Abstract
This study aimed to examine whether nuclear receptor 4a1 (NR4A1) is involved in inhibiting hepatic stellate cell (HSC) activation and liver fibrosis through the epithelial–mesenchymal transition (EMT). HSC-T6 cells were divided into the control group, the acetaldehyde (200 μM, an EMT activator) group, and the NR4A1 activation group (Cytosporone B; 1 μM). The expression levels of the epithelial marker E-cadherin, the mesenchymal markers fibronectin (FN), vimentin, smooth muscle alpha-actin (α-SMA), and fibroblast-specific protein 1 (FSP-1), and the components of the transforming growth factor (TGF)-β pathway were detected by real-time polymerase chain reaction and western blotting. Compared with the control group, E-cadherin in the acetaldehyde group was downregulated, whereas FN, FSP-1, vimentin, α-SMA, and COL1A1/COL1A2 were upregulated (P < 0.05). Compared with the acetaldehyde group, NR4A1 agonist upregulated E-cadherin and downregulated FN, FSP-1, vimentin, α-SMA, and COL1A1/COL1A2 (P < 0.05). After acetaldehyde stimulation, TGF-β, Smad2/3/4, and zinc finger E-box-binding homeobox (ZEB) were upregulated, while Smad7 mRNA levels were downregulated (all P < 0.05). Compared with acetaldehyde alone, NR4A1 agonist increased Smad7 mRNA levels and reduced TGF-β, Smad2/3/4, and ZEB mRNA levels (all P < 0.05). NR4A1 activation suppresses acetaldehyde-induced EMT, as shown by epithelial and mesenchymal marker expression. The inhibition of the TGF-β–Smad2/3/4–ZEB signaling during HSC activation might be involved.
1 Introduction
Liver fibrosis is a wound-healing response to chronic liver injury caused by viral hepatitis, alcohol, metabolic diseases, autoimmune conditions, and cholestatic liver diseases. The most common etiologies are alcoholic liver disease, non-alcoholic fatty liver disease, chronic viral hepatitis, genetic conditions (α − 1 antitrypsin deficiency, hereditary hemochromatosis, and Wilson disease), and autoimmune diseases (primary biliary cirrhosis, primary sclerosing cholangitis, and autoimmune hepatitis), and drugs. Sustained liver damage leads to fibrosis, liver failure, and even hepatocellular carcinoma [1,2]. In the United States, the prevalence of chronic liver diseases was 1.8% in 2017, with 12.8 deaths per 100,000 population [3,4].
The epithelial–mesenchymal transition (EMT) is a transition of epithelial cells to a mesenchymal state, which is a reversible process [5]. The EMT plays an essential role in tissue development, wound healing, fibrosis, and cancer progression [6,7,8]. Liver fibrosis is caused by excess extracellular matrix (ECM) production by myofibroblasts [9]. Activation of hepatic stellate cells (HSCs) is a key event in the formation of liver fibrosis since it is the major source of myofibroblasts [10]. Several studies indicated that HSCs undergo EMT during their activation [7,11,12,13] to participate in liver fibrosis [14,15,16]. The main pathways involved in the EMT in liver fibrosis are the Hedgehog signaling pathway, transforming growth factor (TGF)-β signaling pathway, Notch signaling, and extracellular signal-regulated kinase (ERK) signaling pathway [7,17]. Excessive Hedgehog activation after liver injury participates in EMT and liver fibrosis [7,17]. TGF-β signaling is involved in ECM and collagen production by HSCs [7,17]. The ERK pathway plays a crucial role in cell growth and differentiation and represses EMT [17]. The Notch pathway is involved in cell differentiation [7]. Importantly, inhibition of the EMT of HSCs can suppress the activation of the HSCs, thereby alleviating the progression of hepatic fibrosis [11,18,19]. Hence, inhibition of the EMT is a promising strategy for reversing fibrosis.
Nuclear receptor 4a1 (NR4A1, also known as Nur77, TR3, or NGFIB) is a member of the NR4A family of nuclear orphan receptors. NR4A1 plays diverse and important regulatory roles in glucose and lipid metabolism and inflammatory responses [20,21]. NR4A1 is involved in the EMT in tumor metastasis and migration [22,23,24]. The loss of NR4A1 inhibits TGF-β-induced EMT and metastasis [22]. Furthermore, Palumbo-Zerr et al. [25] demonstrated that NR4A1 inhibits TGF-β signaling and can suppress experimental lung and liver fibrosis.
Additional recent studies have also demonstrated that NR4A1 inhibits TGF-β signaling [26,27,28]. Therefore, NR4A1 might represent a promising antifibrotic target, but since the EMT mechanisms associated with liver fibrosis and those associated with cancer might be different, it remains unclear whether NR4A1 inhibits HSC activation and liver fibrosis by modulating the EMT. This study aimed to examine whether NR4A1 is involved in inhibiting HSC activation and liver fibrosis through the EMT.
2 Materials and methods
2.1 Cells
The HSC-T6 cells were purchased from Shanghai Tongpai Technology Co., Ltd. (Shanghai, China). After synchronization, the HSC-T6 cells were divided into three groups: the control group (HSC-T6 cells plus an equal volume of medium), acetaldehyde (MACKLIN, Shanghai, China; purity: ≥99%), the treatment group (HSC-T6 cells plus acetaldehyde to a final concentration of 200 μM), and the NR4A1 activation group (HSC-T6 cells plus acetaldehyde to a final concentration of 200 μM and Cytosporone B [Csn-B; Santa Cruz Biotechnology, Inc., Dallas, TX, USA; purity: ≥98%] to a final concentration of 1 μM).
2.2 Quantitative real-time PCR
Total RNA was extracted from the cells using TRIzol (MiniBEST Universal RNA Extraction Kit; Takara Bio, Otsu, Japan). Gene expression was measured by the quantitative real-time polymerase chain reaction (qRT-PCR) using the SYBR Green Real-time PCR Master Mix (Takara, Otsu, Japan) performed under standard conditions with an ABI 7900 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). All primers were from Takara. The primer sequences are listed in Table 1.
Primer sequences for real-time PCR
Gene | Primer sequences (5′–3″) | Product size (bp) | Designed T m (°C) |
---|---|---|---|
FSP-1 | Forward: ATGTAATAGTGTCCACCTTCC | 181 | 54.71 |
Reverse: ACTTCATTGTCCCTGTTGCT | 57.34 | ||
a-SMA | Forward: GGAGAAGCCCAGCCAGTCGC | 115 | 65.58 |
Reverse: CCCGCCTTACAGAGCCCGGA | 66.26 | ||
E-cadherin | Forward: TGTTGATAGCGTGCCCTTTG | 100 | 58.84 |
Reverse: GTTCCGATTGCTTGCCTTTT | 57.56 | ||
FN | Forward: GGATCCCCTCCCAGAGAAGT | 188 | 60.03 |
Reverse: GGGTGTGGAAGGGTAACCAG | 59.96 | ||
COL1A2 | Forward: AGGGTGTTCAAGGTGGCAAA | 166 | 60.03 |
Reverse: CCACGTTCTCCTCTTGGACC | 60.04 | ||
COL1A1 | Forward: AAAACCACCAAGACCTCCCG | 141 | 60.18 |
Reverse: GGTGGGAGGGAACCAGATTG | 60.03 | ||
Vimentin | Forward: ACCGCTTCGCCAACTACATC | 138 | 60.74 |
Reverse: GCAACTCCCTCATCTCCTCCT | 60.97 | ||
GADPH | Forward: TCTCTGCTCCTCCCTGTTCT | 95 | 59.59 |
Reverse: ATCCGTTCACACCGACCTTC | 60.04 | ||
Smad2 | Forward: GCCGCCCGAAGGGTAGAT | 164 | 61.55 |
Reverse: TTCTGTTCTCCACCACCTGC | 59.89 | ||
Smad3 | Forward: ATACGGATGTTCAAGTGTTCG | 242 | 56.38 |
Reverse: ACTGGGTCCTCTTTGGTTTT | 56.85 | ||
Smad4 | Forward: ATCCACCAAGTAATCGCGCA | 252 | 60.11 |
Reverse: AGGTGGTAGTGCTGTTATGGTG | 60.03 | ||
Smad7 | Forward: GTGGCATACTGGGAGGAGAA | 309 | 58.80 |
Reverse: GATGGAGAAACCAGGGAACA | 57.12 | ||
ZEB | Forward: CCAAAGCAACAGGGAGAGTTAC | 397 | 59.19 |
Reverse: CTTGTCTTTCATCCTGGTTTCC | 57.23 | ||
TGF-β | Forward: GAGGCGGTGCTCGCTTTGTA | 211 | 60.00 |
Reverse: GCACTGCTTCCCGAATGTCTG | 57.14 |
2.2.1 Genomic DNA removal from total RNA
The genomic DNA was removed using the following components: 5× gDNA Eraser buffer 1 (2 μL), gDNA Eraser (1 μL), and total RNA (2 μL). The reaction conditions were as follows: 42°C, 2 min; 4°C, 5 min.
2.2.2 Calculation of the gene expression
First, we calculated the average Ct value of the sample, and then, the ∆Ct of the target gene in the sample. The relative value of the target gene in the sample to the internal reference gene was calculated. Afterward, the ∆Ct of a certain gene was calculated relative to the reference sample group and multiple relationships.
2.2.3 Reference gene selection
GAPDH has been used as a stable reference gene selected as a housekeeping conserved gene according to previous studies [29,30,31,32,33,34].
2.3 Western blot
Protein lysate was obtained from the cultured cells using the RIPA lysis buffer (Solarbio Corporation, Beijing, China). The protein concentration was measured with a bicinchoninic acid assay. Proteins were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes. The membrane was first incubated with rabbit anti-rat primary antibodies, such as E-cadherin (1:2,000; no. 20874-1-AP), fibronectin (FN; 1:3,000; no. 15613-1-AP), vimentin (1:2,000; no. 10366-1-AP), Smad2 (1:2,000; no. 12570-1-AP), Smad4 (1:2,000; no. 51144-1-AP), zinc-finger-enhancer-binding protein 1 (ZEB; 1:2,000; no. 21544-1-AP) (all from Proteintech Group Inc., Chicago, IL, USA), Smad3 (1:2,000, no. AF6362; Affinity BIO, Scoresby, Australia), Smad7 (1:2,000; no. AF5147; Affinity BIO), and β-actin (1:5,000; no. Ab8226; Abcam, Cambridge, UK), and then incubated with goat anti-rabbit horseradish peroxidase-conjugated-labeled secondary antibodies (1:5,000, # A0208, Beyotime Institute of Biotechnology, Haimen, China) for 1 h at room temperature. The blots were detected using enhanced chemiluminescence.
2.4 Statistical analysis
The data are presented as mean ± standard deviation and were analyzed using a one-way analysis of variance with Fisher’s least significant difference post hoc test. P-values <0.05 were considered statistically significant (*P < 0.05 and **P < 0.01).
3 Results
3.1 NR4A1 regulates the expression of EMT-related genes to prevent EMT in HSC-T6 cells
To explore the regulatory effects of NR4A1 on the EMT of HSC-T6 cells, we first used acetaldehyde to stimulate HSC-T6 cells and measured the changes in the expression of EMT-related genes. Compared with the control group, the mRNA levels of E-cadherin in the acetaldehyde group were significantly downregulated, whereas those of FN, fibroblast-specific protein 1 (FSP-1), and vimentin were significantly upregulated. In addition, the mRNA levels of HSC activation markers, including smooth muscle alpha-actin (α-SMA) and COL1A1/COL1A2, were significantly upregulated in the acetaldehyde group compared with the control group. When the NR4A1 agonist (Csn-B) was used with acetaldehyde, compared with the acetaldehyde group, the mRNA levels of E-cadherin in the NR4A1 activation group were significantly upregulated, while those of FN, FSP-1, vimentin, α-SMA, and collagen genes (COL1A1/COL1A2) were significantly downregulated (Figure 1). Similar changes were observed at the protein level (Figure 2). These results indicated that the acetaldehyde model induces EMT in HSC-T6 cells and that NR4A1 is involved in regulating the expression of EMT-related genes, probably preventing EMT in the cells.

Effects of NR4A1 on EMT-related genes in HSC-T6 cells. The mRNA levels of E-cadherin in the acetaldehyde group were significantly downregulated, whereas FN, FSP-1, vimentin, α-SMA, and COL1A1/COL1A2 were significantly upregulated. The mRNA levels of E-cadherin in the NR4A1 activation group were significantly upregulated, while FN, FSP-1, vimentin, α-SMA, and COL1A1/COL1A2 were significantly downregulated. The mRNAs were analyzed by qRT-PCR analysis. *P < 0.05, **P < 0.01 vs control, # P < 0.05, ## P < 0.01 vs acetaldehyde. n = 3/group.

Effects of NR4A1 on EMT-related proteins in HSC-T6 cells. Protein levels of E-cadherin (epithelial marker) in the acetaldehyde group were downregulated, while those of FN and vimentin (mesenchymal markers) were upregulated. The protein levels of E-cadherin were upregulated in the NR4A1 activation group, while those of FN and vimentin were downregulated. The proteins were analyzed by western blotting. β-Actin was used as an internal control. **P < 0.01 vs control, # P < 0.05, ## P < 0.01 vs acetaldehyde. n = 3/group.
3.2 NR4A1 possibly inhibits EMT through the TGF-β–Smad–ZEB signaling pathway
The TGF-β–Smad–ZEB signaling pathway is involved in the EMT [6]. Therefore, we explored whether NR4A1 activation inhibits EMT by regulating the TGF-β–Smad–ZEB signaling pathway. After acetaldehyde was used to stimulate HSC-T6 cells, TGF-β, Smad2/3/4, and ZEB mRNA levels were significantly upregulated, while Smad7 mRNA levels were significantly downregulated. Compared to these levels following acetaldehyde alone, acetaldehyde combined with an NR4A1 agonist (Csn-B) resulted in increased Smad7 mRNA levels and reduced TGF-β, Smad2/3/4, and ZEB mRNA levels (Figure 3). Similar changes were also observed at the protein level (Figure 4). Collectively, these results suggest that during acetaldehyde-induced HSC activation and EMT, NR4A1 activation suppresses the EMT, at least in part, by inhibiting the TGF-β–Smad–ZEB signaling pathway.

Effects of NR4A1 on the protein levels of Smad2/3/4, Smad 7, and ZEB. Protein levels of Smad2/3/4 and ZEB in the acetaldehyde group were upregulated, while that of Smad 7 was downregulated. The expression of these proteins was reversed in the NR4A1 activation group. The proteins were analyzed by western blotting. β-Actin was used as an internal control. *P < 0.05, **P < 0.01 vs control, # P < 0.05, ## P < 0.01 vs acetaldehyde. n = 3/group.

mRNA levels of the components of the TGF-β–Smad–ZEB signal pathway in HSC-T6 cells. The mRNA levels of TGF-β, Smad2/3/4, and ZEB were significantly upregulated, while Smad7 mRNA levels were significantly downregulated. The mRNA levels of Smad7 in the NR4A1 activation group were significantly upregulated, while those of TGF-β, Smad2/3/4, and ZEB were significantly downregulated. *P < 0.05, **P < 0.01 vs control, # P < 0.05, ## P < 0.01 vs acetaldehyde. n = 3/group.
4 Discussion
Activation of HSCs is a key event in liver fibrosis [10]. HSCs undergo EMT during activation [7,11,12,13]. NR4A1 inhibits TGF-β signaling, which can suppress experimental lung and liver fibrosis [25], but whether NR4A1 inhibits HSC activation and liver fibrosis through the EMT is unknown. Therefore, this study aimed to examine whether NR4A1 is involved in inhibiting HSC activation and liver fibrosis through the EMT. The results suggest that NR4A1 activation suppresses acetaldehyde-induced EMT in HSCs, as shown by increased epithelial and decreased mesenchymal marker expression. The inhibition of the TGF-β–Smad2/3/4–ZEB signaling during HSC activation might be involved.
Liver fibrosis is a wound-healing response to various liver damage forms, such as hepatitis, alcohol, drugs, metabolic diseases, biliary injury, and toxins. Importantly, HSC activation is a key event in liver fibrosis [10], and wounding and repair are dynamic processes that include matrix synthesis, deposition, and degradation [35]. HSC activation undergoes EMT-like changes and participates in fibrogenesis [11,12]. Consistent with these previous studies, the present study indicated that the acetaldehyde-induced activation of HSCs upregulated the expression levels of FN, FSP-1, vimentin, and α-SMA (all myofibroblastic markers) while downregulating those of E-cadherin (an epithelial marker). Hence, these findings confirm that HSC activation involves the EMT.
Several previous studies have shown that NR4A1 can promote tumor cells’ EMT [22,23,24]. Still, it remains unclear whether the role of NR4A1 in EMT in cancer is the same as in EMT in liver fibrosis and HSC activation. Csn-B is an NR4A1 agonist that enhances the transcriptional activity of NR4A1. The present study showed that Csn-B upregulated the expression levels of epithelial markers and decreased the expression levels of mesenchymal markers in acetaldehyde-induced EMT in HSCs, compared to these levels in the presence of acetaldehyde alone. These findings suggest that NR4A1 activation suppressed the EMT during acetaldehyde-induced activation of HSCs. It is contrary to the findings in tumor cells, which is not surprising since the pathogeneses and cellular characteristics of tumors and fibrosis exhibit different characteristics. In the present study, the mechanism of NR4A1-mediated inhibition of the EMT of HSCs was explored. Palumbo-Zerr et al. [25] found that NR4A1 is an endogenous inhibitor of TGF-β signaling and inhibits skin, lung, liver, and kidney fibrosis. TGF-β signaling has also been identified as one of the predominant inducers of the EMT [36,37], and the inhibition of TβRI activity can block TGFβ‑induced EMT. TGF-β binds to TβR receptors to form a complex, activating Smad2/Smad3 to interact with Smad4 to form trimeric Smad complexes. The TGFβ/Smad signaling pathway activates the expression of EMT transcription factors and initiates the EMT [6,38]. Smad complexes interact with ZEB1 and ZEB2 to mediate TGFβ‑regulated gene expression. ZEB is one of the key transcription factors of the EMT, and its functions are finely regulated at the transcriptional, translational, and post-translational levels. ZEB expression is activated early during the EMT and plays a central role in developing both fibrosis and cancer. The TGF–Smad–ZEB pathway is involved in the EMT [6]. In the present study, we found that acetaldehyde-mediated stimulation of HSCs significantly upregulated TGF-β, Smad2/3/4, and ZEB levels and significantly downregulated Smad7 levels. Furthermore, NR4A1 activation in the presence of acetaldehyde resulted in higher Smad7 levels and lower TGF-β, Smad 2/3/4, and ZEB expression levels than acetaldehyde treatment alone. Previous studies confirmed that Smad7 inhibits TGF-β signaling [39]. The present study illustrates that NR4A1 can suppress EMT by inhibiting TGF-β–Smad2/3/4–ZEB signaling. NR4A1 might negatively regulate TGF-β signaling, at least in part, by promoting SMAD7 expression.
NR4A1 activates TGF signaling and promotes EMT in tumor cells [22,23], whereas the present study in HSCs differs from those in tumor cells. Interestingly, NR4A1 exhibits both tumor-suppressive and pro-oncogenic effects in cancer development [40,41,42]. NR4A1 translocation from the nucleus to the cytoplasm in colon cancer cells may initiate apoptotic cascades [43]. In contrast, NR4A1 exhibits anti-apoptotic effects when it is not exported from the nucleus [41,44]. TGF-mediated induction of the EMT is dependent on the nuclear export of NRA41 in breast cancer cells, and NR4A1 antagonists inhibit the nuclear export of NR4A1 and thereby block the TGF-induced EMT [23]. NR4A1 phosphorylation decreases the transcriptional activity of NR4A1, and pNR4A1 is strongly associated with hepatic/lung fibrosis and is mainly located in the cytoplasm, whereas pan-NR4A1 localizes in both nuclear and cytoplasmic compartments [25]. Collectively, these studies suggest that the effects of NR4A1 depend on its subcellular localization and the cell type in which it is signaling.
This study has limitations. The subcellular localization and expression of NRA4A1 were not examined, which could be an added benefit for this study. Thus, this should be tested in future experiments. In addition, the pathways involved in EMT and fibrosis were examined superficially. Only an agonist of NRA4A1 was used, and future studies should also use an antagonist. In addition, agonists/antagonists and silencing/overexpression of TGF-β and other proteins involved in that pathway should be used to determine the contribution of the TGF-β pathway in the EMT in liver fibrosis. Nonetheless, this study only used GAPDH as a reference gene due to the fact that several studies used GAPDH as an internal reference [29–34]. However, it is recommended to use at least two reference genes to obtain more reliable results, and therefore, other reference genes will be considered for future studies.
In summary, this study indicates that NR4A1 suppresses the EMT during acetaldehyde-induced HSC activation. NR4A1-mediated inhibition of the EMT of HSCs is involved in the suppression of TGF-β–SMAD2/3/4–ZEB signaling and increased SMAD7 expression, but confirmation is needed. Hence, the findings suggest that NR4A1 plays an important role during HSC activation and that NR4A1 might be a promising therapeutic target for treating liver fibrosis.
-
Funding information: This work was supported by a grant from the General Project of Hangzhou Health Science and Technology Program (No. 2015A31).
-
Conflict of interest: The authors state no conflict of interest.
-
Data availability statement: The datasets generated during and/or analyzed during this study are available from the corresponding author on reasonable request.
References
[1] Friedman SL. Mechanisms of hepatic fibrogenesis. Gastroenterology. 2008;134(6):1655–69.10.1007/978-94-007-1042-9_4Suche in Google Scholar
[2] Tacke F, Trautwein C. Mechanisms of liver fibrosis resolution. J Hepatol. 2015;63(4):1038–9.10.1016/j.jhep.2015.03.039Suche in Google Scholar PubMed
[3] Kochanek KD, Murphy SL, Xu J, Arias E. Deaths: final data for 2017. Natl Vital Stat Rep. 2019;68(9):1–77.Suche in Google Scholar
[4] Murphy SL, Xu J, Kochanek KD, Arias E. Mortality in the United States, 2017. NCHS. Data Brief. 2018;328:1–8.Suche in Google Scholar
[5] Dewidar B, Meyer C, Dooley S, Meindl B, Nadja. TGF-β in hepatic stellate cell activation and liver fibrogenesis-updated 2019. Cells. 2019;8:11.10.3390/cells8111419Suche in Google Scholar PubMed PubMed Central
[6] Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol. 2014;15(3):178–96.10.1038/nrm3758Suche in Google Scholar PubMed PubMed Central
[7] Chen Y, Fan Y, Guo D-Y, Xu B, Shi X-Y, Li J-T, et al. Study on the relationship between hepatic fibrosis and epithelial-mesenchymal transition in intrahepatic cells. Biomed Pharmacother. 2020;129:110413.10.1016/j.biopha.2020.110413Suche in Google Scholar PubMed
[8] Thiery JP, Acloque H, Huang RYJ, Nieto MA. Epithelial-mesenchymal transitions in development and disease. Cell. 2009;139(5):871–90.10.1016/j.cell.2009.11.007Suche in Google Scholar PubMed
[9] Pellicoro A, Ramachandran P, Iredale JP, Fallowfield JA. Liver fibrosis and repair: immune regulation of wound healing in a solid organ. Nat Rev Immunol. 2014;14(3):181–94.10.1038/nri3623Suche in Google Scholar PubMed
[10] Yin C, Evason KJ, Asahina K, Stainier DY. Hepatic stellate cells in liver development, regeneration, and cancer. J Clin Invest. 2013;123(5):1902–10.10.1172/JCI66369Suche in Google Scholar PubMed PubMed Central
[11] Zheng J, Wang W, Yu F, Dong P, Chen B, Zhou M-T. MicroRNA-30a suppresses the activation of hepatic stellate cells by inhibiting epithelial-to-mesenchymal transition. Cell Physiol Biochem. 2018;46(1):82–92.10.1159/000488411Suche in Google Scholar PubMed
[12] Yue HY, Yin C, Hou JL, Zeng X, Chen YX, Zhong W, et al. Hepatocyte nuclear factor 4alpha attenuates hepatic fibrosis in rats. Gut. 2010;59(2):236–46.10.1136/gut.2008.174904Suche in Google Scholar PubMed
[13] Lim YS, Kim KA, Jung JO, Yoon JH, Suh KS, Kim CY, et al. Modulation of cytokeratin expression during in vitro cultivation of human hepatic stellate cells: evidence of transdifferentiation from epithelial to mesenchymal phenotype. Histochem Cell Biol. 2002;118(2):127–36.10.1007/s00418-002-0436-9Suche in Google Scholar PubMed
[14] Nitta T, Kim JS, Mohuczy D, Behrns KE. Murine cirrhosis induces hepatocyte epithelial mesenchymal transition and alterations in survival signaling pathways. Hepatology. 2008;48(3):909–19.10.1002/hep.22397Suche in Google Scholar PubMed PubMed Central
[15] Dooley S, Hamzavi J, Ciuclan L, Godoy P, Ilkavets I, Ehnert S, et al. Hepatocyte-specific Smad7 expression attenuates TGF-beta-mediated fibrogenesis and protects against liver damage. Gastroenterology. 2008;135(2):642–59.10.1053/j.gastro.2008.04.038Suche in Google Scholar PubMed
[16] Matsuzaki K, Murata M, Yoshida K, Sekimoto G, Uemura Y, Sakaida N, et al. Chronic inflammation associated with hepatitis C virus infection perturbs hepatic transforming growth factor beta signaling, promoting cirrhosis and hepatocellular carcinoma. Hepatology. 2007;46(1):48–57.10.1002/hep.21672Suche in Google Scholar PubMed
[17] Yu K, Li Q, Shi G, Li N. Involvement of epithelial-mesenchymal transition in liver fibrosis. Saudi J Gastroenterol. 2018;24(1):5–11.10.4103/sjg.SJG_297_17Suche in Google Scholar PubMed PubMed Central
[18] Dai W, Zhao J, Tang N, Zeng X, Wu K, Ye C, et al. MicroRNA-155 attenuates activation of hepatic stellate cell by simultaneously preventing EMT process and ERK1 signalling pathway. Liver Int. 2015;35(4):1234–43.10.1111/liv.12660Suche in Google Scholar PubMed
[19] Yu F, Geng W, Dong P, Huang Z, Zheng J. LncRNA-MEG3 inhibits activation of hepatic stellate cells through SMO protein and miR-212. Cell Death Dis. 2018;9(10):1014.10.1038/s41419-018-1068-xSuche in Google Scholar PubMed PubMed Central
[20] Fassett MS, Jiang W, D’Alise AM, Mathis D, Benoist C. Nuclear receptor Nr4a1 modulates both regulatory T-cell (Treg) differentiation and clonal deletion. Proc Natl Acad Sci U S A. 2012;109(10):3891–6.10.1073/pnas.1200090109Suche in Google Scholar PubMed PubMed Central
[21] Hanna RN, Carlin LM, Hubbeling HG, Nackiewicz D, Green AM, Punt JA, et al. The transcription factor NR4A1 (Nur77) controls bone marrow differentiation and the survival of Ly6C- monocytes. Nat Immunol. 2011;12(8):778–85.10.1038/ni.2063Suche in Google Scholar PubMed PubMed Central
[22] Zhou F, Drabsch Y, Dekker TJA, de Vinuesa AG, Li Y, Hawinkels LJAC, et al. Nuclear receptor NR4A1 promotes breast cancer invasion and metastasis by activating TGF-β signalling. Nature Commun. 2014;5:3388.10.1038/ncomms4388Suche in Google Scholar PubMed
[23] Hedrick E, Safe S. Transforming growth factor β/NR4A1-inducible breast cancer cell migration and epithelial-to-mesenchymal transition Is p38α (mitogen-activated protein kinase 14) dependent. Mol Cell Biol. 2017;37:18.10.1128/MCB.00306-17Suche in Google Scholar PubMed PubMed Central
[24] To SKY, Zeng WJ, Zeng JZ, Wong AST. Hypoxia triggers a Nur77-β-catenin feed-forward loop to promote the invasive growth of colon cancer cells. Br J Cancer. 2014;110(4):935–45.10.1038/bjc.2013.816Suche in Google Scholar PubMed PubMed Central
[25] Palumbo-Zerr K, Zerr P, Distler A, Fliehr J, Mancuso R, Huang J, et al. Orphan nuclear receptor NR4A1 regulates transforming growth factor-beta signaling and fibrosis. Nat Med. 2015;21(2):150–8.10.1038/nm.3777Suche in Google Scholar PubMed
[26] Wu J, Sun H, Yang X, Sun X. Nur77 suppression facilitates androgen deprivation-induced cell invasion of prostate cancer cells mediated by TGF-β signaling. Clin Transl Oncol. 2018;20(10):1302–13.10.1007/s12094-018-1862-zSuche in Google Scholar PubMed
[27] Hiwatashi N, Mukudai S, Bing R, Branski RC. The effects of cytosporone-B, a novel antifibrotic agent, on vocal fold fibroblasts. Laryngoscope. 2018;128(12):E425–E8.10.1002/lary.27361Suche in Google Scholar PubMed PubMed Central
[28] Hiwatashi N, Bing R, Kraja I, Branski RC. NR4A1 is an endogenous inhibitor of vocal fold fibrosis. Laryngoscope. 2017;127(9):E317–23.10.1002/lary.26678Suche in Google Scholar PubMed PubMed Central
[29] Li Z, Li X, Zhang Q, Yuan L, Zhou X. Reference gene selection for transcriptional profiling in Cryptocercus punctulatus, an evolutionary link between Isoptera and Blattodea. Sci Rep. 2020;10(1):22169.10.1038/s41598-020-79030-6Suche in Google Scholar PubMed PubMed Central
[30] Mehta A, Dobersch S, Dammann RH, Bellusci S, Ilinskaya ON, Braun T, et al. Validation of Tuba1a as appropriate internal control for normalization of gene expression analysis during mouse lung development. Int J Mol Sci. 2015;16(3):4492–511.10.3390/ijms16034492Suche in Google Scholar PubMed PubMed Central
[31] Mu J, Chen L, Gu Y, Duan L, Han S, Li Y, et al. Genome-wide identification of internal reference genes for normalization of gene expression values during endosperm development in wheat. J Appl Genet. 2019;60(3–4):233–41.10.1007/s13353-019-00503-0Suche in Google Scholar PubMed
[32] Adeola F. Normalization of gene expression by quantitative RT-PCR in human cell line: comparison of 12 endogenous reference genes. Ethiop J Health Sci. 2018;28(6):741–8.10.4314/ejhs.v28i6.9Suche in Google Scholar PubMed PubMed Central
[33] Feria-Romero IA, Bribiesca-Cruz I, Coyoy-Salgado A, Segura-Uribe JJ, Bautista-Poblet G, Granados-Cervantes A, et al. Validation of housekeeping genes as an internal control for gene expression studies in the brain of ovariectomized rats treated with tibolone. Gene. 2021;769:145255.10.1016/j.gene.2020.145255Suche in Google Scholar
[34] Nazari F, Parham A, Maleki AF. GAPDH, β-actin and β2-microglobulin, as three common reference genes, are not reliable for gene expression studies in equine adipose- and marrow-derived mesenchymal stem cells. J Anim Sci Technol. 2015;57:18.10.1186/s40781-015-0050-8Suche in Google Scholar
[35] Rockey DC. Antifibrotic therapy in chronic liver disease. Clin Gastroenterol Hepatol. 2005;3:2.10.1016/S1542-3565(04)00445-8Suche in Google Scholar
[36] Zhang J, Tian X-J, Zhang H, Teng Y, Li R, Bai F, et al. TGF-β-induced epithelial-to-mesenchymal transition proceeds through stepwise activation of multiple feedback loops. Sci Signal. 2014;7(345):ra91.10.1126/scisignal.2005304Suche in Google Scholar PubMed
[37] Giannelli G, Koudelkova P, Dituri F, Mikulits W. Role of epithelial to mesenchymal transition in hepatocellular carcinoma. J Hepatol. 2016;65(4):798–808.10.1016/j.jhep.2016.05.007Suche in Google Scholar PubMed
[38] Massagué J. TGFβ signalling in context. Nat Rev Mol Cell Biol. 2012;13(10):616–30.10.1038/nrm3434Suche in Google Scholar PubMed PubMed Central
[39] Ganai AA, Husain M. Genistein attenuates D-GalN induced liver fibrosis/chronic liver damage in rats by blocking the TGF-β/Smad signaling pathways. Chem Biol Interact. 2017;261:80–5.10.1016/j.cbi.2016.11.022Suche in Google Scholar PubMed
[40] Mullican SE, Zhang S, Konopleva M, Ruvolo V, Andreeff M, Milbrandt J, et al. Abrogation of nuclear receptors Nr4a3 and Nr4a1 leads to development of acute myeloid leukemia. Nat Med. 2007;13(6):730–5.10.1038/nm1579Suche in Google Scholar PubMed
[41] Lee S-O, Abdelrahim M, Yoon K, Chintharlapalli S, Papineni S, Kim K, et al. Inactivation of the orphan nuclear receptor TR3/Nur77 inhibits pancreatic cancer cell and tumor growth. Cancer Res. 2010;70(17):6824–36.10.1158/0008-5472.CAN-10-1992Suche in Google Scholar PubMed PubMed Central
[42] Ramirez-Herrick AM, Mullican SE, Sheehan AM, Conneely OM. Reduced NR4A gene dosage leads to mixed myelodysplastic/myeloproliferative neoplasms in mice. Blood. 2011;117(9):2681–90.10.1182/blood-2010-02-267906Suche in Google Scholar PubMed PubMed Central
[43] Wilson AJ, Arango D, Mariadason JM, Heerdt BG, Augenlicht LH. TR3/Nur77 in colon cancer cell apoptosis. Cancer Res. 2003;63(17):5401–7.Suche in Google Scholar
[44] Kolluri SK, Bruey-Sedano N, Cao X, Lin B, Lin F, Han Y-H, et al. Mitogenic effect of orphan receptor TR3 and its regulation by MEKK1 in lung cancer cells. Mol Cell Biol. 2003;23(23):8651–67.10.1128/MCB.23.23.8651-8667.2003Suche in Google Scholar PubMed PubMed Central
© 2022 Qian Huang et al., published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Artikel in diesem Heft
- Biomedical Sciences
- Effects of direct oral anticoagulants dabigatran and rivaroxaban on the blood coagulation function in rabbits
- The mother of all battles: Viruses vs humans. Can humans avoid extinction in 50–100 years?
- Knockdown of G1P3 inhibits cell proliferation and enhances the cytotoxicity of dexamethasone in acute lymphoblastic leukemia
- LINC00665 regulates hepatocellular carcinoma by modulating mRNA via the m6A enzyme
- Association study of CLDN14 variations in patients with kidney stones
- Concanavalin A-induced autoimmune hepatitis model in mice: Mechanisms and future outlook
- Regulation of miR-30b in cancer development, apoptosis, and drug resistance
- Informatic analysis of the pulmonary microecology in non-cystic fibrosis bronchiectasis at three different stages
- Swimming attenuates tumor growth in CT-26 tumor-bearing mice and suppresses angiogenesis by mediating the HIF-1α/VEGFA pathway
- Characterization of intestinal microbiota and serum metabolites in patients with mild hepatic encephalopathy
- Functional conservation and divergence in plant-specific GRF gene family revealed by sequences and expression analysis
- Application of the FLP/LoxP-FRT recombination system to switch the eGFP expression in a model prokaryote
- Biomedical evaluation of antioxidant properties of lamb meat enriched with iodine and selenium
- Intravenous infusion of the exosomes derived from human umbilical cord mesenchymal stem cells enhance neurological recovery after traumatic brain injury via suppressing the NF-κB pathway
- Effect of dietary pattern on pregnant women with gestational diabetes mellitus and its clinical significance
- Potential regulatory mechanism of TNF-α/TNFR1/ANXA1 in glioma cells and its role in glioma cell proliferation
- Effect of the genetic mutant G71R in uridine diphosphate-glucuronosyltransferase 1A1 on the conjugation of bilirubin
- Quercetin inhibits cytotoxicity of PC12 cells induced by amyloid-beta 25–35 via stimulating estrogen receptor α, activating ERK1/2, and inhibiting apoptosis
- Nutrition intervention in the management of novel coronavirus pneumonia patients
- circ-CFH promotes the development of HCC by regulating cell proliferation, apoptosis, migration, invasion, and glycolysis through the miR-377-3p/RNF38 axis
- Bmi-1 directly upregulates glucose transporter 1 in human gastric adenocarcinoma
- Lacunar infarction aggravates the cognitive deficit in the elderly with white matter lesion
- Hydroxysafflor yellow A improved retinopathy via Nrf2/HO-1 pathway in rats
- Comparison of axon extension: PTFE versus PLA formed by a 3D printer
- Elevated IL-35 level and iTr35 subset increase the bacterial burden and lung lesions in Mycobacterium tuberculosis-infected mice
- A case report of CAT gene and HNF1β gene variations in a patient with early-onset diabetes
- Study on the mechanism of inhibiting patulin production by fengycin
- SOX4 promotes high-glucose-induced inflammation and angiogenesis of retinal endothelial cells by activating NF-κB signaling pathway
- Relationship between blood clots and COVID-19 vaccines: A literature review
- Analysis of genetic characteristics of 436 children with dysplasia and detailed analysis of rare karyotype
- Bioinformatics network analyses of growth differentiation factor 11
- NR4A1 inhibits the epithelial–mesenchymal transition of hepatic stellate cells: Involvement of TGF-β–Smad2/3/4–ZEB signaling
- Expression of Zeb1 in the differentiation of mouse embryonic stem cell
- Study on the genetic damage caused by cadmium sulfide quantum dots in human lymphocytes
- Association between single-nucleotide polymorphisms of NKX2.5 and congenital heart disease in Chinese population: A meta-analysis
- Assessment of the anesthetic effect of modified pentothal sodium solution on Sprague-Dawley rats
- Genetic susceptibility to high myopia in Han Chinese population
- Potential biomarkers and molecular mechanisms in preeclampsia progression
- Silencing circular RNA-friend leukemia virus integration 1 restrained malignancy of CC cells and oxaliplatin resistance by disturbing dyskeratosis congenita 1
- Endostar plus pembrolizumab combined with a platinum-based dual chemotherapy regime for advanced pulmonary large-cell neuroendocrine carcinoma as a first-line treatment: A case report
- The significance of PAK4 in signaling and clinicopathology: A review
- Sorafenib inhibits ovarian cancer cell proliferation and mobility and induces radiosensitivity by targeting the tumor cell epithelial–mesenchymal transition
- Characterization of rabbit polyclonal antibody against camel recombinant nanobodies
- Active legumain promotes invasion and migration of neuroblastoma by regulating epithelial-mesenchymal transition
- Effect of cell receptors in the pathogenesis of osteoarthritis: Current insights
- MT-12 inhibits the proliferation of bladder cells in vitro and in vivo by enhancing autophagy through mitochondrial dysfunction
- Study of hsa_circRNA_000121 and hsa_circRNA_004183 in papillary thyroid microcarcinoma
- BuyangHuanwu Decoction attenuates cerebral vasospasm caused by subarachnoid hemorrhage in rats via PI3K/AKT/eNOS axis
- Effects of the interaction of Notch and TLR4 pathways on inflammation and heart function in septic heart
- Monosodium iodoacetate-induced subchondral bone microstructure and inflammatory changes in an animal model of osteoarthritis
- A rare presentation of type II Abernethy malformation and nephrotic syndrome: Case report and review
- Rapid death due to pulmonary epithelioid haemangioendothelioma in several weeks: A case report
- Hepatoprotective role of peroxisome proliferator-activated receptor-α in non-cancerous hepatic tissues following transcatheter arterial embolization
- Correlation between peripheral blood lymphocyte subpopulations and primary systemic lupus erythematosus
- A novel SLC8A1-ALK fusion in lung adenocarcinoma confers sensitivity to alectinib: A case report
- β-Hydroxybutyrate upregulates FGF21 expression through inhibition of histone deacetylases in hepatocytes
- Identification of metabolic genes for the prediction of prognosis and tumor microenvironment infiltration in early-stage non-small cell lung cancer
- BTBD10 inhibits glioma tumorigenesis by downregulating cyclin D1 and p-Akt
- Mucormycosis co-infection in COVID-19 patients: An update
- Metagenomic next-generation sequencing in diagnosing Pneumocystis jirovecii pneumonia: A case report
- Long non-coding RNA HOXB-AS1 is a prognostic marker and promotes hepatocellular carcinoma cells’ proliferation and invasion
- Preparation and evaluation of LA-PEG-SPION, a targeted MRI contrast agent for liver cancer
- Proteomic analysis of the liver regulating lipid metabolism in Chaohu ducks using two-dimensional electrophoresis
- Nasopharyngeal tuberculosis: A case report
- Characterization and evaluation of anti-Salmonella enteritidis activity of indigenous probiotic lactobacilli in mice
- Aberrant pulmonary immune response of obese mice to periodontal infection
- Bacteriospermia – A formidable player in male subfertility
- In silico and in vivo analysis of TIPE1 expression in diffuse large B cell lymphoma
- Effects of KCa channels on biological behavior of trophoblasts
- Interleukin-17A influences the vulnerability rather than the size of established atherosclerotic plaques in apolipoprotein E-deficient mice
- Multiple organ failure and death caused by Staphylococcus aureus hip infection: A case report
- Prognostic signature related to the immune environment of oral squamous cell carcinoma
- Primary and metastatic squamous cell carcinoma of the thyroid gland: Two case reports
- Neuroprotective effects of crocin and crocin-loaded niosomes against the paraquat-induced oxidative brain damage in rats
- Role of MMP-2 and CD147 in kidney fibrosis
- Geometric basis of action potential of skeletal muscle cells and neurons
- Babesia microti-induced fulminant sepsis in an immunocompromised host: A case report and the case-specific literature review
- Role of cerebellar cortex in associative learning and memory in guinea pigs
- Application of metagenomic next-generation sequencing technique for diagnosing a specific case of necrotizing meningoencephalitis caused by human herpesvirus 2
- Case report: Quadruple primary malignant neoplasms including esophageal, ureteral, and lung in an elderly male
- Long non-coding RNA NEAT1 promotes angiogenesis in hepatoma carcinoma via the miR-125a-5p/VEGF pathway
- Osteogenic differentiation of periodontal membrane stem cells in inflammatory environments
- Knockdown of SHMT2 enhances the sensitivity of gastric cancer cells to radiotherapy through the Wnt/β-catenin pathway
- Continuous renal replacement therapy combined with double filtration plasmapheresis in the treatment of severe lupus complicated by serious bacterial infections in children: A case report
- Simultaneous triple primary malignancies, including bladder cancer, lymphoma, and lung cancer, in an elderly male: A case report
- Preclinical immunogenicity assessment of a cell-based inactivated whole-virion H5N1 influenza vaccine
- One case of iodine-125 therapy – A new minimally invasive treatment of intrahepatic cholangiocarcinoma
- S1P promotes corneal trigeminal neuron differentiation and corneal nerve repair via upregulating nerve growth factor expression in a mouse model
- Early cancer detection by a targeted methylation assay of circulating tumor DNA in plasma
- Calcifying nanoparticles initiate the calcification process of mesenchymal stem cells in vitro through the activation of the TGF-β1/Smad signaling pathway and promote the decay of echinococcosis
- Evaluation of prognostic markers in patients infected with SARS-CoV-2
- N6-Methyladenosine-related alternative splicing events play a role in bladder cancer
- Characterization of the structural, oxidative, and immunological features of testis tissue from Zucker diabetic fatty rats
- Effects of glucose and osmotic pressure on the proliferation and cell cycle of human chorionic trophoblast cells
- Investigation of genotype diversity of 7,804 norovirus sequences in humans and animals of China
- Characteristics and karyotype analysis of a patient with turner syndrome complicated with multiple-site tumors: A case report
- Aggravated renal fibrosis is positively associated with the activation of HMGB1-TLR2/4 signaling in STZ-induced diabetic mice
- Distribution characteristics of SARS-CoV-2 IgM/IgG in false-positive results detected by chemiluminescent immunoassay
- SRPX2 attenuated oxygen–glucose deprivation and reperfusion-induced injury in cardiomyocytes via alleviating endoplasmic reticulum stress-induced apoptosis through targeting PI3K/Akt/mTOR axis
- Aquaporin-8 overexpression is involved in vascular structure and function changes in placentas of gestational diabetes mellitus patients
- Relationship between CRP gene polymorphisms and ischemic stroke risk: A systematic review and meta-analysis
- Effects of growth hormone on lipid metabolism and sexual development in pubertal obese male rats
- Cloning and identification of the CTLA-4IgV gene and functional application of vaccine in Xinjiang sheep
- Antitumor activity of RUNX3: Upregulation of E-cadherin and downregulation of the epithelial–mesenchymal transition in clear-cell renal cell carcinoma
- PHF8 promotes osteogenic differentiation of BMSCs in old rat with osteoporosis by regulating Wnt/β-catenin pathway
- A review of the current state of the computer-aided diagnosis (CAD) systems for breast cancer diagnosis
- Bilateral dacryoadenitis in adult-onset Still’s disease: A case report
- A novel association between Bmi-1 protein expression and the SUVmax obtained by 18F-FDG PET/CT in patients with gastric adenocarcinoma
- The role of erythrocytes and erythroid progenitor cells in tumors
- Relationship between platelet activation markers and spontaneous abortion: A meta-analysis
- Abnormal methylation caused by folic acid deficiency in neural tube defects
- Silencing TLR4 using an ultrasound-targeted microbubble destruction-based shRNA system reduces ischemia-induced seizures in hyperglycemic rats
- Plant Sciences
- Seasonal succession of bacterial communities in cultured Caulerpa lentillifera detected by high-throughput sequencing
- Cloning and prokaryotic expression of WRKY48 from Caragana intermedia
- Novel Brassica hybrids with different resistance to Leptosphaeria maculans reveal unbalanced rDNA signal patterns
- Application of exogenous auxin and gibberellin regulates the bolting of lettuce (Lactuca sativa L.)
- Phytoremediation of pollutants from wastewater: A concise review
- Genome-wide identification and characterization of NBS-encoding genes in the sweet potato wild ancestor Ipomoea trifida (H.B.K.)
- Alleviative effects of magnetic Fe3O4 nanoparticles on the physiological toxicity of 3-nitrophenol to rice (Oryza sativa L.) seedlings
- Selection and functional identification of Dof genes expressed in response to nitrogen in Populus simonii × Populus nigra
- Study on pecan seed germination influenced by seed endocarp
- Identification of active compounds in Ophiopogonis Radix from different geographical origins by UPLC-Q/TOF-MS combined with GC-MS approaches
- The entire chloroplast genome sequence of Asparagus cochinchinensis and genetic comparison to Asparagus species
- Genome-wide identification of MAPK family genes and their response to abiotic stresses in tea plant (Camellia sinensis)
- Selection and validation of reference genes for RT-qPCR analysis of different organs at various development stages in Caragana intermedia
- Cloning and expression analysis of SERK1 gene in Diospyros lotus
- Integrated metabolomic and transcriptomic profiling revealed coping mechanisms of the edible and medicinal homologous plant Plantago asiatica L. cadmium resistance
- A missense variant in NCF1 is associated with susceptibility to unexplained recurrent spontaneous abortion
- Assessment of drought tolerance indices in faba bean genotypes under different irrigation regimes
- The entire chloroplast genome sequence of Asparagus setaceus (Kunth) Jessop: Genome structure, gene composition, and phylogenetic analysis in Asparagaceae
- Food Science
- Dietary food additive monosodium glutamate with or without high-lipid diet induces spleen anomaly: A mechanistic approach on rat model
- Binge eating disorder during COVID-19
- Potential of honey against the onset of autoimmune diabetes and its associated nephropathy, pancreatitis, and retinopathy in type 1 diabetic animal model
- FTO gene expression in diet-induced obesity is downregulated by Solanum fruit supplementation
- Physical activity enhances fecal lactobacilli in rats chronically drinking sweetened cola beverage
- Supercritical CO2 extraction, chemical composition, and antioxidant effects of Coreopsis tinctoria Nutt. oleoresin
- Functional constituents of plant-based foods boost immunity against acute and chronic disorders
- Effect of selenium and methods of protein extraction on the proteomic profile of Saccharomyces yeast
- Microbial diversity of milk ghee in southern Gansu and its effect on the formation of ghee flavor compounds
- Ecology and Environmental Sciences
- Effects of heavy metals on bacterial community surrounding Bijiashan mining area located in northwest China
- Microorganism community composition analysis coupling with 15N tracer experiments reveals the nitrification rate and N2O emissions in low pH soils in Southern China
- Genetic diversity and population structure of Cinnamomum balansae Lecomte inferred by microsatellites
- Preliminary screening of microplastic contamination in different marine fish species of Taif market, Saudi Arabia
- Plant volatile organic compounds attractive to Lygus pratensis
- Effects of organic materials on soil bacterial community structure in long-term continuous cropping of tomato in greenhouse
- Effects of soil treated fungicide fluopimomide on tomato (Solanum lycopersicum L.) disease control and plant growth
- Prevalence of Yersinia pestis among rodents captured in a semi-arid tropical ecosystem of south-western Zimbabwe
- Effects of irrigation and nitrogen fertilization on mitigating salt-induced Na+ toxicity and sustaining sea rice growth
- Bioengineering and Biotechnology
- Poly-l-lysine-caused cell adhesion induces pyroptosis in THP-1 monocytes
- Development of alkaline phosphatase-scFv and its use for one-step enzyme-linked immunosorbent assay for His-tagged protein detection
- Development and validation of a predictive model for immune-related genes in patients with tongue squamous cell carcinoma
- Agriculture
- Effects of chemical-based fertilizer replacement with biochar-based fertilizer on albic soil nutrient content and maize yield
- Genome-wide identification and expression analysis of CPP-like gene family in Triticum aestivum L. under different hormone and stress conditions
- Agronomic and economic performance of mung bean (Vigna radiata L.) varieties in response to rates of blended NPS fertilizer in Kindo Koysha district, Southern Ethiopia
- Influence of furrow irrigation regime on the yield and water consumption indicators of winter wheat based on a multi-level fuzzy comprehensive evaluation
- Discovery of exercise-related genes and pathway analysis based on comparative genomes of Mongolian originated Abaga and Wushen horse
- Lessons from integrated seasonal forecast-crop modelling in Africa: A systematic review
- Evolution trend of soil fertility in tobacco-planting area of Chenzhou, Hunan Province, China
- Animal Sciences
- Morphological and molecular characterization of Tatera indica Hardwicke 1807 (Rodentia: Muridae) from Pothwar, Pakistan
- Research on meat quality of Qianhua Mutton Merino sheep and Small-tail Han sheep
- SI: A Scientific Memoir
- Suggestions on leading an academic research laboratory group
- My scientific genealogy and the Toronto ACDC Laboratory, 1988–2022
- Erratum
- Erratum to “Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study”
- Erratum to “A two-microRNA signature predicts the progression of male thyroid cancer”
- Retraction
- Retraction of “Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis”
Artikel in diesem Heft
- Biomedical Sciences
- Effects of direct oral anticoagulants dabigatran and rivaroxaban on the blood coagulation function in rabbits
- The mother of all battles: Viruses vs humans. Can humans avoid extinction in 50–100 years?
- Knockdown of G1P3 inhibits cell proliferation and enhances the cytotoxicity of dexamethasone in acute lymphoblastic leukemia
- LINC00665 regulates hepatocellular carcinoma by modulating mRNA via the m6A enzyme
- Association study of CLDN14 variations in patients with kidney stones
- Concanavalin A-induced autoimmune hepatitis model in mice: Mechanisms and future outlook
- Regulation of miR-30b in cancer development, apoptosis, and drug resistance
- Informatic analysis of the pulmonary microecology in non-cystic fibrosis bronchiectasis at three different stages
- Swimming attenuates tumor growth in CT-26 tumor-bearing mice and suppresses angiogenesis by mediating the HIF-1α/VEGFA pathway
- Characterization of intestinal microbiota and serum metabolites in patients with mild hepatic encephalopathy
- Functional conservation and divergence in plant-specific GRF gene family revealed by sequences and expression analysis
- Application of the FLP/LoxP-FRT recombination system to switch the eGFP expression in a model prokaryote
- Biomedical evaluation of antioxidant properties of lamb meat enriched with iodine and selenium
- Intravenous infusion of the exosomes derived from human umbilical cord mesenchymal stem cells enhance neurological recovery after traumatic brain injury via suppressing the NF-κB pathway
- Effect of dietary pattern on pregnant women with gestational diabetes mellitus and its clinical significance
- Potential regulatory mechanism of TNF-α/TNFR1/ANXA1 in glioma cells and its role in glioma cell proliferation
- Effect of the genetic mutant G71R in uridine diphosphate-glucuronosyltransferase 1A1 on the conjugation of bilirubin
- Quercetin inhibits cytotoxicity of PC12 cells induced by amyloid-beta 25–35 via stimulating estrogen receptor α, activating ERK1/2, and inhibiting apoptosis
- Nutrition intervention in the management of novel coronavirus pneumonia patients
- circ-CFH promotes the development of HCC by regulating cell proliferation, apoptosis, migration, invasion, and glycolysis through the miR-377-3p/RNF38 axis
- Bmi-1 directly upregulates glucose transporter 1 in human gastric adenocarcinoma
- Lacunar infarction aggravates the cognitive deficit in the elderly with white matter lesion
- Hydroxysafflor yellow A improved retinopathy via Nrf2/HO-1 pathway in rats
- Comparison of axon extension: PTFE versus PLA formed by a 3D printer
- Elevated IL-35 level and iTr35 subset increase the bacterial burden and lung lesions in Mycobacterium tuberculosis-infected mice
- A case report of CAT gene and HNF1β gene variations in a patient with early-onset diabetes
- Study on the mechanism of inhibiting patulin production by fengycin
- SOX4 promotes high-glucose-induced inflammation and angiogenesis of retinal endothelial cells by activating NF-κB signaling pathway
- Relationship between blood clots and COVID-19 vaccines: A literature review
- Analysis of genetic characteristics of 436 children with dysplasia and detailed analysis of rare karyotype
- Bioinformatics network analyses of growth differentiation factor 11
- NR4A1 inhibits the epithelial–mesenchymal transition of hepatic stellate cells: Involvement of TGF-β–Smad2/3/4–ZEB signaling
- Expression of Zeb1 in the differentiation of mouse embryonic stem cell
- Study on the genetic damage caused by cadmium sulfide quantum dots in human lymphocytes
- Association between single-nucleotide polymorphisms of NKX2.5 and congenital heart disease in Chinese population: A meta-analysis
- Assessment of the anesthetic effect of modified pentothal sodium solution on Sprague-Dawley rats
- Genetic susceptibility to high myopia in Han Chinese population
- Potential biomarkers and molecular mechanisms in preeclampsia progression
- Silencing circular RNA-friend leukemia virus integration 1 restrained malignancy of CC cells and oxaliplatin resistance by disturbing dyskeratosis congenita 1
- Endostar plus pembrolizumab combined with a platinum-based dual chemotherapy regime for advanced pulmonary large-cell neuroendocrine carcinoma as a first-line treatment: A case report
- The significance of PAK4 in signaling and clinicopathology: A review
- Sorafenib inhibits ovarian cancer cell proliferation and mobility and induces radiosensitivity by targeting the tumor cell epithelial–mesenchymal transition
- Characterization of rabbit polyclonal antibody against camel recombinant nanobodies
- Active legumain promotes invasion and migration of neuroblastoma by regulating epithelial-mesenchymal transition
- Effect of cell receptors in the pathogenesis of osteoarthritis: Current insights
- MT-12 inhibits the proliferation of bladder cells in vitro and in vivo by enhancing autophagy through mitochondrial dysfunction
- Study of hsa_circRNA_000121 and hsa_circRNA_004183 in papillary thyroid microcarcinoma
- BuyangHuanwu Decoction attenuates cerebral vasospasm caused by subarachnoid hemorrhage in rats via PI3K/AKT/eNOS axis
- Effects of the interaction of Notch and TLR4 pathways on inflammation and heart function in septic heart
- Monosodium iodoacetate-induced subchondral bone microstructure and inflammatory changes in an animal model of osteoarthritis
- A rare presentation of type II Abernethy malformation and nephrotic syndrome: Case report and review
- Rapid death due to pulmonary epithelioid haemangioendothelioma in several weeks: A case report
- Hepatoprotective role of peroxisome proliferator-activated receptor-α in non-cancerous hepatic tissues following transcatheter arterial embolization
- Correlation between peripheral blood lymphocyte subpopulations and primary systemic lupus erythematosus
- A novel SLC8A1-ALK fusion in lung adenocarcinoma confers sensitivity to alectinib: A case report
- β-Hydroxybutyrate upregulates FGF21 expression through inhibition of histone deacetylases in hepatocytes
- Identification of metabolic genes for the prediction of prognosis and tumor microenvironment infiltration in early-stage non-small cell lung cancer
- BTBD10 inhibits glioma tumorigenesis by downregulating cyclin D1 and p-Akt
- Mucormycosis co-infection in COVID-19 patients: An update
- Metagenomic next-generation sequencing in diagnosing Pneumocystis jirovecii pneumonia: A case report
- Long non-coding RNA HOXB-AS1 is a prognostic marker and promotes hepatocellular carcinoma cells’ proliferation and invasion
- Preparation and evaluation of LA-PEG-SPION, a targeted MRI contrast agent for liver cancer
- Proteomic analysis of the liver regulating lipid metabolism in Chaohu ducks using two-dimensional electrophoresis
- Nasopharyngeal tuberculosis: A case report
- Characterization and evaluation of anti-Salmonella enteritidis activity of indigenous probiotic lactobacilli in mice
- Aberrant pulmonary immune response of obese mice to periodontal infection
- Bacteriospermia – A formidable player in male subfertility
- In silico and in vivo analysis of TIPE1 expression in diffuse large B cell lymphoma
- Effects of KCa channels on biological behavior of trophoblasts
- Interleukin-17A influences the vulnerability rather than the size of established atherosclerotic plaques in apolipoprotein E-deficient mice
- Multiple organ failure and death caused by Staphylococcus aureus hip infection: A case report
- Prognostic signature related to the immune environment of oral squamous cell carcinoma
- Primary and metastatic squamous cell carcinoma of the thyroid gland: Two case reports
- Neuroprotective effects of crocin and crocin-loaded niosomes against the paraquat-induced oxidative brain damage in rats
- Role of MMP-2 and CD147 in kidney fibrosis
- Geometric basis of action potential of skeletal muscle cells and neurons
- Babesia microti-induced fulminant sepsis in an immunocompromised host: A case report and the case-specific literature review
- Role of cerebellar cortex in associative learning and memory in guinea pigs
- Application of metagenomic next-generation sequencing technique for diagnosing a specific case of necrotizing meningoencephalitis caused by human herpesvirus 2
- Case report: Quadruple primary malignant neoplasms including esophageal, ureteral, and lung in an elderly male
- Long non-coding RNA NEAT1 promotes angiogenesis in hepatoma carcinoma via the miR-125a-5p/VEGF pathway
- Osteogenic differentiation of periodontal membrane stem cells in inflammatory environments
- Knockdown of SHMT2 enhances the sensitivity of gastric cancer cells to radiotherapy through the Wnt/β-catenin pathway
- Continuous renal replacement therapy combined with double filtration plasmapheresis in the treatment of severe lupus complicated by serious bacterial infections in children: A case report
- Simultaneous triple primary malignancies, including bladder cancer, lymphoma, and lung cancer, in an elderly male: A case report
- Preclinical immunogenicity assessment of a cell-based inactivated whole-virion H5N1 influenza vaccine
- One case of iodine-125 therapy – A new minimally invasive treatment of intrahepatic cholangiocarcinoma
- S1P promotes corneal trigeminal neuron differentiation and corneal nerve repair via upregulating nerve growth factor expression in a mouse model
- Early cancer detection by a targeted methylation assay of circulating tumor DNA in plasma
- Calcifying nanoparticles initiate the calcification process of mesenchymal stem cells in vitro through the activation of the TGF-β1/Smad signaling pathway and promote the decay of echinococcosis
- Evaluation of prognostic markers in patients infected with SARS-CoV-2
- N6-Methyladenosine-related alternative splicing events play a role in bladder cancer
- Characterization of the structural, oxidative, and immunological features of testis tissue from Zucker diabetic fatty rats
- Effects of glucose and osmotic pressure on the proliferation and cell cycle of human chorionic trophoblast cells
- Investigation of genotype diversity of 7,804 norovirus sequences in humans and animals of China
- Characteristics and karyotype analysis of a patient with turner syndrome complicated with multiple-site tumors: A case report
- Aggravated renal fibrosis is positively associated with the activation of HMGB1-TLR2/4 signaling in STZ-induced diabetic mice
- Distribution characteristics of SARS-CoV-2 IgM/IgG in false-positive results detected by chemiluminescent immunoassay
- SRPX2 attenuated oxygen–glucose deprivation and reperfusion-induced injury in cardiomyocytes via alleviating endoplasmic reticulum stress-induced apoptosis through targeting PI3K/Akt/mTOR axis
- Aquaporin-8 overexpression is involved in vascular structure and function changes in placentas of gestational diabetes mellitus patients
- Relationship between CRP gene polymorphisms and ischemic stroke risk: A systematic review and meta-analysis
- Effects of growth hormone on lipid metabolism and sexual development in pubertal obese male rats
- Cloning and identification of the CTLA-4IgV gene and functional application of vaccine in Xinjiang sheep
- Antitumor activity of RUNX3: Upregulation of E-cadherin and downregulation of the epithelial–mesenchymal transition in clear-cell renal cell carcinoma
- PHF8 promotes osteogenic differentiation of BMSCs in old rat with osteoporosis by regulating Wnt/β-catenin pathway
- A review of the current state of the computer-aided diagnosis (CAD) systems for breast cancer diagnosis
- Bilateral dacryoadenitis in adult-onset Still’s disease: A case report
- A novel association between Bmi-1 protein expression and the SUVmax obtained by 18F-FDG PET/CT in patients with gastric adenocarcinoma
- The role of erythrocytes and erythroid progenitor cells in tumors
- Relationship between platelet activation markers and spontaneous abortion: A meta-analysis
- Abnormal methylation caused by folic acid deficiency in neural tube defects
- Silencing TLR4 using an ultrasound-targeted microbubble destruction-based shRNA system reduces ischemia-induced seizures in hyperglycemic rats
- Plant Sciences
- Seasonal succession of bacterial communities in cultured Caulerpa lentillifera detected by high-throughput sequencing
- Cloning and prokaryotic expression of WRKY48 from Caragana intermedia
- Novel Brassica hybrids with different resistance to Leptosphaeria maculans reveal unbalanced rDNA signal patterns
- Application of exogenous auxin and gibberellin regulates the bolting of lettuce (Lactuca sativa L.)
- Phytoremediation of pollutants from wastewater: A concise review
- Genome-wide identification and characterization of NBS-encoding genes in the sweet potato wild ancestor Ipomoea trifida (H.B.K.)
- Alleviative effects of magnetic Fe3O4 nanoparticles on the physiological toxicity of 3-nitrophenol to rice (Oryza sativa L.) seedlings
- Selection and functional identification of Dof genes expressed in response to nitrogen in Populus simonii × Populus nigra
- Study on pecan seed germination influenced by seed endocarp
- Identification of active compounds in Ophiopogonis Radix from different geographical origins by UPLC-Q/TOF-MS combined with GC-MS approaches
- The entire chloroplast genome sequence of Asparagus cochinchinensis and genetic comparison to Asparagus species
- Genome-wide identification of MAPK family genes and their response to abiotic stresses in tea plant (Camellia sinensis)
- Selection and validation of reference genes for RT-qPCR analysis of different organs at various development stages in Caragana intermedia
- Cloning and expression analysis of SERK1 gene in Diospyros lotus
- Integrated metabolomic and transcriptomic profiling revealed coping mechanisms of the edible and medicinal homologous plant Plantago asiatica L. cadmium resistance
- A missense variant in NCF1 is associated with susceptibility to unexplained recurrent spontaneous abortion
- Assessment of drought tolerance indices in faba bean genotypes under different irrigation regimes
- The entire chloroplast genome sequence of Asparagus setaceus (Kunth) Jessop: Genome structure, gene composition, and phylogenetic analysis in Asparagaceae
- Food Science
- Dietary food additive monosodium glutamate with or without high-lipid diet induces spleen anomaly: A mechanistic approach on rat model
- Binge eating disorder during COVID-19
- Potential of honey against the onset of autoimmune diabetes and its associated nephropathy, pancreatitis, and retinopathy in type 1 diabetic animal model
- FTO gene expression in diet-induced obesity is downregulated by Solanum fruit supplementation
- Physical activity enhances fecal lactobacilli in rats chronically drinking sweetened cola beverage
- Supercritical CO2 extraction, chemical composition, and antioxidant effects of Coreopsis tinctoria Nutt. oleoresin
- Functional constituents of plant-based foods boost immunity against acute and chronic disorders
- Effect of selenium and methods of protein extraction on the proteomic profile of Saccharomyces yeast
- Microbial diversity of milk ghee in southern Gansu and its effect on the formation of ghee flavor compounds
- Ecology and Environmental Sciences
- Effects of heavy metals on bacterial community surrounding Bijiashan mining area located in northwest China
- Microorganism community composition analysis coupling with 15N tracer experiments reveals the nitrification rate and N2O emissions in low pH soils in Southern China
- Genetic diversity and population structure of Cinnamomum balansae Lecomte inferred by microsatellites
- Preliminary screening of microplastic contamination in different marine fish species of Taif market, Saudi Arabia
- Plant volatile organic compounds attractive to Lygus pratensis
- Effects of organic materials on soil bacterial community structure in long-term continuous cropping of tomato in greenhouse
- Effects of soil treated fungicide fluopimomide on tomato (Solanum lycopersicum L.) disease control and plant growth
- Prevalence of Yersinia pestis among rodents captured in a semi-arid tropical ecosystem of south-western Zimbabwe
- Effects of irrigation and nitrogen fertilization on mitigating salt-induced Na+ toxicity and sustaining sea rice growth
- Bioengineering and Biotechnology
- Poly-l-lysine-caused cell adhesion induces pyroptosis in THP-1 monocytes
- Development of alkaline phosphatase-scFv and its use for one-step enzyme-linked immunosorbent assay for His-tagged protein detection
- Development and validation of a predictive model for immune-related genes in patients with tongue squamous cell carcinoma
- Agriculture
- Effects of chemical-based fertilizer replacement with biochar-based fertilizer on albic soil nutrient content and maize yield
- Genome-wide identification and expression analysis of CPP-like gene family in Triticum aestivum L. under different hormone and stress conditions
- Agronomic and economic performance of mung bean (Vigna radiata L.) varieties in response to rates of blended NPS fertilizer in Kindo Koysha district, Southern Ethiopia
- Influence of furrow irrigation regime on the yield and water consumption indicators of winter wheat based on a multi-level fuzzy comprehensive evaluation
- Discovery of exercise-related genes and pathway analysis based on comparative genomes of Mongolian originated Abaga and Wushen horse
- Lessons from integrated seasonal forecast-crop modelling in Africa: A systematic review
- Evolution trend of soil fertility in tobacco-planting area of Chenzhou, Hunan Province, China
- Animal Sciences
- Morphological and molecular characterization of Tatera indica Hardwicke 1807 (Rodentia: Muridae) from Pothwar, Pakistan
- Research on meat quality of Qianhua Mutton Merino sheep and Small-tail Han sheep
- SI: A Scientific Memoir
- Suggestions on leading an academic research laboratory group
- My scientific genealogy and the Toronto ACDC Laboratory, 1988–2022
- Erratum
- Erratum to “Changes of immune cells in patients with hepatocellular carcinoma treated by radiofrequency ablation and hepatectomy, a pilot study”
- Erratum to “A two-microRNA signature predicts the progression of male thyroid cancer”
- Retraction
- Retraction of “Lidocaine has antitumor effect on hepatocellular carcinoma via the circ_DYNC1H1/miR-520a-3p/USP14 axis”