genes and expression analysis under salt stress in soybean. Acta Agric Boreali-occidentalis Sin. 2019;28(10):1708–17.Search in Google Scholar

[49] Nolan KE, Irwanto RR, Rose RJ. Auxin up-regulates MtSERK1 expression in both Medicago truncatula root-forming and embryogenic cultures. Plant Physiol. 2003;133(1):218–30.10.1104/pp.103.020917Search in Google Scholar PubMed PubMed Central

Received: 2022-04-11
Revised: 2022-07-04
Accepted: 2022-08-09
Published Online: 2022-09-26

© 2022 Ruijin Zhou et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Effects of direct oral anticoagulants dabigatran and rivaroxaban on the blood coagulation function in rabbits
  3. The mother of all battles: Viruses vs humans. Can humans avoid extinction in 50–100 years?
  4. Knockdown of G1P3 inhibits cell proliferation and enhances the cytotoxicity of dexamethasone in acute lymphoblastic leukemia
  5. LINC00665 regulates hepatocellular carcinoma by modulating mRNA via the m6A enzyme
  6. Association study of CLDN14 variations in patients with kidney stones
  7. Concanavalin A-induced autoimmune hepatitis model in mice: Mechanisms and future outlook
  8. Regulation of miR-30b in cancer development, apoptosis, and drug resistance
  9. Informatic analysis of the pulmonary microecology in non-cystic fibrosis bronchiectasis at three different stages
  10. Swimming attenuates tumor growth in CT-26 tumor-bearing mice and suppresses angiogenesis by mediating the HIF-1α/VEGFA pathway
  11. Characterization of intestinal microbiota and serum metabolites in patients with mild hepatic encephalopathy
  12. Functional conservation and divergence in plant-specific GRF gene family revealed by sequences and expression analysis
  13. Application of the FLP/LoxP-FRT recombination system to switch the eGFP expression in a model prokaryote
  14. Biomedical evaluation of antioxidant properties of lamb meat enriched with iodine and selenium
  15. Intravenous infusion of the exosomes derived from human umbilical cord mesenchymal stem cells enhance neurological recovery after traumatic brain injury via suppressing the NF-κB pathway
  16. Effect of dietary pattern on pregnant women with gestational diabetes mellitus and its clinical significance
  17. Potential regulatory mechanism of TNF-α/TNFR1/ANXA1 in glioma cells and its role in glioma cell proliferation
  18. Effect of the genetic mutant G71R in uridine diphosphate-glucuronosyltransferase 1A1 on the conjugation of bilirubin
  19. Quercetin inhibits cytotoxicity of PC12 cells induced by amyloid-beta 25–35 via stimulating estrogen receptor α, activating ERK1/2, and inhibiting apoptosis
  20. Nutrition intervention in the management of novel coronavirus pneumonia patients
  21. circ-CFH promotes the development of HCC by regulating cell proliferation, apoptosis, migration, invasion, and glycolysis through the miR-377-3p/RNF38 axis
  22. Bmi-1 directly upregulates glucose transporter 1 in human gastric adenocarcinoma
  23. Lacunar infarction aggravates the cognitive deficit in the elderly with white matter lesion
  24. Hydroxysafflor yellow A improved retinopathy via Nrf2/HO-1 pathway in rats
  25. Comparison of axon extension: PTFE versus PLA formed by a 3D printer
  26. Elevated IL-35 level and iTr35 subset increase the bacterial burden and lung lesions in Mycobacterium tuberculosis-infected mice
  27. A case report of CAT gene and HNF1β gene variations in a patient with early-onset diabetes
  28. Study on the mechanism of inhibiting patulin production by fengycin
  29. SOX4 promotes high-glucose-induced inflammation and angiogenesis of retinal endothelial cells by activating NF-κB signaling pathway
  30. Relationship between blood clots and COVID-19 vaccines: A literature review
  31. Analysis of genetic characteristics of 436 children with dysplasia and detailed analysis of rare karyotype
  32. Bioinformatics network analyses of growth differentiation factor 11
  33. NR4A1 inhibits the epithelial–mesenchymal transition of hepatic stellate cells: Involvement of TGF-β–Smad2/3/4–ZEB signaling
  34. Expression of Zeb1 in the differentiation of mouse embryonic stem cell
  35. Study on the genetic damage caused by cadmium sulfide quantum dots in human lymphocytes
  36. Association between single-nucleotide polymorphisms of NKX2.5 and congenital heart disease in Chinese population: A meta-analysis
  37. Assessment of the anesthetic effect of modified pentothal sodium solution on Sprague-Dawley rats
  38. Genetic susceptibility to high myopia in Han Chinese population
  39. Potential biomarkers and molecular mechanisms in preeclampsia progression
  40. Silencing circular RNA-friend leukemia virus integration 1 restrained malignancy of CC cells and oxaliplatin resistance by disturbing dyskeratosis congenita 1
  41. Endostar plus pembrolizumab combined with a platinum-based dual chemotherapy regime for advanced pulmonary large-cell neuroendocrine carcinoma as a first-line treatment: A case report
  42. The significance of PAK4 in signaling and clinicopathology: A review
  43. Sorafenib inhibits ovarian cancer cell proliferation and mobility and induces radiosensitivity by targeting the tumor cell epithelial–mesenchymal transition
  44. Characterization of rabbit polyclonal antibody against camel recombinant nanobodies
  45. Active legumain promotes invasion and migration of neuroblastoma by regulating epithelial-mesenchymal transition
  46. Effect of cell receptors in the pathogenesis of osteoarthritis: Current insights
  47. MT-12 inhibits the proliferation of bladder cells in vitro and in vivo by enhancing autophagy through mitochondrial dysfunction
  48. Study of hsa_circRNA_000121 and hsa_circRNA_004183 in papillary thyroid microcarcinoma
  49. BuyangHuanwu Decoction attenuates cerebral vasospasm caused by subarachnoid hemorrhage in rats via PI3K/AKT/eNOS axis
  50. Effects of the interaction of Notch and TLR4 pathways on inflammation and heart function in septic heart
  51. Monosodium iodoacetate-induced subchondral bone microstructure and inflammatory changes in an animal model of osteoarthritis
  52. A rare presentation of type II Abernethy malformation and nephrotic syndrome: Case report and review
  53. Rapid death due to pulmonary epithelioid haemangioendothelioma in several weeks: A case report
  54. Hepatoprotective role of peroxisome proliferator-activated receptor-α in non-cancerous hepatic tissues following transcatheter arterial embolization
  55. Correlation between peripheral blood lymphocyte subpopulations and primary systemic lupus erythematosus
  56. A novel SLC8A1-ALK fusion in lung adenocarcinoma confers sensitivity to alectinib: A case report
  57. β-Hydroxybutyrate upregulates FGF21 expression through inhibition of histone deacetylases in hepatocytes
  58. Identification of metabolic genes for the prediction of prognosis and tumor microenvironment infiltration in early-stage non-small cell lung cancer
  59. BTBD10 inhibits glioma tumorigenesis by downregulating cyclin D1 and p-Akt
  60. Mucormycosis co-infection in COVID-19 patients: An update
  61. Metagenomic next-generation sequencing in diagnosing Pneumocystis jirovecii pneumonia: A case report
  62. Long non-coding RNA HOXB-AS1 is a prognostic marker and promotes hepatocellular carcinoma cells’ proliferation and invasion
  63. Preparation and evaluation of LA-PEG-SPION, a targeted MRI contrast agent for liver cancer
  64. Proteomic analysis of the liver regulating lipid metabolism in Chaohu ducks using two-dimensional electrophoresis
  65. Nasopharyngeal tuberculosis: A case report
  66. Characterization and evaluation of anti-Salmonella enteritidis activity of indigenous probiotic lactobacilli in mice
  67. Aberrant pulmonary immune response of obese mice to periodontal infection
  68. Bacteriospermia – A formidable player in male subfertility
  69. In silico and in vivo analysis of TIPE1 expression in diffuse large B cell lymphoma
  70. Effects of KCa channels on biological behavior of trophoblasts
  71. Interleukin-17A influences the vulnerability rather than the size of established atherosclerotic plaques in apolipoprotein E-deficient mice
  72. Multiple organ failure and death caused by Staphylococcus aureus hip infection: A case report
  73. Prognostic signature related to the immune environment of oral squamous cell carcinoma
  74. Primary and metastatic squamous cell carcinoma of the thyroid gland: Two case reports
  75. Neuroprotective effects of crocin and crocin-loaded niosomes against the paraquat-induced oxidative brain damage in rats
  76. Role of MMP-2 and CD147 in kidney fibrosis
  77. Geometric basis of action potential of skeletal muscle cells and neurons
  78. Babesia microti-induced fulminant sepsis in an immunocompromised host: A case report and the case-specific literature review
  79. Role of cerebellar cortex in associative learning and memory in guinea pigs
  80. Application of metagenomic next-generation sequencing technique for diagnosing a specific case of necrotizing meningoencephalitis caused by human herpesvirus 2
  81. Case report: Quadruple primary malignant neoplasms including esophageal, ureteral, and lung in an elderly male
  82. Long non-coding RNA NEAT1 promotes angiogenesis in hepatoma carcinoma via the miR-125a-5p/VEGF pathway
  83. Osteogenic differentiation of periodontal membrane stem cells in inflammatory environments
  84. Knockdown of SHMT2 enhances the sensitivity of gastric cancer cells to radiotherapy through the Wnt/β-catenin pathway
  85. Continuous renal replacement therapy combined with double filtration plasmapheresis in the treatment of severe lupus complicated by serious bacterial infections in children: A case report
  86. Simultaneous triple primary malignancies, including bladder cancer, lymphoma, and lung cancer, in an elderly male: A case report
  87. Preclinical immunogenicity assessment of a cell-based inactivated whole-virion H5N1 influenza vaccine
  88. One case of iodine-125 therapy – A new minimally invasive treatment of intrahepatic cholangiocarcinoma
  89. S1P promotes corneal trigeminal neuron differentiation and corneal nerve repair via upregulating nerve growth factor expression in a mouse model
  90. Early cancer detection by a targeted methylation assay of circulating tumor DNA in plasma
  91. Calcifying nanoparticles initiate the calcification process of mesenchymal stem cells in vitro through the activation of the TGF-β1/Smad signaling pathway and promote the decay of echinococcosis
  92. Evaluation of prognostic markers in patients infected with SARS-CoV-2
  93. N6-Methyladenosine-related alternative splicing events play a role in bladder cancer
  94. Characterization of the structural, oxidative, and immunological features of testis tissue from Zucker diabetic fatty rats
  95. Effects of glucose and osmotic pressure on the proliferation and cell cycle of human chorionic trophoblast cells
  96. Investigation of genotype diversity of 7,804 norovirus sequences in humans and animals of China
  97. Characteristics and karyotype analysis of a patient with turner syndrome complicated with multiple-site tumors: A case report
  98. Aggravated renal fibrosis is positively associated with the activation of HMGB1-TLR2/4 signaling in STZ-induced diabetic mice
  99. Distribution characteristics of SARS-CoV-2 IgM/IgG in false-positive results detected by chemiluminescent immunoassay
  100. SRPX2 attenuated oxygen–glucose deprivation and reperfusion-induced injury in cardiomyocytes via alleviating endoplasmic reticulum stress-induced apoptosis through targeting PI3K/Akt/mTOR axis
  101. Aquaporin-8 overexpression is involved in vascular structure and function changes in placentas of gestational diabetes mellitus patients
  102. Relationship between CRP gene polymorphisms and ischemic stroke risk: A systematic review and meta-analysis
  103. Effects of growth hormone on lipid metabolism and sexual development in pubertal obese male rats
  104. Cloning and identification of the CTLA-4IgV gene and functional application of vaccine in Xinjiang sheep
  105. Antitumor activity of RUNX3: Upregulation of E-cadherin and downregulation of the epithelial–mesenchymal transition in clear-cell renal cell carcinoma
  106. PHF8 promotes osteogenic differentiation of BMSCs in old rat with osteoporosis by regulating Wnt/β-catenin pathway
  107. A review of the current state of the computer-aided diagnosis (CAD) systems for breast cancer diagnosis
  108. Bilateral dacryoadenitis in adult-onset Still’s disease: A case report
  109. A novel association between Bmi-1 protein expression and the SUVmax obtained by 18F-FDG PET/CT in patients with gastric adenocarcinoma
  110. The role of erythrocytes and erythroid progenitor cells in tumors
  111. Relationship between platelet activation markers and spontaneous abortion: A meta-analysis
  112. Abnormal methylation caused by folic acid deficiency in neural tube defects
  113. Silencing TLR4 using an ultrasound-targeted microbubble destruction-based shRNA system reduces ischemia-induced seizures in hyperglycemic rats
  114. Plant Sciences
  115. Seasonal succession of bacterial communities in cultured Caulerpa lentillifera detected by high-throughput sequencing
  116. Cloning and prokaryotic expression of WRKY48 from Caragana intermedia
  117. Novel Brassica hybrids with different resistance to Leptosphaeria maculans reveal unbalanced rDNA signal patterns
  118. Application of exogenous auxin and gibberellin regulates the bolting of lettuce (Lactuca sativa L.)
  119. Phytoremediation of pollutants from wastewater: A concise review
  120. Genome-wide identification and characterization of NBS-encoding genes in the sweet potato wild ancestor Ipomoea trifida (H.B.K.)
  121. Alleviative effects of magnetic Fe3O4 nanoparticles on the physiological toxicity of 3-nitrophenol to rice (Oryza sativa L.) seedlings
  122. Selection and functional identification of Dof genes expressed in response to nitrogen in Populus simonii × Populus nigra
  123. Study on pecan seed germination influenced by seed endocarp
  124. Identification of active compounds in Ophiopogonis Radix from different geographical origins by UPLC-Q/TOF-MS combined with GC-MS approaches
  125. The entire chloroplast genome sequence of Asparagus cochinchinensis and genetic comparison to Asparagus species
  126. Genome-wide identification of MAPK family genes and their response to abiotic stresses in tea plant (Camellia sinensis)
  127. Selection and validation of reference genes for RT-qPCR analysis of different organs at various development stages in Caragana intermedia
  128. Cloning and expression analysis of SERK1 gene in Diospyros lotus
  129. Integrated metabolomic and transcriptomic profiling revealed coping mechanisms of the edible and medicinal homologous plant Plantago asiatica L. cadmium resistance
  130. A missense variant in NCF1 is associated with susceptibility to unexplained recurrent spontaneous abortion
  131. Assessment of drought tolerance indices in faba bean genotypes under different irrigation regimes
  132. The entire chloroplast genome sequence of Asparagus setaceus (Kunth) Jessop: Genome structure, gene composition, and phylogenetic analysis in Asparagaceae
  133. Food Science
  134. Dietary food additive monosodium glutamate with or without high-lipid diet induces spleen anomaly: A mechanistic approach on rat model
  135. Binge eating disorder during COVID-19
  136. Potential of honey against the onset of autoimmune diabetes and its associated nephropathy, pancreatitis, and retinopathy in type 1 diabetic animal model
  137. FTO gene expression in diet-induced obesity is downregulated by Solanum fruit supplementation
  138. Physical activity enhances fecal lactobacilli in rats chronically drinking sweetened cola beverage
  139. Supercritical CO2 extraction, chemical composition, and antioxidant effects of Coreopsis tinctoria Nutt. oleoresin
  140. Functional constituents of plant-based foods boost immunity against acute and chronic disorders
  141. Effect of selenium and methods of protein extraction on the proteomic profile of Saccharomyces yeast
  142. Microbial diversity of milk ghee in southern Gansu and its effect on the formation of ghee flavor compounds
  143. Ecology and Environmental Sciences
  144. Effects of heavy metals on bacterial community surrounding Bijiashan mining area located in northwest China
  145. Microorganism community composition analysis coupling with 15N tracer experiments reveals the nitrification rate and N2O emissions in low pH soils in Southern China
  146. Genetic diversity and population structure of Cinnamomum balansae Lecomte inferred by microsatellites
  147. Preliminary screening of microplastic contamination in different marine fish species of Taif market, Saudi Arabia
  148. Plant volatile organic compounds attractive to Lygus pratensis
  149. Effects of organic materials on soil bacterial community structure in long-term continuous cropping of tomato in greenhouse
  150. Effects of soil treated fungicide fluopimomide on tomato (Solanum lycopersicum L.) disease control and plant growth
  151. Prevalence of Yersinia pestis among rodents captured in a semi-arid tropical ecosystem of south-western Zimbabwe
  152. Effects of irrigation and nitrogen fertilization on mitigating salt-induced Na+ toxicity and sustaining sea rice growth
  153. Bioengineering and Biotechnology
  154. Poly-l-lysine-caused cell adhesion induces pyroptosis in THP-1 monocytes
  155. Development of alkaline phosphatase-scFv and its use for one-step enzyme-linked immunosorbent assay for His-tagged protein detection
  156. Development and validation of a predictive model for immune-related genes in patients with tongue squamous cell carcinoma
  157. Agriculture
  158. Effects of chemical-based fertilizer replacement with biochar-based fertilizer on albic soil nutrient content and maize yield
  159. Genome-wide identification and expression analysis of CPP-like gene family in Triticum aestivum L. under different hormone and stress conditions
  160. Agronomic and economic performance of mung bean (Vigna radiata L.) varieties in response to rates of blended NPS fertilizer in Kindo Koysha district, Southern Ethiopia
  161. Influence of furrow irrigation regime on the yield and water consumption indicators of winter wheat based on a multi-level fuzzy comprehensive evaluation
  162. Discovery of exercise-related genes and pathway analysis based on comparative genomes of Mongolian originated Abaga and Wushen horse
  163. Lessons from integrated seasonal forecast-crop modelling in Africa: A systematic review
  164. Evolution trend of soil fertility in tobacco-planting area of Chenzhou, Hunan Province, China
  165. Animal Sciences
  166. Morphological and molecular characterization of Tatera indica Hardwicke 1807 (Rodentia: Muridae) from Pothwar, Pakistan
  167. Research on meat quality of Qianhua Mutton Merino sheep and Small-tail Han sheep
  168. SI: A Scientific Memoir
  169. Suggestions on leading an academic research laboratory group
  170. My scientific genealogy and the Toronto ACDC Laboratory, 1988–2022
  171. Erratum
  172. Erratum to “Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study”
  173. Erratum to “A two-microRNA signature predicts the progression of male thyroid cancer”
  174. Retraction
  175. Retraction of “Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis”
Downloaded on 11.3.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0490/html
Scroll to top button