Home Application of the FLP/LoxP-FRT recombination system to switch the eGFP expression in a model prokaryote
Article Open Access

Application of the FLP/LoxP-FRT recombination system to switch the eGFP expression in a model prokaryote

  • Junhao Dan , Huafeng Deng , Yumei Xia , Yijie Zhan , Ning Tang , Yao Wang and Mengliang Cao EMAIL logo
Published/Copyright: March 11, 2022
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 17 Issue 1

Abstract

In prokaryotes, few studies have applied the flippase (FLP)/P1-flippase recombination target (LoxP-FRT) recombination system to switch gene expression. This study developed a new method for switching gene expression by constructing an FLP/LoxP-FRT site-specific recombination system in Escherichia coli. To this end, we placed the Nos terminator flanked by a pair of LoxP-FRT in front of enhanced green fluorescent protein (eGFP). The Nos terminator was used to block the expression of the eGFP. When a plasmid expressing FLP was available, deletion of the Nos terminator would allow expression of eGFP. The regulatory effect was demonstrated by eGFP expression. The efficiency of the gene switch was calculated as high as 89.67%. The results showed that the FLP/LoxP-FRT recombinase system could be used as a gene switch to regulate gene expression in prokaryotes. This new method for switching gene expression could simplify the gene function analysis in E. coli and other prokaryotes, as well as eukaryotes.

Graphical abstract

Keywords: FLP/LoxP-FRT ; gene switch; Escherichia coli ; eGFP ; prokaryotic

1 Introduction

Escherichia coli is a Gram-negative bacterium. Most E. coli strains have a capsular structure and fimbriae. Due to its simple structure and well-understood genetic background, it is an important model organism and one of the most commonly used bacteria for gene transformations currently [1]. Terminator is a DNA sequence that functions to terminate DNA transcription and release RNA. Hence, the terminator plays an important role in regulating gene expression [2,3]. At present, some universal terminators are used in plant genetic transformation vectors and most of them are derived from viruses or other microorganisms. Among them, Nos terminator is one of the most widely used terminators in plant molecular breeding [4].

The flippase (FLP) recombinase system is derived from the 2 µm plasmid of Saccharomyces cerevisiae. Depending on the location and direction of the flippase recombination target (FRT) recognition sites, FLP recombinase can invert, recombine, and position the DNA sequence between the recognition sites [5]. When FRT recognition sites have different orientations and are located on the same chromosome, FLP recombinase inverts the sequences between the recognition sites; when FRT recognition sites have the same orientation and are located on the same chromosome, FLP recombinase removes the entire region between the recognition sites, leaving only one recognition site; and when FRT recognition sites are in the same orientation but are located on different chromosomes, the two chromosomes will exchange DNA around the recognition sites under the action of FLP recombinase [6]. As the FLP recombinase system has been shown to have high recombination efficiency and target in eukaryotes, it is widely used in higher eukaryotes such as rice, Arabidopsis and tobacco for deletion of exogenous and marker genes at present [7,8,9,10,11,12]. Studies have shown that in the FLP recombination system, gene recombination efficiency was higher when using the locus of crossing over in the P1-flippase recombination target (LoxP-FRT) fusion recognition site compared with the FRT single recognition site [13,14]. Introduction of a nuclear localization signal (NLS) can also improve gene recombination efficiency [10].

In addition to eukaryotes, the FLP/FRT recombination system has also been used in prokaryotes. A markerless mutant was generated in cyanobacteria by using FLP recombinase to delete the kanamycin (KAN) resistance gene between two FRT recognition sites [15]. The FLP recombinase was used to eliminate the resistance genes between two FRT sites in E. coli [16]. Apart from this, there have been few studies about the FLP/LoxP-FRT site-specific recombination system operating as a gene switch to regulate target gene expression.

The purpose of this study was to develop a new method for switching gene expression by constructing an FLP/LoxP-FRT site-specific recombination system in E. coli. The regulatory effect was demonstrated by enhanced green fluorescent protein (eGFP) expression. This new method of switching gene expression could simplify the analysis of the gene function in prokaryotes and eukaryotes. The effectiveness of this method provides a reference for the FLP/LoxP-FRT recombinase system as a gene switch and basis for the future gene switch of other recombinase systems.

2 Materials and methods

2.1 Bacterial strains and transformations

E. coli strain BL21 was used for this study. The liquid medium used for E. coli growth was Luria Broth (LB; 10.0 g tryptone, 5.0 g yeast extract, and 10.0 g sodium chloride per 1 L water), whereas LB agar was used as the solid medium (LB with 15.0 g agar per 1 L). For selective media (used to isolate transformed bacteria), the final concentrations of KAN, ampicillin (AMP), and isopropyl-β-D-thiopyrgalactoside (IPTG) were 50 µg/mL, 100 µg/mL, and 0.5 mmol/L, respectively.

Vectors pET-21a (+) and pRSFDuet-1 were purchased from GenScript Biotechnology Co. Ltd. The Ep30TL vector was constructed using EcoRI and SacI enzymes (Thermo Fisher Scientific, Tokyo, Japan) to double digest the pET-21a (+) vector, and then the synthetic fragment seq30TL (containing Nos terminator between two LoxP/FRT sites and tagged with eGFP) was ligated to the pET-21a (+) vector by T4 DNA ligase (Promega, Wisconsin, USA) (Figure 1). The p30TK vector was constructed by double digestion of the pRSFDuet-1 vector with EcoRI and SacI enzymes followed by the ligation of the synthetic fragment seq30TK (containing FLP between NLS and tagged with Nos terminator) to the pRSFDuet-1 vector by T4 DNA ligase (Figure 2). Ep30TLK competent cells were prepared as described by Sambrook and Russell [17]. The vector p30TK was transformed into Ep30TL competent cells by electroporation and the transformed line (Ep30TLK) was grown at 37℃ with shaking at 180 rpm/min for 1 h. Approximately, 100–200 µL of the resulting culture was spread on LB agar containing KAN + AMP + IPTG.

Figure 1 Construction scheme of Ep30TL vector. Using EcoRI and SacI enzymes to double digest the pET-21a (+) vector, the vector Ep30TL was obtained by attaching seq30TL to the pET-21a (+) vector with T4 DNA ligase.
Figure 1

Construction scheme of Ep30TL vector. Using EcoRI and SacI enzymes to double digest the pET-21a (+) vector, the vector Ep30TL was obtained by attaching seq30TL to the pET-21a (+) vector with T4 DNA ligase.

Figure 2 Construction scheme of p30TK vector. Using EcoRI and SacI enzymes to double digest the pRSFDuet-1 vector, the vector p30TK was obtained by attaching seq30TK to the pRSFDuet-1 vector with T4 DNA ligase.
Figure 2

Construction scheme of p30TK vector. Using EcoRI and SacI enzymes to double digest the pRSFDuet-1 vector, the vector p30TK was obtained by attaching seq30TK to the pRSFDuet-1 vector with T4 DNA ligase.

2.2 Vector sequence verification

The following primer sequences were designed for verification to ensure the sequences of the Ep30TL, p30TK, and Ep30TLK vectors were correct. The primers F1 and R1 were used to verify the Loxp-FRT-Nos-Loxp-FRT-eGFP vector Ep30TL sequence, where LoxP-FRT sequences with the same orientation were added at both ends of the Nos terminator, and the eGFP gene was added at the 3′ end. The primers F2 and R2 were used to verify the FLP recombinase expression vector p30TK. The EcoRI restriction site was introduced at the 5′ end of the FLP gene and the SacI restriction site was introduced at the 3′ end. The Ep30TLK vector, the product of p30TK transformation into Ep30TL competent cells by electroporation, was verified by sequencing with F1, R1, F2, and R2 primers. The synthesis and sequencing of the primers were completed by Tsingke Biotechnology Co. Ltd.

F1: CCGGATATAGTTCCTCCTTTC

R1: AGATCTCGATCCCGCGAAAT

F2: GTATATGTGCCTACTAACGC

R2: CTTTCATCAATTGTGGAAGA.

2.3 Regulatory efficiency calculations

Ep30TLK was cultured on LB medium supplemented with KAN + AMP + IPTG at 37°C. Samples of 50 cultures of 100 µL each were mounted on glass slides. Ep30TL competent cells were negative control without p30TK. Prepared slides were then analyzed with a Confocal 880 laser, confocal scanning microscope and stimulated with a laser at 488 nm to obtain scanning images of E. coli at different points in time post inoculation.

The study has set three replicates to calculate the efficiency of gene switch. The calculations of total bacteria were made from bacterial populations that were more or less similar in number in the negative control and treated bacterial cells. The efficiency of the gene switch was calculated as the number of single green fluorescent colonies divided by the total number of colonies.

DNA extraction was performed according to the instructions of the plasmid DNA microextraction kit (Magen, Guangzhou, China). Gel purification was performed according to the instructions of the gel midi purification kit (Tiangen, Beijing, China). Restriction digests were incubated at 37°C for 30 min according to the manufacturer instructions (Thermo Fisher Scientific, Tokyo, Japan).

2.4 Statistical analysis

Preliminary calculations were performed on the data using excel tables, SPSS16.0 statistical analysis software was used to perform variance analysis on the data of deletion efficiency of FLP recombinase, and all the data were analyzed by the least significant difference method at 5% level.

3 Results and analysis

3.1 Verification of transformants with Ep30TL and p30TK

As shown in Figure 3, the Ep30TL plasmid was identified by single and double enzyme digestion with restriction endonucleases, EcoRI and SacI. The single digests each resulted in DNA fragments of 6,613 bp while the double digest resulted in two fragments of 5,441 bp and 1,172 bp, respectively; one was the pET-21a (+) plasmid vector and the other was the seq30TL insertion fragment. The electrophoresis results showed that the expected fragments were obtained and the sequencing results were consistent with the enzyme digestion results, further indicating that the cells were successfully transformed with the Ep30TL plasmid.

Figure 3 Visualization of Ep30TL plasmid digest products. Lane M1 and M2 are Marker-1kb and Marker-DL2000, respectively (Tiangen, Beijing, China); they showed molecular size marker as indicated alongside in kilodaltons. Lane 1: product of Ep30TL plasmid digested with EcoRI. Lane 2: product of Ep30TL plasmid digested with SacI. Lane 3: product of Ep30TL plasmid digested with EcoRI and SacI. Lane 4: undigested Ep30TL plasmid.
Figure 3

Visualization of Ep30TL plasmid digest products. Lane M1 and M2 are Marker-1kb and Marker-DL2000, respectively (Tiangen, Beijing, China); they showed molecular size marker as indicated alongside in kilodaltons. Lane 1: product of Ep30TL plasmid digested with EcoRI. Lane 2: product of Ep30TL plasmid digested with SacI. Lane 3: product of Ep30TL plasmid digested with EcoRI and SacI. Lane 4: undigested Ep30TL plasmid.

The p30TK plasmid was verified using the same method. As shown in Figure 4, the EcoRI enzyme single digest resulted in 4,666 bp and 800 bp fragments, while the SacI enzyme single digest resulted in a fragment of 5,466 bp. Double digest with EcoRI and SacI resulted in fragments of 3,819 bp, 847 bp, and 800 bp, consistent with the expectations. The p30TK plasmid isolated from the transformed bacteria was sequenced and found to be 100% homologous to the reference sequence, thus demonstrating that the transformation with p30TK was successful.

Figure 4 Visualization of p30TK plasmid digest product. Lane M1 and M2 are Marker-1kb and Marker-DL1000, respectively (Tiangen, Beijing, China). Lane 1: product of p30TK plasmid digested with EcoRI. Lane 2: product of p30TK plasmid digested with SacI. Lane 3: product of p30TK plasmid digested with EcoRI and SacI. Lane 4: undigested p30TK plasmid.
Figure 4

Visualization of p30TK plasmid digest product. Lane M1 and M2 are Marker-1kb and Marker-DL1000, respectively (Tiangen, Beijing, China). Lane 1: product of p30TK plasmid digested with EcoRI. Lane 2: product of p30TK plasmid digested with SacI. Lane 3: product of p30TK plasmid digested with EcoRI and SacI. Lane 4: undigested p30TK plasmid.

3.2 Expression of p30TK in Ep30TL competent cells

Through electroporation method, p30TK was transformed into Ep30TL competent cells, and the transformed product (Ep30TLK) and negative control were added to LB medium separately. Bacterial culture was then sampled to observe the fluorescence with a laser confocal microscope.

As shown in Figure 5, eGFP did not express in the negative control (Figure 5a), demonstrating that the gene eGFP was locked in Ep30TL. The expression of eGFP was observed in Ep30TLK in five different fields (Figure 5b–f), which proved that p30TK had been transformed into Ep30TL competent cells, and the Nos terminator was deleted by FLP recombinase in Ep30TLK. The FLP/LoxP-FRT recombination system to switch the eGFP expression was successful in E. coli by observing the expression of eGFP.

Figure 5 eGFP expression in different samples under the laser confocal microscope. Left: Fluorescence images; middle: bright field images; right: overlay images.
Figure 5

eGFP expression in different samples under the laser confocal microscope. Left: Fluorescence images; middle: bright field images; right: overlay images.

3.3 Regulatory efficiency of gene switch

In the negative control, expression of eGFP was not observed in bacterial cells (Figure 6a). In Ep30TLK, expression of eGFP was observed in single colonies under a fluorescence microscope, with three different types of colonies being identified: those with no eGFP expression (“single white colonies,” Figure 6b); those with some eGFP expression (“single green and white colonies,” Figure 6c); and those with full eGFP expression (“single green colonies,” Figure 6d). Single white colonies resulted from Nos terminator not being deleted, preventing eGFP expression. Similarly, the appearance of single green and white colonies was due to the incomplete deletion of Nos terminator by FLP recombinase, while the occurrence of green fluorescent single colonies was because eGFP could be expressed after the complete deletion of Nos terminator. Thus, it could be concluded that the FLP/LoxP-FRT recombination system could switch the gene eGFP expression in a single colony.

Figure 6 Expression of eGFP in single colonies in the transformation of bacterial cells. (a) Single white colony in the negative control. (b) Single white colony in Ep30TLK. (c) Single green and white colony in Ep30TLK. (d) Single green colony in Ep30TLK. The left column shows images taken with green fluorescent microscopy and the right column shows images taken with bright field microscopy.
Figure 6

Expression of eGFP in single colonies in the transformation of bacterial cells. (a) Single white colony in the negative control. (b) Single white colony in Ep30TLK. (c) Single green and white colony in Ep30TLK. (d) Single green colony in Ep30TLK. The left column shows images taken with green fluorescent microscopy and the right column shows images taken with bright field microscopy.

Then, the regulatory efficiency of gene switch in E. coli could be calculated. Statistical results are shown in Table 1; the efficiency of the gene switch in Ep30TLK was calculated in this study as ∼87.10–89.67%.

Table 1

Regulatory efficiency of gene switch in E. coli

Treatment The total population of bacteria in each plate Rate of FLP recombinant enzyme deletion (%)
Negative control 315 0
Ep30TLK1 296 87.60 ± 2.04
Ep30TLK2 306 87.10 ± 2.91
Ep30TLK3 284 89.67 ± 1.42

3.4 Verification of Ep30TLK plasmid

The three different single colonies shown in Figure 6 were cultured in liquid medium, then plasmids were extracted from each. Extracted plasmids were named Ep30TLK1, Ep30TLK2, and Ep30TLK3, each corresponding to the white, green and white, and green colonies, respectively. As shown in Figure 7a, EcoRI and SacI double digestion of Ep30TLK1 and Ep30TLK2 results in 1,172 bp fragments; when the same digestion was performed with Ep30TLK3, an 808 bp fragment was seen but not a 1,172 bp fragment, thus indicating that Nos terminator in Ep30TLK3 had been deleted by FLP recombinase. Results of each plasmid from single digests with EcoRI and SacI were also in line with the expectations. Finally, the Ep30TLK1, Ep30TLK2, and Ep30TLK3 plasmids were sequenced to unambiguously verify their identity and were found to be consistent with the reference sequence.

Figure 7 Identification of restriction enzyme digestion of Ep30TLK plasmid. (a) Lane M1 and M2 are Marker-1kb and Marker-DL2000, respectively (Tiangen, Beijing, China). Lanes 1, 2, and 3: products of Ep30TLK1 plasmid digestion with EcoRI, SacI, and EcoRI + SacI, respectively. Lanes 4, 5, and 6: products of Ep30TLK2 plasmid digestion with EcoRI, SacI, and EcoRI + SacI, respectively. Lanes 7, 8, and 9: products of Ep30TLK3 plasmid digestion with EcoRI, SacI, and EcoRI + SacI, respectively. (b) In the Ep30TLK3 plasmid, the deletion of Nos in Ep30TL leads to expression of eGFP.
Figure 7

Identification of restriction enzyme digestion of Ep30TLK plasmid. (a) Lane M1 and M2 are Marker-1kb and Marker-DL2000, respectively (Tiangen, Beijing, China). Lanes 1, 2, and 3: products of Ep30TLK1 plasmid digestion with EcoRI, SacI, and EcoRI + SacI, respectively. Lanes 4, 5, and 6: products of Ep30TLK2 plasmid digestion with EcoRI, SacI, and EcoRI + SacI, respectively. Lanes 7, 8, and 9: products of Ep30TLK3 plasmid digestion with EcoRI, SacI, and EcoRI + SacI, respectively. (b) In the Ep30TLK3 plasmid, the deletion of Nos in Ep30TL leads to expression of eGFP.

The double digestion model of vector Ep30TLK is shown in Figure 7b. After p30TK was transformed into Ep30TL competent cells, if FLP recombinase fully deleted Nos terminator in Ep30TL, the plasmid Ep30TLK3 could be obtained after identification from eGFP expression. The deletion of the Nos terminator would lead to an 808 bp fragment resulting from double digestion with EcoRI and SacI. The results shown in Figure 5 were consistent with the double digestion model.

4 Discussion

In this study, the FLP/LoxP-FRT recombination system was used as a gene switch, controlling the temporal and spatial specificity to precisely regulate target gene expression. The FLP recombination acted as the “gene key” while Nos terminator was the “gene lock” that hindered the expression of eGFP. When the FLP recombinase recognized the LoxP-FRT fusion site and deleted the Nos terminator, the “gene key” opened the “gene lock” and eGFP could be expressed. The efficiency of the gene switch was calculated as high as 89.67%.

Exploring the efficiency of the FRT/LoxP-FRT recombination system in E. coli provides a reference for the research of prokaryotes with other site-specific recombination systems. For example, when studying the Cre/LoxP system from bacteriophage P1, based on the prior construction of a label-free transgenic Chlamydomonas reinhardtii [18], the Cre recombinase can be combined with the LoxP-FRT fusion site and applied to other prokaryotes. Alternatively, the method presented in this study could be used with the recombinase/recombination site (R/RS) system from Zygosaccharomyces to verify the effectiveness and gene switch efficiency of the R/RS recombinant systems quickly and efficiently.

This principle has been shown previously using the Cre/loxP site-specific recombination system as a gene switch in hybrid rice; one cassette was the KEY, containing a nuclear-localized Cre recombinase driven by the green-tissue-specific promoter rbcS, while another cassette was the LOCK, containing a Nos terminator between two loxP sites. When the two cassettes were pyramided into hybrid rice, the Cre recombination from the KEY would excise loxP-NosT in the LOCK, the gene of interest could express in green tissues but not express in the endosperm [19]. For future research in eukaryotes, we can consider changing the “gene key” promoter to regulate gene expression specifically. In the FLP/LoxP-FRT gene switch, the expression of FLP recombinase is designed to be driven by the specific promoter. The design strategy is to first deactivate all gene expressions and then activate expression in only the desired locations.

In addition to the FLP/LoxP-FRT gene switch that we constructed in this study for switching eGFP gene expression in the E. coli, we have considered another method for switching gene expression. When the promoter flanks by a pair of FRT in the opposite direction (FRT-promoter-FRT [opposite]), it can drive the expression of the eGFP. When FLP is expressed, the expression of eGFP is hindered because the promoter has been reversed. Compared with the “FRT-promoter-FRT (opposite)” method, our FLP/LoxP-FRT gene switch is stable. In the “FRT-promoter-FRT (opposite)” method, the promoter sequences between the FRT sites (opposite) would be inverted constantly and that may not regulate gene expression precisely. Therefore, as shown in our FLP/LoxP-FRT gene switch, the Nos terminator was added between the LoxP-FRT sites (same orientation) to hinder the expression of eGFP, when a plasmid expressed FLP recombinase, the Nos terminator was deleted instead of inverted, eGFP was expressed, and a stable gene switch was constructed in E. coli.

In conclusion, the FLP/LoxP-FRT gene switch has good development potential in prokaryotes and eukaryotes. First, in the research on the synthesis of natural products by recombinant microorganisms, the FLP/LoxP-FRT gene switch can be used to dynamically regulate the metabolic flow, that is, when the microorganisms grow to a certain stage, the “gene key” opens the “gene lock” to specifically express a specific protein at a specific time, thereby effectively distributing the intracellular metabolic flux and ultimately increasing the output of natural products. Second, for future research in eukaryotes, such as the cultivation of transgenic plants, the FRT/LoxP-FRT gene switch has the advantage of the ability to regulate the expression of foreign genes and marker genes to produce marker-free transgenic plants, thereby relieving public concerns about transgenic plants.

These authors contributed equally to this work.

  1. Funding information: This work was supported by the Bureau of Science and Technology of Changsha Municipality (grant kq2004052), the Natural Science Foundation of Hainan province (321MS108).

  2. Author contributions: J.H.D. and H.F.D. performed the experiments and analyzed the data, M.L.C. conceived the study, Y.M.X. and Y.J.Z. designed the experiments, N.T. and Y.W. helped with data analysis. J.H.D. and H.F.D. wrote the manuscript. All authors have read and approved the final manuscript. The authors applied the FLAE approach for the sequence of authors.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Guo MY, Wu JF. Research status on preparation and transformation of E. coli competent cells. J Hebei North Univ (Nat Sci Ed). 2020;36(8):44–8.Search in Google Scholar

[2] Mayr C. Regulation by 3-untranslated regions. Annu Rev Genet. 2017;51(1):171–94.10.1146/annurev-genet-120116-024704Search in Google Scholar PubMed

[3] Curran KA, Morse NJ, Markham KA, Wagman AM, Gupta A, Alper HS. Short synthetic terminators for improved heterologous gene expression in yeast. ACS Synth Biol. 2015;4(7):824–32.10.1021/sb5003357Search in Google Scholar PubMed

[4] Li J, Qu SH. PolyA trapping by using terminatorless RFP reporter gene in rice. Acta Agric Zhejiangensis. 2012;24(5):758–63.Search in Google Scholar

[5] Zhao Y, Yu T, Xing SC. Application of Cre/lox site-specific recombination system in transgenic plants. Chin J Biochem Mol Biol. 2010;26(2):95–103.Search in Google Scholar

[6] Long DP, Tan B, Zhao AC, Xu LX, Xiang ZH. Progress in Cre/lox site-specific recombination system in higher eukaryotes. Herditas. 2012;34(2):177–89.10.3724/SP.J.1005.2012.00177Search in Google Scholar PubMed

[7] Qin LJ, Li QL, Zhao DG. Study on exogenous gene deletion from transgenic tobacco by leaf senescence-induced FLP recombinase. Acta Tabacaria Sin. 2019;25(6):90–7.Search in Google Scholar

[8] Nguyen LD, Underwood JL, Nandy S, Akbudak MA, Srivastava V. Strong activity of FLPe recombinase in rice plants does not correlate with the transmission of the recombined locus to the progeny. Plant Biotechnol Rep. 2014;8(6):455–62.10.1007/s11816-014-0332-5Search in Google Scholar

[9] Zou LL, Wei JH, Wang HZ, Zhang SB. Construction of Bhlea2 gene vector with efficient deleting marker gene system in transgenic plants. Biotechnol Bull. 2011;27(11):79–82.Search in Google Scholar

[10] Gao JL. Reconstruction of split-recombinase FLP and its recombination activation in transgenic tobacco [Research article]. Chongqing: Southwest University; 2012.Search in Google Scholar

[11] Woo HJ, Qin Y, Park SY, Park SK, Cho YG, Shin KS, et al. Development of selectable marker-free transgenic rice plants with enhanced seed tocopherol content through FLP/FRT-mediated spontaneous auto-excision. PLoS One. 2017;10(7):1–16.10.1371/journal.pone.0132667Search in Google Scholar PubMed PubMed Central

[12] Liu RC, Long Q, Zou XP, Wang Y, Pei Y. DNA methylation occurring in Cre-expressing cells inhibits loxP recombination and silences loxP-sandwiched genes. N Phytologist. 2021;231(1):210–24.10.1111/nph.17353Search in Google Scholar PubMed

[13] Luo K, Duan H, Zhao D, Zheng XL, Deng W, Chen YQ, et al. ‘GM-gene-deletor’: Fused loxP-FRT recognition sequences dramatic-ally improve the efficiency of FLP or CRE recombinase on transgene excision from pollen and seed of tobacco plants. Plant Biotechnol J. 2007;5(2):263–374.10.1111/j.1467-7652.2006.00237.xSearch in Google Scholar PubMed

[14] Yan XH, Wang H, Ye YY, Zeng G, Ma RC, Mi FG, et al. pYBA100: an ease-of-use binary vector with LoxP-FRT recombinase site for plant transformation. Mol Plant Breed. 2012;10(3):371–9.Search in Google Scholar

[15] Tan XM, Liang FY, Cai K, Lu XF. Application of the FLP/FRT recombination system in cyanobacteria for construction of markerless mutants. Appl Microbiol Biotechnol. 2013;97(14):6373–82.10.1007/s00253-013-4837-6Search in Google Scholar PubMed

[16] Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci. 2000;97(12):6640–5.10.1073/pnas.120163297Search in Google Scholar PubMed PubMed Central

[17] Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. 3rd edn. China: Science Press; 2002.Search in Google Scholar

[18] Kasai YK, Harayama SG. Construction of marker-free transgenic strains of chlamydomonas reinhardtii using a Cre/loxP-mediated recombinase system. PLoS One. 2016;11(8):e0161733.10.1371/journal.pone.0161733Search in Google Scholar PubMed PubMed Central

[19] Chen H, Luo J, Zheng P, Zhang XB, Zhang CC, Li XY, et al. Application of Cre-lox gene switch to limit the Cry expression in rice green tissues. Sci Rep. 2017(6);7(1):14505–19.10.1038/s41598-017-14679-0Search in Google Scholar PubMed PubMed Central

Received: 2021-08-20
Revised: 2021-12-11
Accepted: 2022-01-03
Published Online: 2022-03-11

© 2022 Junhao Dan et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Effects of direct oral anticoagulants dabigatran and rivaroxaban on the blood coagulation function in rabbits
  3. The mother of all battles: Viruses vs humans. Can humans avoid extinction in 50–100 years?
  4. Knockdown of G1P3 inhibits cell proliferation and enhances the cytotoxicity of dexamethasone in acute lymphoblastic leukemia
  5. LINC00665 regulates hepatocellular carcinoma by modulating mRNA via the m6A enzyme
  6. Association study of CLDN14 variations in patients with kidney stones
  7. Concanavalin A-induced autoimmune hepatitis model in mice: Mechanisms and future outlook
  8. Regulation of miR-30b in cancer development, apoptosis, and drug resistance
  9. Informatic analysis of the pulmonary microecology in non-cystic fibrosis bronchiectasis at three different stages
  10. Swimming attenuates tumor growth in CT-26 tumor-bearing mice and suppresses angiogenesis by mediating the HIF-1α/VEGFA pathway
  11. Characterization of intestinal microbiota and serum metabolites in patients with mild hepatic encephalopathy
  12. Functional conservation and divergence in plant-specific GRF gene family revealed by sequences and expression analysis
  13. Application of the FLP/LoxP-FRT recombination system to switch the eGFP expression in a model prokaryote
  14. Biomedical evaluation of antioxidant properties of lamb meat enriched with iodine and selenium
  15. Intravenous infusion of the exosomes derived from human umbilical cord mesenchymal stem cells enhance neurological recovery after traumatic brain injury via suppressing the NF-κB pathway
  16. Effect of dietary pattern on pregnant women with gestational diabetes mellitus and its clinical significance
  17. Potential regulatory mechanism of TNF-α/TNFR1/ANXA1 in glioma cells and its role in glioma cell proliferation
  18. Effect of the genetic mutant G71R in uridine diphosphate-glucuronosyltransferase 1A1 on the conjugation of bilirubin
  19. Quercetin inhibits cytotoxicity of PC12 cells induced by amyloid-beta 25–35 via stimulating estrogen receptor α, activating ERK1/2, and inhibiting apoptosis
  20. Nutrition intervention in the management of novel coronavirus pneumonia patients
  21. circ-CFH promotes the development of HCC by regulating cell proliferation, apoptosis, migration, invasion, and glycolysis through the miR-377-3p/RNF38 axis
  22. Bmi-1 directly upregulates glucose transporter 1 in human gastric adenocarcinoma
  23. Lacunar infarction aggravates the cognitive deficit in the elderly with white matter lesion
  24. Hydroxysafflor yellow A improved retinopathy via Nrf2/HO-1 pathway in rats
  25. Comparison of axon extension: PTFE versus PLA formed by a 3D printer
  26. Elevated IL-35 level and iTr35 subset increase the bacterial burden and lung lesions in Mycobacterium tuberculosis-infected mice
  27. A case report of CAT gene and HNF1β gene variations in a patient with early-onset diabetes
  28. Study on the mechanism of inhibiting patulin production by fengycin
  29. SOX4 promotes high-glucose-induced inflammation and angiogenesis of retinal endothelial cells by activating NF-κB signaling pathway
  30. Relationship between blood clots and COVID-19 vaccines: A literature review
  31. Analysis of genetic characteristics of 436 children with dysplasia and detailed analysis of rare karyotype
  32. Bioinformatics network analyses of growth differentiation factor 11
  33. NR4A1 inhibits the epithelial–mesenchymal transition of hepatic stellate cells: Involvement of TGF-β–Smad2/3/4–ZEB signaling
  34. Expression of Zeb1 in the differentiation of mouse embryonic stem cell
  35. Study on the genetic damage caused by cadmium sulfide quantum dots in human lymphocytes
  36. Association between single-nucleotide polymorphisms of NKX2.5 and congenital heart disease in Chinese population: A meta-analysis
  37. Assessment of the anesthetic effect of modified pentothal sodium solution on Sprague-Dawley rats
  38. Genetic susceptibility to high myopia in Han Chinese population
  39. Potential biomarkers and molecular mechanisms in preeclampsia progression
  40. Silencing circular RNA-friend leukemia virus integration 1 restrained malignancy of CC cells and oxaliplatin resistance by disturbing dyskeratosis congenita 1
  41. Endostar plus pembrolizumab combined with a platinum-based dual chemotherapy regime for advanced pulmonary large-cell neuroendocrine carcinoma as a first-line treatment: A case report
  42. The significance of PAK4 in signaling and clinicopathology: A review
  43. Sorafenib inhibits ovarian cancer cell proliferation and mobility and induces radiosensitivity by targeting the tumor cell epithelial–mesenchymal transition
  44. Characterization of rabbit polyclonal antibody against camel recombinant nanobodies
  45. Active legumain promotes invasion and migration of neuroblastoma by regulating epithelial-mesenchymal transition
  46. Effect of cell receptors in the pathogenesis of osteoarthritis: Current insights
  47. MT-12 inhibits the proliferation of bladder cells in vitro and in vivo by enhancing autophagy through mitochondrial dysfunction
  48. Study of hsa_circRNA_000121 and hsa_circRNA_004183 in papillary thyroid microcarcinoma
  49. BuyangHuanwu Decoction attenuates cerebral vasospasm caused by subarachnoid hemorrhage in rats via PI3K/AKT/eNOS axis
  50. Effects of the interaction of Notch and TLR4 pathways on inflammation and heart function in septic heart
  51. Monosodium iodoacetate-induced subchondral bone microstructure and inflammatory changes in an animal model of osteoarthritis
  52. A rare presentation of type II Abernethy malformation and nephrotic syndrome: Case report and review
  53. Rapid death due to pulmonary epithelioid haemangioendothelioma in several weeks: A case report
  54. Hepatoprotective role of peroxisome proliferator-activated receptor-α in non-cancerous hepatic tissues following transcatheter arterial embolization
  55. Correlation between peripheral blood lymphocyte subpopulations and primary systemic lupus erythematosus
  56. A novel SLC8A1-ALK fusion in lung adenocarcinoma confers sensitivity to alectinib: A case report
  57. β-Hydroxybutyrate upregulates FGF21 expression through inhibition of histone deacetylases in hepatocytes
  58. Identification of metabolic genes for the prediction of prognosis and tumor microenvironment infiltration in early-stage non-small cell lung cancer
  59. BTBD10 inhibits glioma tumorigenesis by downregulating cyclin D1 and p-Akt
  60. Mucormycosis co-infection in COVID-19 patients: An update
  61. Metagenomic next-generation sequencing in diagnosing Pneumocystis jirovecii pneumonia: A case report
  62. Long non-coding RNA HOXB-AS1 is a prognostic marker and promotes hepatocellular carcinoma cells’ proliferation and invasion
  63. Preparation and evaluation of LA-PEG-SPION, a targeted MRI contrast agent for liver cancer
  64. Proteomic analysis of the liver regulating lipid metabolism in Chaohu ducks using two-dimensional electrophoresis
  65. Nasopharyngeal tuberculosis: A case report
  66. Characterization and evaluation of anti-Salmonella enteritidis activity of indigenous probiotic lactobacilli in mice
  67. Aberrant pulmonary immune response of obese mice to periodontal infection
  68. Bacteriospermia – A formidable player in male subfertility
  69. In silico and in vivo analysis of TIPE1 expression in diffuse large B cell lymphoma
  70. Effects of KCa channels on biological behavior of trophoblasts
  71. Interleukin-17A influences the vulnerability rather than the size of established atherosclerotic plaques in apolipoprotein E-deficient mice
  72. Multiple organ failure and death caused by Staphylococcus aureus hip infection: A case report
  73. Prognostic signature related to the immune environment of oral squamous cell carcinoma
  74. Primary and metastatic squamous cell carcinoma of the thyroid gland: Two case reports
  75. Neuroprotective effects of crocin and crocin-loaded niosomes against the paraquat-induced oxidative brain damage in rats
  76. Role of MMP-2 and CD147 in kidney fibrosis
  77. Geometric basis of action potential of skeletal muscle cells and neurons
  78. Babesia microti-induced fulminant sepsis in an immunocompromised host: A case report and the case-specific literature review
  79. Role of cerebellar cortex in associative learning and memory in guinea pigs
  80. Application of metagenomic next-generation sequencing technique for diagnosing a specific case of necrotizing meningoencephalitis caused by human herpesvirus 2
  81. Case report: Quadruple primary malignant neoplasms including esophageal, ureteral, and lung in an elderly male
  82. Long non-coding RNA NEAT1 promotes angiogenesis in hepatoma carcinoma via the miR-125a-5p/VEGF pathway
  83. Osteogenic differentiation of periodontal membrane stem cells in inflammatory environments
  84. Knockdown of SHMT2 enhances the sensitivity of gastric cancer cells to radiotherapy through the Wnt/β-catenin pathway
  85. Continuous renal replacement therapy combined with double filtration plasmapheresis in the treatment of severe lupus complicated by serious bacterial infections in children: A case report
  86. Simultaneous triple primary malignancies, including bladder cancer, lymphoma, and lung cancer, in an elderly male: A case report
  87. Preclinical immunogenicity assessment of a cell-based inactivated whole-virion H5N1 influenza vaccine
  88. One case of iodine-125 therapy – A new minimally invasive treatment of intrahepatic cholangiocarcinoma
  89. S1P promotes corneal trigeminal neuron differentiation and corneal nerve repair via upregulating nerve growth factor expression in a mouse model
  90. Early cancer detection by a targeted methylation assay of circulating tumor DNA in plasma
  91. Calcifying nanoparticles initiate the calcification process of mesenchymal stem cells in vitro through the activation of the TGF-β1/Smad signaling pathway and promote the decay of echinococcosis
  92. Evaluation of prognostic markers in patients infected with SARS-CoV-2
  93. N6-Methyladenosine-related alternative splicing events play a role in bladder cancer
  94. Characterization of the structural, oxidative, and immunological features of testis tissue from Zucker diabetic fatty rats
  95. Effects of glucose and osmotic pressure on the proliferation and cell cycle of human chorionic trophoblast cells
  96. Investigation of genotype diversity of 7,804 norovirus sequences in humans and animals of China
  97. Characteristics and karyotype analysis of a patient with turner syndrome complicated with multiple-site tumors: A case report
  98. Aggravated renal fibrosis is positively associated with the activation of HMGB1-TLR2/4 signaling in STZ-induced diabetic mice
  99. Distribution characteristics of SARS-CoV-2 IgM/IgG in false-positive results detected by chemiluminescent immunoassay
  100. SRPX2 attenuated oxygen–glucose deprivation and reperfusion-induced injury in cardiomyocytes via alleviating endoplasmic reticulum stress-induced apoptosis through targeting PI3K/Akt/mTOR axis
  101. Aquaporin-8 overexpression is involved in vascular structure and function changes in placentas of gestational diabetes mellitus patients
  102. Relationship between CRP gene polymorphisms and ischemic stroke risk: A systematic review and meta-analysis
  103. Effects of growth hormone on lipid metabolism and sexual development in pubertal obese male rats
  104. Cloning and identification of the CTLA-4IgV gene and functional application of vaccine in Xinjiang sheep
  105. Antitumor activity of RUNX3: Upregulation of E-cadherin and downregulation of the epithelial–mesenchymal transition in clear-cell renal cell carcinoma
  106. PHF8 promotes osteogenic differentiation of BMSCs in old rat with osteoporosis by regulating Wnt/β-catenin pathway
  107. A review of the current state of the computer-aided diagnosis (CAD) systems for breast cancer diagnosis
  108. Bilateral dacryoadenitis in adult-onset Still’s disease: A case report
  109. A novel association between Bmi-1 protein expression and the SUVmax obtained by 18F-FDG PET/CT in patients with gastric adenocarcinoma
  110. The role of erythrocytes and erythroid progenitor cells in tumors
  111. Relationship between platelet activation markers and spontaneous abortion: A meta-analysis
  112. Abnormal methylation caused by folic acid deficiency in neural tube defects
  113. Silencing TLR4 using an ultrasound-targeted microbubble destruction-based shRNA system reduces ischemia-induced seizures in hyperglycemic rats
  114. Plant Sciences
  115. Seasonal succession of bacterial communities in cultured Caulerpa lentillifera detected by high-throughput sequencing
  116. Cloning and prokaryotic expression of WRKY48 from Caragana intermedia
  117. Novel Brassica hybrids with different resistance to Leptosphaeria maculans reveal unbalanced rDNA signal patterns
  118. Application of exogenous auxin and gibberellin regulates the bolting of lettuce (Lactuca sativa L.)
  119. Phytoremediation of pollutants from wastewater: A concise review
  120. Genome-wide identification and characterization of NBS-encoding genes in the sweet potato wild ancestor Ipomoea trifida (H.B.K.)
  121. Alleviative effects of magnetic Fe3O4 nanoparticles on the physiological toxicity of 3-nitrophenol to rice (Oryza sativa L.) seedlings
  122. Selection and functional identification of Dof genes expressed in response to nitrogen in Populus simonii × Populus nigra
  123. Study on pecan seed germination influenced by seed endocarp
  124. Identification of active compounds in Ophiopogonis Radix from different geographical origins by UPLC-Q/TOF-MS combined with GC-MS approaches
  125. The entire chloroplast genome sequence of Asparagus cochinchinensis and genetic comparison to Asparagus species
  126. Genome-wide identification of MAPK family genes and their response to abiotic stresses in tea plant (Camellia sinensis)
  127. Selection and validation of reference genes for RT-qPCR analysis of different organs at various development stages in Caragana intermedia
  128. Cloning and expression analysis of SERK1 gene in Diospyros lotus
  129. Integrated metabolomic and transcriptomic profiling revealed coping mechanisms of the edible and medicinal homologous plant Plantago asiatica L. cadmium resistance
  130. A missense variant in NCF1 is associated with susceptibility to unexplained recurrent spontaneous abortion
  131. Assessment of drought tolerance indices in faba bean genotypes under different irrigation regimes
  132. The entire chloroplast genome sequence of Asparagus setaceus (Kunth) Jessop: Genome structure, gene composition, and phylogenetic analysis in Asparagaceae
  133. Food Science
  134. Dietary food additive monosodium glutamate with or without high-lipid diet induces spleen anomaly: A mechanistic approach on rat model
  135. Binge eating disorder during COVID-19
  136. Potential of honey against the onset of autoimmune diabetes and its associated nephropathy, pancreatitis, and retinopathy in type 1 diabetic animal model
  137. FTO gene expression in diet-induced obesity is downregulated by Solanum fruit supplementation
  138. Physical activity enhances fecal lactobacilli in rats chronically drinking sweetened cola beverage
  139. Supercritical CO2 extraction, chemical composition, and antioxidant effects of Coreopsis tinctoria Nutt. oleoresin
  140. Functional constituents of plant-based foods boost immunity against acute and chronic disorders
  141. Effect of selenium and methods of protein extraction on the proteomic profile of Saccharomyces yeast
  142. Microbial diversity of milk ghee in southern Gansu and its effect on the formation of ghee flavor compounds
  143. Ecology and Environmental Sciences
  144. Effects of heavy metals on bacterial community surrounding Bijiashan mining area located in northwest China
  145. Microorganism community composition analysis coupling with 15N tracer experiments reveals the nitrification rate and N2O emissions in low pH soils in Southern China
  146. Genetic diversity and population structure of Cinnamomum balansae Lecomte inferred by microsatellites
  147. Preliminary screening of microplastic contamination in different marine fish species of Taif market, Saudi Arabia
  148. Plant volatile organic compounds attractive to Lygus pratensis
  149. Effects of organic materials on soil bacterial community structure in long-term continuous cropping of tomato in greenhouse
  150. Effects of soil treated fungicide fluopimomide on tomato (Solanum lycopersicum L.) disease control and plant growth
  151. Prevalence of Yersinia pestis among rodents captured in a semi-arid tropical ecosystem of south-western Zimbabwe
  152. Effects of irrigation and nitrogen fertilization on mitigating salt-induced Na+ toxicity and sustaining sea rice growth
  153. Bioengineering and Biotechnology
  154. Poly-l-lysine-caused cell adhesion induces pyroptosis in THP-1 monocytes
  155. Development of alkaline phosphatase-scFv and its use for one-step enzyme-linked immunosorbent assay for His-tagged protein detection
  156. Development and validation of a predictive model for immune-related genes in patients with tongue squamous cell carcinoma
  157. Agriculture
  158. Effects of chemical-based fertilizer replacement with biochar-based fertilizer on albic soil nutrient content and maize yield
  159. Genome-wide identification and expression analysis of CPP-like gene family in Triticum aestivum L. under different hormone and stress conditions
  160. Agronomic and economic performance of mung bean (Vigna radiata L.) varieties in response to rates of blended NPS fertilizer in Kindo Koysha district, Southern Ethiopia
  161. Influence of furrow irrigation regime on the yield and water consumption indicators of winter wheat based on a multi-level fuzzy comprehensive evaluation
  162. Discovery of exercise-related genes and pathway analysis based on comparative genomes of Mongolian originated Abaga and Wushen horse
  163. Lessons from integrated seasonal forecast-crop modelling in Africa: A systematic review
  164. Evolution trend of soil fertility in tobacco-planting area of Chenzhou, Hunan Province, China
  165. Animal Sciences
  166. Morphological and molecular characterization of Tatera indica Hardwicke 1807 (Rodentia: Muridae) from Pothwar, Pakistan
  167. Research on meat quality of Qianhua Mutton Merino sheep and Small-tail Han sheep
  168. SI: A Scientific Memoir
  169. Suggestions on leading an academic research laboratory group
  170. My scientific genealogy and the Toronto ACDC Laboratory, 1988–2022
  171. Erratum
  172. Erratum to “Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study”
  173. Erratum to “A two-microRNA signature predicts the progression of male thyroid cancer”
  174. Retraction
  175. Retraction of “Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis”
https://doi.org/10.1515/biol-2022-0019
Keywords for this article
FLP/LoxP-FRT; gene switch; Escherichia coli; eGFP; prokaryotic
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Effects of direct oral anticoagulants dabigatran and rivaroxaban on the blood coagulation function in rabbits
  3. The mother of all battles: Viruses vs humans. Can humans avoid extinction in 50–100 years?
  4. Knockdown of G1P3 inhibits cell proliferation and enhances the cytotoxicity of dexamethasone in acute lymphoblastic leukemia
  5. LINC00665 regulates hepatocellular carcinoma by modulating mRNA via the m6A enzyme
  6. Association study of CLDN14 variations in patients with kidney stones
  7. Concanavalin A-induced autoimmune hepatitis model in mice: Mechanisms and future outlook
  8. Regulation of miR-30b in cancer development, apoptosis, and drug resistance
  9. Informatic analysis of the pulmonary microecology in non-cystic fibrosis bronchiectasis at three different stages
  10. Swimming attenuates tumor growth in CT-26 tumor-bearing mice and suppresses angiogenesis by mediating the HIF-1α/VEGFA pathway
  11. Characterization of intestinal microbiota and serum metabolites in patients with mild hepatic encephalopathy
  12. Functional conservation and divergence in plant-specific GRF gene family revealed by sequences and expression analysis
  13. Application of the FLP/LoxP-FRT recombination system to switch the eGFP expression in a model prokaryote
  14. Biomedical evaluation of antioxidant properties of lamb meat enriched with iodine and selenium
  15. Intravenous infusion of the exosomes derived from human umbilical cord mesenchymal stem cells enhance neurological recovery after traumatic brain injury via suppressing the NF-κB pathway
  16. Effect of dietary pattern on pregnant women with gestational diabetes mellitus and its clinical significance
  17. Potential regulatory mechanism of TNF-α/TNFR1/ANXA1 in glioma cells and its role in glioma cell proliferation
  18. Effect of the genetic mutant G71R in uridine diphosphate-glucuronosyltransferase 1A1 on the conjugation of bilirubin
  19. Quercetin inhibits cytotoxicity of PC12 cells induced by amyloid-beta 25–35 via stimulating estrogen receptor α, activating ERK1/2, and inhibiting apoptosis
  20. Nutrition intervention in the management of novel coronavirus pneumonia patients
  21. circ-CFH promotes the development of HCC by regulating cell proliferation, apoptosis, migration, invasion, and glycolysis through the miR-377-3p/RNF38 axis
  22. Bmi-1 directly upregulates glucose transporter 1 in human gastric adenocarcinoma
  23. Lacunar infarction aggravates the cognitive deficit in the elderly with white matter lesion
  24. Hydroxysafflor yellow A improved retinopathy via Nrf2/HO-1 pathway in rats
  25. Comparison of axon extension: PTFE versus PLA formed by a 3D printer
  26. Elevated IL-35 level and iTr35 subset increase the bacterial burden and lung lesions in Mycobacterium tuberculosis-infected mice
  27. A case report of CAT gene and HNF1β gene variations in a patient with early-onset diabetes
  28. Study on the mechanism of inhibiting patulin production by fengycin
  29. SOX4 promotes high-glucose-induced inflammation and angiogenesis of retinal endothelial cells by activating NF-κB signaling pathway
  30. Relationship between blood clots and COVID-19 vaccines: A literature review
  31. Analysis of genetic characteristics of 436 children with dysplasia and detailed analysis of rare karyotype
  32. Bioinformatics network analyses of growth differentiation factor 11
  33. NR4A1 inhibits the epithelial–mesenchymal transition of hepatic stellate cells: Involvement of TGF-β–Smad2/3/4–ZEB signaling
  34. Expression of Zeb1 in the differentiation of mouse embryonic stem cell
  35. Study on the genetic damage caused by cadmium sulfide quantum dots in human lymphocytes
  36. Association between single-nucleotide polymorphisms of NKX2.5 and congenital heart disease in Chinese population: A meta-analysis
  37. Assessment of the anesthetic effect of modified pentothal sodium solution on Sprague-Dawley rats
  38. Genetic susceptibility to high myopia in Han Chinese population
  39. Potential biomarkers and molecular mechanisms in preeclampsia progression
  40. Silencing circular RNA-friend leukemia virus integration 1 restrained malignancy of CC cells and oxaliplatin resistance by disturbing dyskeratosis congenita 1
  41. Endostar plus pembrolizumab combined with a platinum-based dual chemotherapy regime for advanced pulmonary large-cell neuroendocrine carcinoma as a first-line treatment: A case report
  42. The significance of PAK4 in signaling and clinicopathology: A review
  43. Sorafenib inhibits ovarian cancer cell proliferation and mobility and induces radiosensitivity by targeting the tumor cell epithelial–mesenchymal transition
  44. Characterization of rabbit polyclonal antibody against camel recombinant nanobodies
  45. Active legumain promotes invasion and migration of neuroblastoma by regulating epithelial-mesenchymal transition
  46. Effect of cell receptors in the pathogenesis of osteoarthritis: Current insights
  47. MT-12 inhibits the proliferation of bladder cells in vitro and in vivo by enhancing autophagy through mitochondrial dysfunction
  48. Study of hsa_circRNA_000121 and hsa_circRNA_004183 in papillary thyroid microcarcinoma
  49. BuyangHuanwu Decoction attenuates cerebral vasospasm caused by subarachnoid hemorrhage in rats via PI3K/AKT/eNOS axis
  50. Effects of the interaction of Notch and TLR4 pathways on inflammation and heart function in septic heart
  51. Monosodium iodoacetate-induced subchondral bone microstructure and inflammatory changes in an animal model of osteoarthritis
  52. A rare presentation of type II Abernethy malformation and nephrotic syndrome: Case report and review
  53. Rapid death due to pulmonary epithelioid haemangioendothelioma in several weeks: A case report
  54. Hepatoprotective role of peroxisome proliferator-activated receptor-α in non-cancerous hepatic tissues following transcatheter arterial embolization
  55. Correlation between peripheral blood lymphocyte subpopulations and primary systemic lupus erythematosus
  56. A novel SLC8A1-ALK fusion in lung adenocarcinoma confers sensitivity to alectinib: A case report
  57. β-Hydroxybutyrate upregulates FGF21 expression through inhibition of histone deacetylases in hepatocytes
  58. Identification of metabolic genes for the prediction of prognosis and tumor microenvironment infiltration in early-stage non-small cell lung cancer
  59. BTBD10 inhibits glioma tumorigenesis by downregulating cyclin D1 and p-Akt
  60. Mucormycosis co-infection in COVID-19 patients: An update
  61. Metagenomic next-generation sequencing in diagnosing Pneumocystis jirovecii pneumonia: A case report
  62. Long non-coding RNA HOXB-AS1 is a prognostic marker and promotes hepatocellular carcinoma cells’ proliferation and invasion
  63. Preparation and evaluation of LA-PEG-SPION, a targeted MRI contrast agent for liver cancer
  64. Proteomic analysis of the liver regulating lipid metabolism in Chaohu ducks using two-dimensional electrophoresis
  65. Nasopharyngeal tuberculosis: A case report
  66. Characterization and evaluation of anti-Salmonella enteritidis activity of indigenous probiotic lactobacilli in mice
  67. Aberrant pulmonary immune response of obese mice to periodontal infection
  68. Bacteriospermia – A formidable player in male subfertility
  69. In silico and in vivo analysis of TIPE1 expression in diffuse large B cell lymphoma
  70. Effects of KCa channels on biological behavior of trophoblasts
  71. Interleukin-17A influences the vulnerability rather than the size of established atherosclerotic plaques in apolipoprotein E-deficient mice
  72. Multiple organ failure and death caused by Staphylococcus aureus hip infection: A case report
  73. Prognostic signature related to the immune environment of oral squamous cell carcinoma
  74. Primary and metastatic squamous cell carcinoma of the thyroid gland: Two case reports
  75. Neuroprotective effects of crocin and crocin-loaded niosomes against the paraquat-induced oxidative brain damage in rats
  76. Role of MMP-2 and CD147 in kidney fibrosis
  77. Geometric basis of action potential of skeletal muscle cells and neurons
  78. Babesia microti-induced fulminant sepsis in an immunocompromised host: A case report and the case-specific literature review
  79. Role of cerebellar cortex in associative learning and memory in guinea pigs
  80. Application of metagenomic next-generation sequencing technique for diagnosing a specific case of necrotizing meningoencephalitis caused by human herpesvirus 2
  81. Case report: Quadruple primary malignant neoplasms including esophageal, ureteral, and lung in an elderly male
  82. Long non-coding RNA NEAT1 promotes angiogenesis in hepatoma carcinoma via the miR-125a-5p/VEGF pathway
  83. Osteogenic differentiation of periodontal membrane stem cells in inflammatory environments
  84. Knockdown of SHMT2 enhances the sensitivity of gastric cancer cells to radiotherapy through the Wnt/β-catenin pathway
  85. Continuous renal replacement therapy combined with double filtration plasmapheresis in the treatment of severe lupus complicated by serious bacterial infections in children: A case report
  86. Simultaneous triple primary malignancies, including bladder cancer, lymphoma, and lung cancer, in an elderly male: A case report
  87. Preclinical immunogenicity assessment of a cell-based inactivated whole-virion H5N1 influenza vaccine
  88. One case of iodine-125 therapy – A new minimally invasive treatment of intrahepatic cholangiocarcinoma
  89. S1P promotes corneal trigeminal neuron differentiation and corneal nerve repair via upregulating nerve growth factor expression in a mouse model
  90. Early cancer detection by a targeted methylation assay of circulating tumor DNA in plasma
  91. Calcifying nanoparticles initiate the calcification process of mesenchymal stem cells in vitro through the activation of the TGF-β1/Smad signaling pathway and promote the decay of echinococcosis
  92. Evaluation of prognostic markers in patients infected with SARS-CoV-2
  93. N6-Methyladenosine-related alternative splicing events play a role in bladder cancer
  94. Characterization of the structural, oxidative, and immunological features of testis tissue from Zucker diabetic fatty rats
  95. Effects of glucose and osmotic pressure on the proliferation and cell cycle of human chorionic trophoblast cells
  96. Investigation of genotype diversity of 7,804 norovirus sequences in humans and animals of China
  97. Characteristics and karyotype analysis of a patient with turner syndrome complicated with multiple-site tumors: A case report
  98. Aggravated renal fibrosis is positively associated with the activation of HMGB1-TLR2/4 signaling in STZ-induced diabetic mice
  99. Distribution characteristics of SARS-CoV-2 IgM/IgG in false-positive results detected by chemiluminescent immunoassay
  100. SRPX2 attenuated oxygen–glucose deprivation and reperfusion-induced injury in cardiomyocytes via alleviating endoplasmic reticulum stress-induced apoptosis through targeting PI3K/Akt/mTOR axis
  101. Aquaporin-8 overexpression is involved in vascular structure and function changes in placentas of gestational diabetes mellitus patients
  102. Relationship between CRP gene polymorphisms and ischemic stroke risk: A systematic review and meta-analysis
  103. Effects of growth hormone on lipid metabolism and sexual development in pubertal obese male rats
  104. Cloning and identification of the CTLA-4IgV gene and functional application of vaccine in Xinjiang sheep
  105. Antitumor activity of RUNX3: Upregulation of E-cadherin and downregulation of the epithelial–mesenchymal transition in clear-cell renal cell carcinoma
  106. PHF8 promotes osteogenic differentiation of BMSCs in old rat with osteoporosis by regulating Wnt/β-catenin pathway
  107. A review of the current state of the computer-aided diagnosis (CAD) systems for breast cancer diagnosis
  108. Bilateral dacryoadenitis in adult-onset Still’s disease: A case report
  109. A novel association between Bmi-1 protein expression and the SUVmax obtained by 18F-FDG PET/CT in patients with gastric adenocarcinoma
  110. The role of erythrocytes and erythroid progenitor cells in tumors
  111. Relationship between platelet activation markers and spontaneous abortion: A meta-analysis
  112. Abnormal methylation caused by folic acid deficiency in neural tube defects
  113. Silencing TLR4 using an ultrasound-targeted microbubble destruction-based shRNA system reduces ischemia-induced seizures in hyperglycemic rats
  114. Plant Sciences
  115. Seasonal succession of bacterial communities in cultured Caulerpa lentillifera detected by high-throughput sequencing
  116. Cloning and prokaryotic expression of WRKY48 from Caragana intermedia
  117. Novel Brassica hybrids with different resistance to Leptosphaeria maculans reveal unbalanced rDNA signal patterns
  118. Application of exogenous auxin and gibberellin regulates the bolting of lettuce (Lactuca sativa L.)
  119. Phytoremediation of pollutants from wastewater: A concise review
  120. Genome-wide identification and characterization of NBS-encoding genes in the sweet potato wild ancestor Ipomoea trifida (H.B.K.)
  121. Alleviative effects of magnetic Fe3O4 nanoparticles on the physiological toxicity of 3-nitrophenol to rice (Oryza sativa L.) seedlings
  122. Selection and functional identification of Dof genes expressed in response to nitrogen in Populus simonii × Populus nigra
  123. Study on pecan seed germination influenced by seed endocarp
  124. Identification of active compounds in Ophiopogonis Radix from different geographical origins by UPLC-Q/TOF-MS combined with GC-MS approaches
  125. The entire chloroplast genome sequence of Asparagus cochinchinensis and genetic comparison to Asparagus species
  126. Genome-wide identification of MAPK family genes and their response to abiotic stresses in tea plant (Camellia sinensis)
  127. Selection and validation of reference genes for RT-qPCR analysis of different organs at various development stages in Caragana intermedia
  128. Cloning and expression analysis of SERK1 gene in Diospyros lotus
  129. Integrated metabolomic and transcriptomic profiling revealed coping mechanisms of the edible and medicinal homologous plant Plantago asiatica L. cadmium resistance
  130. A missense variant in NCF1 is associated with susceptibility to unexplained recurrent spontaneous abortion
  131. Assessment of drought tolerance indices in faba bean genotypes under different irrigation regimes
  132. The entire chloroplast genome sequence of Asparagus setaceus (Kunth) Jessop: Genome structure, gene composition, and phylogenetic analysis in Asparagaceae
  133. Food Science
  134. Dietary food additive monosodium glutamate with or without high-lipid diet induces spleen anomaly: A mechanistic approach on rat model
  135. Binge eating disorder during COVID-19
  136. Potential of honey against the onset of autoimmune diabetes and its associated nephropathy, pancreatitis, and retinopathy in type 1 diabetic animal model
  137. FTO gene expression in diet-induced obesity is downregulated by Solanum fruit supplementation
  138. Physical activity enhances fecal lactobacilli in rats chronically drinking sweetened cola beverage
  139. Supercritical CO2 extraction, chemical composition, and antioxidant effects of Coreopsis tinctoria Nutt. oleoresin
  140. Functional constituents of plant-based foods boost immunity against acute and chronic disorders
  141. Effect of selenium and methods of protein extraction on the proteomic profile of Saccharomyces yeast
  142. Microbial diversity of milk ghee in southern Gansu and its effect on the formation of ghee flavor compounds
  143. Ecology and Environmental Sciences
  144. Effects of heavy metals on bacterial community surrounding Bijiashan mining area located in northwest China
  145. Microorganism community composition analysis coupling with 15N tracer experiments reveals the nitrification rate and N2O emissions in low pH soils in Southern China
  146. Genetic diversity and population structure of Cinnamomum balansae Lecomte inferred by microsatellites
  147. Preliminary screening of microplastic contamination in different marine fish species of Taif market, Saudi Arabia
  148. Plant volatile organic compounds attractive to Lygus pratensis
  149. Effects of organic materials on soil bacterial community structure in long-term continuous cropping of tomato in greenhouse
  150. Effects of soil treated fungicide fluopimomide on tomato (Solanum lycopersicum L.) disease control and plant growth
  151. Prevalence of Yersinia pestis among rodents captured in a semi-arid tropical ecosystem of south-western Zimbabwe
  152. Effects of irrigation and nitrogen fertilization on mitigating salt-induced Na+ toxicity and sustaining sea rice growth
  153. Bioengineering and Biotechnology
  154. Poly-l-lysine-caused cell adhesion induces pyroptosis in THP-1 monocytes
  155. Development of alkaline phosphatase-scFv and its use for one-step enzyme-linked immunosorbent assay for His-tagged protein detection
  156. Development and validation of a predictive model for immune-related genes in patients with tongue squamous cell carcinoma
  157. Agriculture
  158. Effects of chemical-based fertilizer replacement with biochar-based fertilizer on albic soil nutrient content and maize yield
  159. Genome-wide identification and expression analysis of CPP-like gene family in Triticum aestivum L. under different hormone and stress conditions
  160. Agronomic and economic performance of mung bean (Vigna radiata L.) varieties in response to rates of blended NPS fertilizer in Kindo Koysha district, Southern Ethiopia
  161. Influence of furrow irrigation regime on the yield and water consumption indicators of winter wheat based on a multi-level fuzzy comprehensive evaluation
  162. Discovery of exercise-related genes and pathway analysis based on comparative genomes of Mongolian originated Abaga and Wushen horse
  163. Lessons from integrated seasonal forecast-crop modelling in Africa: A systematic review
  164. Evolution trend of soil fertility in tobacco-planting area of Chenzhou, Hunan Province, China
  165. Animal Sciences
  166. Morphological and molecular characterization of Tatera indica Hardwicke 1807 (Rodentia: Muridae) from Pothwar, Pakistan
  167. Research on meat quality of Qianhua Mutton Merino sheep and Small-tail Han sheep
  168. SI: A Scientific Memoir
  169. Suggestions on leading an academic research laboratory group
  170. My scientific genealogy and the Toronto ACDC Laboratory, 1988–2022
  171. Erratum
  172. Erratum to “Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study”
  173. Erratum to “A two-microRNA signature predicts the progression of male thyroid cancer”
  174. Retraction
  175. Retraction of “Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis”
Stay updated on our offers and services
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 23.6.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0019/html
Scroll to top button