Abstract
Previous research has revealed the involvement of microRNA-212-5p (miR-212-5p) and cyclin T2 (CCNT2) in acute myeloid leukemia (AML). However, whether the miR-212-5p/CCNT2 axis is required for the function of decitabine in AML has not been well elucidated. Quantitative reverse transcription-polymerase chain reaction was used to examine enrichment of miR-212-5p. The relationship between CCNT2 and miR-212-5p was verified by the luciferase reporter assay. Cell apoptosis was evaluated by flow cytometry and western blot. CCK-8 assay was performed to determine cell viability. Decitabine significantly repressed cell viability, while promoted cell apoptosis. Meanwhile, the expression levels of cyclinD1, CDK4, and Bcl-2 were suppressed in cells with decitabine exposure, but Bax and caspase-3 expression levels were upregulated. Besides, miR-212-5p upregulation had the similar function with decitabine in AML cell proliferation and apoptosis. Subsequently, restoration of CCNT2 attenuated miR-212-5p overexpression-induced effects in Kasumi-1 and SKNO-1 cells. In addition, miR-212-5p depletion reversed decitabine-induced CCNT2 downregulation. The miR-212-5p/CCNT2 axis had an implication in the anti-leukemic effect of decitabine in AML.
1 Introduction
Acute myeloid leukemia (AML) is a malignant leukemia affecting adults [1,2]. Although great progression in AML treatment has been made, the prognosis and outcome of AML remain dismal.
Many studies have shown that hypomethylating agents contribute to the treatment of hematologic malignancies, including AML [3,4,5]. Decitabine, a DNA hypomethylating agent, is one of the most commonly utilized therapeutics for AML [6]. In AML cell lines, it has been observed that decitabine inhibits cell viability and promotes apoptosis [7]. However, the effect of decitabine is still limited. MicroRNAs (miRNAs) are widely reported to modulate cellular viability, survival, as well as differentiation, and act as the potential therapeutic targets for AML [8]. For instance, Yan et al. demonstrated low expression of miR-217 in AML in vivo, which may be a prognostic indicator for AML [9]. In another report, loss of miR-345-5p promoted proliferation and blocked apoptosis by targeting AKT2 in AML [10]. Previous studies pointed out that miR-29b overexpression could increase the antileukemic activity of decitabine [11,12]. Low expression of miR-29a was linked to the malignant progression in pediatric AML patients [13]. These findings supported the important roles of miRNAs in predicting prognosis of AML. More importantly, miRNAs may have the potential to synergize with decitabine to treat AML. Previous studies have revealed the protective role of miR-212-5p in various diseases, including AML [14,15]. These results further showed that miR-212-5p could regulate the proliferation and apoptosis of AML in vitro [15]. Cyclin T2 (CCNT2) is required for the RNA polymerase II-mediated transcription process [16,17]. More importantly, a previous investigation indicated that miR-192 suppressed cell viability and cell cycle progression as well as enhanced cell apoptosis in AML by targeting CCNT2 [18]. Although several findings have indicated the roles of miRNAs (including miR-212-5p) and CCNT2 in AML, the involvement of the miR-212-5p/CCNT2 pathway in the antileukemic activity of decitabine has not been fully understood.
In this study, we sought to address whether the miR-212-5p/CCNT2 pathway is required for the antiproliferative function of decitabine in AML.
2 Materials and methods
2.1 Cell culture and transfection
Cells (Kasumi-1 and SKNO-1 cell lines) were purchased from American Type Culture Collection (Manassas, VA, USA) and maintained in RPMI 1640 (Thermo Fisher Scientific, Waltham, MA, USA) containing 10% fetal bovine serum. CCNT2 overexpression plasmid (pc-CCNT2), pcDNA 3.0 vector (pc-NC), miR-212-5p mimic (agomiR-212-5p), negative control mimic (Scramble), miR-212-5p inhibitor (antagomiR-212-5p), and negative control inhibitor (antagomiR-NC) were constructed. In brief, 1 × 106 cells were plated into a 6-well plate, then the constructs were transfected into the cells using Lipofectamine 3000 (Thermo Fisher Scientific) following the manufacturer’s instruction. 24-72 hours upon transfection, the transfected cells were harvested for subsequent research.
2.2 Luciferase reporter assay
CCNT2 fragments including the wild-type (WT-CCNT2) or mutated (MUT-CCNT2) were cloned into the psiCHECK-2 vector. Cells were co-transfected with agomiR-212-5p or Scramble and WT-CCNT2 or MUT-CCNT2 using Lipofectamine 3000. The relative luciferase activity was quantified with the dual-luciferase reporter assay system (Promega, Madison, WI, USA).
2.3 Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) assay
Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and DNase I and quantified with Nanodrop 2000 (Thermo Fisher Scientific). Then, reverse transcription was performed using PrimeScript RT Reagent Kit (Takara, Dalian, China). qPCR was conducted using SYBR Green PCR Master Mix (BioSystems, Foster City, CA, USA). Beta-actin (β-actin) was employed as the internal control, which was the most stable reference gene in AML analyzed by GeNorm and NormFinder [19,20]. Relative expression levels of CCNT2 and miR-212-5p were calculated using the 2−ΔΔCt method. The primer sequences are presented in Table 1.
The primers used in qRT-PCR
| Gene | Primer sequence | Tm (°C) | Amplification efficiency (%) | Product size (bp) |
|---|---|---|---|---|
| miR-212-5p | F: ACCTTGGCTCTAGACTGCT | 57.6 | 92.30 | 74 |
| R: GCAGGGTCCGAGGTATTC | 56.8 | |||
| CCNT2 | F: GGAGTGGAGGCGGATAAAGAG | 59.9 | 94.70 | 84 |
| R: AGAGACATTGAGACGCTGTCC | 59.8 | |||
| U6 | F: TAGGATTATACATTGTAAGAGGT | 51.8 | 93.50 | 119 |
| R: GTGTGCTACAGAATTTAAAGGTT | 55.4 | |||
| β-Actin | F: CTTCGCGGGCGACGAT | 59.9 | 96.40 | 104 |
| R: CCACATAGGAATCCTTCTGAC | 58.7 |
2.4 Western blot
Total protein was extracted from cells using RIPA lysis buffer (Beyotime, Shanghai, China) containing phenylmethylsulfonyl fluoride (PMSF; Beyotime) and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Samples were then transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). Afterward, the membranes were blocked with 5% skim milk for 1 h at room temperature. The membranes were incubated with the following primary antibodies at 4°C overnight: anti-CCNT2 (1:1,000; ab96133; Abcam, Cambridge, UK), anti-β-actin (1:2,500; ab8227; Abcam), anti-cyclinD1 (1:5,000; ab134175; Abcam), anti-CDK4 (1:1,000; ab108357; Abcam), anti-Bcl-2 (1:1,000; ab32124; Abcam), anti-Bax (1:1,000; ab32503; Abcam), and anti-caspase-3 (1:500; ab13847; Abcam); and then incubated with secondary antibody (1:5,000; ab205718; Abcam) for 1 h at room temperature. Protein bands were visualized using ECL kits (Thermo Fisher Scientific).
2.5 Cell Counting Kit-8 (CCK-8) assay
After decitabine (Sigma-Aldrich, Germany) treatment and/or miRNA and plasmid transfection, cells at a density of 5–6 × 105 per well (96-well plate) in 100 µL of culture medium were tested. Ten microliters of the CCK-8 solution (Beyotime) were added into each well and incubated for 4 h. Absorbance was measured at 450 nm using a microplate reader (Bio-Rad, Hercules, CA, USA).
2.6 Cell apoptosis assay
The number of cells per sample was 1–5 × 106/mL. The cells were washed once with incubation buffer, resuspended with 100 µL of labeling solution (labeling solution: Annexin V-FITC and PI in the incubation buffer at a final concentration of 1 µg/mL), incubated for 15 min at room temperature, and collected by centrifugation at 1,000 rpm for 5 min. Apoptotic cells were detected using a flow cytometer (BD Biosciences, San Jose, CA, USA).
2.7 Statistical analysis
Statistical analysis in this study was performed using Graphpad 7.0 statistical software (Graphpad, San Diego, CA, USA). The differences were determined using Student’s t-test or one-way ANOVA. P values less than 0.05 were considered statistically significant.
3 Results
3.1 Decitabine decreases proliferation while promotes apoptosis of AML cells
In this study, decitabine was used to treat AML cells. As shown in Figure 1a and b, various concentrations of decitabine were used to stimulate Kasumi-1 and SKNO-1 cells. Our data indicated that cell viability was significantly inhibited after treatment with different concentrations of decitabine. The results of flow cytometry further outlined that decitabine notably increased the cell apoptotic rate (Figure 1c and d). To expound the molecular basis of these processes, the expression levels of proliferation/apoptosis-related proteins were detected (Figure 2a and b). We found that cyclinD1 and CDK4, proliferation-related proteins, were decreased in decitabine-treated cells. Meanwhile, Bcl-2 expression was also downregulated. In contrast, the levels of Bax and caspase-3 were distinctly upregulated in cells exposed to decitabine. Decitabine at a concentration of 5 µM was selected for the following experiments. MiR-212-5p was significantly upregulated in decitabine-treated cells (Figure 3). These data implied that miR-212-5p may be related to the function of decitabine in AML cells.

Effect of decitabine on the viability and apoptosis of AML cells. (a and b) CCK-8 assay was used to determine the viability of cells treated with various concentrations of decitabine. (c and d) Cell apoptosis was evaluated by flow cytometry. *P < 0.05 compared with 24 h treatment; #P < 0.05 compared with 48 h treatment; &P < 0.05 compared with 72 h treatment.

Effect of decitabine on the expression levels of proliferation- and apoptosis-related proteins. (a and b) Western blot was performed to examine the protein levels of cyclinD1, CDK4, Bcl-2, Bax, and caspase-3 in Kasumi-1 and SKNO-1 cells after treatment with different concentrations of decitabine. *P < 0.05.

Effect of decitabine on miR-212-5p expression level in Kasumi-1 and SKNO-1 cells. Cells were exposed to decitabine, and the level of miR-212-5p was detected using qRT-PCR assay. *P < 0.05.
3.2 MiR-212-5p upregulation decreases cell viability, while increases cell apoptosis
Then, we upregulated miR-212-5p expression in AML cells using agomiR-212-5p. The transfection efficiency demonstrated that the introduction of agomiR-212-5p distinctly upregulated the miR-212-5p level (Figure 4a). The agomiRNA-mediated overexpression of miR-212-5p inhibited cell viability (Figure 4b and c). In addition, the cell apoptotic rate was remarkably increased by miR-212-5p overexpression (Figure 4d). Simultaneously, the result of the western blot analysis of proliferation/apoptosis-related proteins was also consistent with that of CCK-8 and flow cytometry assays (Figure 5a and b), further confirming that the gain of miR-212-5p may participate in decitabine-induced proliferation suppression and apoptosis promotion in AML cells.

Effect of miR-212-5p overexpression on cell viability and apoptosis. (a) qRT-PCR was carried out to evaluate miR-212-5p expression in cells transfected with Scramble or agomiR-212-5p. (b and c) CCK-8 assay was employed to determine cell viability. (d) Cell apoptotic rate was examined in Kasumi-1 and SKNO-1 cells of each group. *P < 0.05.

Effect of miR-212-5p upregulation on the expression levels of proliferation- and apoptosis-related proteins in AML cells. (a and b) The protein levels of cyclinD1, CDK4, Bcl-2, Bax, and caspase-3 in cells transfected with agomiR-212-5p. *P < 0.05.
3.3 MiR-212-5p contains the binding sites with CCNT2
It is well known that miRNAs regulate cellular processes by repressing target genes. We searched the potential target gene of miR-212-5p using an online tool TargetScan. The data uncovered that miR-212-5p harbored binding sequences complementary to CCNT2 seed regions (Figure 6a). We further addressed whether miR-212-5p targets CCNT2. As a result, the transfection of agomiR-212-5p greatly decreased the luciferase activity of the WT-CCNT2 group, while no obvious change was observed in the MUT-CCNT2 group (Figure 6b and c). As demonstrated in Figure 6d, the delivery of agomiR-212-5p induced the inhibition of the CCNT2 protein level. However, the interference of miR-212-5p elevated the CCNT2 level (Figure 6e).

MiR-212-5p interacts with CCNT2. (a) The complementary sequences of miR-212-5p and CCNT2 were predicted by TargetScan online database. (b and c) AgomiR-212-5p or Scramble and MUT-CCNT2 or WT-CCNT2 were transfected into Kasumi-1 and SKNO-1 cells, and then, the luciferase activity was examined. (d) Western blot was performed to detect the protein level of CCNT2 in cells introduced with agomiR-212-5p or Scramble. (e) The relative expression of CCNT2 in antagomiR-212-5p- or antagomiR-NC-transfected cells. *P < 0.05.
3.4 Restoration of CCNT2 attenuates the effects of miR-212-5p upregulation in AML
We performed the rescue-of-function experiment to confirm the involvement of miR-212-5p/CCNT2 axis in the regulation of proliferation and apoptosis of AML. As displayed in Figure 7a and b, the protein level of CCNT2 was lower in miR-212-5p overexpressing cells than that of the control group, while it was rescued by forced expression of CCNT2. CCK-8 assay further indicated that elevated CCNT2 expression regained miR-212-5p upregulation-induced inhibition of cell viability (Figure 7c and d). When compared with the agomiR-212-5p + pc-NC group, cell apoptosis was blocked in the agomiR-212-5p + pc-CCNT2 group (Figure 7e and f). These results revealed that pc-CCNT2 transfection distinctly overturned the impact of miR-212-5p upregulation on cell viability and apoptosis.

Effect of CCNT2 overexpression on miR-212-5p upregulation-induced effects in AML cells. (a and b) Cells were co-transfected with agomiR-212-5p and CCNT2 overexpression plasmid (pc-CCNT2) and then subjected to western blot analysis of CCNT2. (c–f) Cell viability and apoptosis were determined by CCK-8 assay and flow cytometry, respectively. *P < 0.05.
3.5 MiR-212-5p ablation overturns decitabine-induced CCNT2 downregulation
Finally, the level of CCNT2 in AML cells treated with decitabine and antagomiR-212-5p was also examined using qRT-PCR. In Kasumi-1 cells, we disclosed that the protein level of CCNT2 was inhibited in the decitabine group compared with that in the control group. However, the introduction of antagomiR-212-5p dramatically recuperated the decitabine-induced CCNT2 suppression (Figure 8a). As expected, miR-212-5p ablation overturned decitabine-induced CCNT2 downregulation in SKNO-1 cells (Figure 8b). Collectively, all these data implied that the miR-212-5p/CCNT2 axis may be responsible for the function of decitabine in AML, further demonstrating the potential of miR-212-5p combined with decitabine in AML treatment by inducing cell proliferation inhibition and apoptosis (Figure 9).

Decitabine regulates the expression of CCNT2 via miR-212-5p. (a and b) Western blot was conducted to evaluate the expression of CCNT2 in cells with decitabine exposure and antagomiR-212-5p transfection. *P < 0.05.

Decitabine inhibits cell proliferation and enhances apoptosis via the miR-212-5p/CCNT2 axis in AML cells.
4 Discussion
AML develops in people of all ages, especially in the elderly, who have poor overall survival rates [2,21]. It has been well documented that decitabine has acceptable efficacy for the treatment of AML [22,23]. However, there are little data about the molecular mechanism of decitabine treatment of AML. Therefore, a deep understanding of the related molecular mechanisms of decitabine in AML may contribute to the treatment of AML. In our study, we also confirmed the anti-AML activity of decitabine via evaluating cell viability and apoptosis. According to the cell viability of Kasumi-1 and SKNO-1 cells treated with different concentrations of decitabine for different times, decitabine at a concentration of 5 µM for 48 h was used to explore the regulatory mechanism of decitabine function in AML.
Accumulating studies supported that many miRNAs participate in the development of various diseases, including AML [8,9]. Emerging evidence has revealed the involvement of miR-212-5p in various diseases [14,24,25]. Researchers have reported that miR-212-5p prevents dopaminergic neuron death in the mouse model of Parkinson’s disease [24]. In another study, high level of miR-212-5p blocks epithelial–mesenchymal transition in breast cancer, thereby inhibiting cancer progression [26]. A study also revealed that downregulation of miR-212-5p is related to MIF-AS1-mediated promotion of proliferation and apoptosis inhibition in gastric cancer [27]. Recently, the previous study has demonstrated that the expression of miR-212-5p is low in AML patients and cells. They further indicated that the upregulation of miR-212-5p blocks cell viability and proliferation, while increases apoptosis in Kasumi-1 cells [15]. Consistently, we disclosed that the miR-212-5p level was elevated in cells exposed to different concentrations of decitabine. Moreover, gain of miR-212-5p induced cell viability promotion, as well as increased the cell apoptosis rate, implying that miR-212-5p may participate in the process of AML response to decitabine. The induced expression of miR-212-5p by decitabine and its role in AML suggested that miR-212-5p might serve as a potential biomarker in AML or in decitabine-treated AML; however, this still needs to be verified by further clinical test.
An increasing number of miRNA–mRNA networks was identified to be associated with AML [28,29]. A previous study stated that miR-142-3p may play a suppressor role in the development of gastric cancer via downregulating CCNT2 [30]. A study confirmed that CCNT2 act as a target of miR-15a to block spermatogenesis [31]. MiR-297c-5p impedes cell proliferation via negatively affecting CCNT2 expression in oligodendrocyte progenitor cells [32]. Recent evidence showed that CCNT2 may act as the target of miR-192 and participate in the progression of AML [18]. But whether CCNT2 is associated with the miR-212-5p-mediated function has not been elaborated. Interestingly, results from this study provided the evidence that CCNT2 contained the binding sites with miR-212-5p and the expression of CCNT2 could be impeded by miR-212-5p, referring that CCNT2 may have an implication in the function of miR-212-5p in decitabine-treated cells. Subsequently, in rescue-of-function experiment, the function of miR-212-5p overexpression to inhibit cell viability and promote cell apoptosis was blocked by CCNT2 upregulation in AML, and these results suggested that miR-212-5p effected the behavior of AML cells via targeting CCNT2. In further experiments, CCNT2 was visibly decreased in AML cells treated with decitabine; nevertheless, the decitabine-induced suppression of CCNT2 was relieved by downregulation of miR-212-5p. In summary, these experiments proved that decitabine repressed cell proliferation and enhanced apoptosis via inducing miR-212-5p expression to downregulate CCNT2 in AML (Figure 9).
There are some limitations in this study. It is vital to explore the detailed molecular mechanisms of the miR-212-5p/CCNT2 axis in the treatment of AML. At the same time, the role of CCNT2 alone should be anatomized in future. In addition, whether the miR-212-5p/CCNT2 pathway axis influences other cell biological processes in decitabine-treated AML cells also requires more intensive research. Their function should be addressed in vivo in future.
In conclusion, these findings shed light on that miR-212-5p may serve as a potential target of AML therapy. MiR-212-5p/CCNT2 pathway is a novel mechanism of decitabine-induced response in AML cells, which could bridge an important gap in knowledge of decitabine treatment for AML. Meanwhile, our data also provided the theoretical basis for the pathogenesis of AML.
Acknowledgments
This work was supported by Clinical study on the treatment of medullary tumors by decitabine(grant no. 20180293).
Conflict of interest: The authors state no conflict of interest.
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
[1] De Kouchkovsky I, Abdul-Hay M. Acute myeloid leukemia: a comprehensive review and 2016 update. Blood Cancer J. 2016;6(7):e441.10.1038/bcj.2016.50Search in Google Scholar PubMed PubMed Central
[2] Shallis RM, Wang R, Davidoff A, Ma X, Zeidan AM. Epidemiology of acute myeloid leukemia: recent progress and enduring challenges. Blood Rev. 2019;36:70–87.10.1016/j.blre.2019.04.005Search in Google Scholar PubMed
[3] Lindblad KE, Goswami M, Hourigan CS, Oetjen KA. Immunological effects of hypomethylating agents. Expert Rev Hematol. 2017;10(8):745–52.10.1080/17474086.2017.1346470Search in Google Scholar PubMed PubMed Central
[4] Gardin C, Dombret H. Hypomethylating agents as a therapy for AML. Curr Hematol Malig Rep. 2017;12(1):1–10.10.1007/s11899-017-0363-4Search in Google Scholar PubMed
[5] Gbolahan OB, Zeidan AM, Stahl M, Abu Zaid M, Farag S, Paczesny S, et al. Immunotherapeutic concepts to target acute myeloid leukemia: focusing on the role of monoclonal antibodies, hypomethylating agents and the leukemic microenvironment. Int J Mol Sci. 2017;18(8):1660.10.3390/ijms18081660Search in Google Scholar PubMed PubMed Central
[6] He PF, Zhou JD, Yao DM, Ma JC, Wen XM, Zhang ZH, et al. Efficacy and safety of decitabine in treatment of elderly patients with acute myeloid leukemia: a systematic review and meta-analysis. Oncotarget. 2017;8(25):41498–507.10.18632/oncotarget.17241Search in Google Scholar PubMed PubMed Central
[7] Mao J, Li S, Zhao H, Zhu Y, Hong M, Zhu H, et al. Effects of chidamide and its combination with decitabine on proliferation and apoptosis of leukemia cell lines. Am J Transl Res. 2018;10(8):2567–78.Search in Google Scholar
[8] Wallace JA, O’Connell RM. MicroRNAs and acute myeloid leukemia: therapeutic implications and emerging concepts. Blood. 2017;130(11):1290–301.10.1182/blood-2016-10-697698Search in Google Scholar PubMed PubMed Central
[9] Yan J, Wu G, Chen J, Xiong L, Chen G, Li P. Downregulated miR-217 expression predicts a poor outcome in acute myeloid leukemia. Cancer Biomark. 2018;22(1):73–8.10.3233/CBM-170936Search in Google Scholar PubMed
[10] Ying X, Zhang W, Fang M, Zhang W, Wang C, Han L. miR-345-5p regulates proliferation, cell cycle, and apoptosis of acute myeloid leukemia cells by targeting AKT2. J Cell Biochem. 2019;120(2):1620–9.10.1002/jcb.27461Search in Google Scholar PubMed
[11] Mims A, Walker AR, Huang X, Sun J, Wang H, Santhanam R, et al. Increased anti-leukemic activity of decitabine via AR-42-induced upregulation of miR-29b: a novel epigenetic-targeting approach in acute myeloid leukemia. Leukemia. 2013;27(4):871–8.10.1038/leu.2012.342Search in Google Scholar PubMed PubMed Central
[12] Blum W, Garzon R, Klisovic RB, Schwind S, Walker A, Geyer S, et al. Clinical response and miR-29b predictive significance in older AML patients treated with a 10-day schedule of decitabine. Proc Natl Acad Sci USA. 2010;107(16):7473–8.10.1073/pnas.1002650107Search in Google Scholar PubMed PubMed Central
[13] Zhu C, Wang Y, Kuai W, Sun X, Chen H, Hong Z. Prognostic value of miR-29a expression in pediatric acute myeloid leukemia. Clin Biochem. 2013;46(1–2):49–53.10.1016/j.clinbiochem.2012.09.002Search in Google Scholar PubMed
[14] Jia Q, Chang J, Hong Q, Zhang JJ, Zhou H, Chen FH. MiR-212-5p exerts a protective effect in chronic obstructive pulmonary disease. Discovery Med. 2018;26(144):173–83.Search in Google Scholar
[15] Lin JF, Zeng H, Zhao JQ. MiR-212-5p regulates the proliferation and apoptosis of AML cells through targeting FZD5. Eur Rev Med Pharmacol Sci. 2018;22(23):8415–22.Search in Google Scholar
[16] Kohoutek J, Li Q, Blazek D, Luo Z, Jiang H, Peterlin BM. Cyclin T2 is essential for mouse embryogenesis. Mol Cell Biol. 2009;29(12):3280–5.10.1128/MCB.00172-09Search in Google Scholar PubMed PubMed Central
[17] Baumli S, Lolli G, Lowe ED, Troiani S, Rusconi L, Bullock AN, et al. The structure of P-TEFb (CDK9/cyclin T1), its complex with flavopiridol and regulation by phosphorylation. EMBO J. 2008;27(13):1907–18.10.1038/emboj.2008.121Search in Google Scholar PubMed PubMed Central
[18] Ke S, Li RC, Lu J, Meng FK, Feng YK, Fang MH. MicroRNA-192 regulates cell proliferation and cell cycle transition in acute myeloid leukemia via interaction with CCNT2. Int J Hematol. 2017;106(2):258–65.10.1007/s12185-017-2232-2Search in Google Scholar PubMed
[19] Lee C, Yiau KXS, Lee LJ, Chong PP, Chang KM, Abdullah M. Selection of reference genes for quantitative studies in acute myeloid leukaemia. Malaysian J Pathol. 2019;41(3):313–26.Search in Google Scholar
[20] Li H, Chen C, Yao H, Li X, Yang N, Qiao J, et al. Identification of suitable reference genes for mRNA studies in bone marrow in a mouse model of hematopoietic stem cell transplantation. Transplant Proc. 2016;48(8):2826–32.10.1016/j.transproceed.2016.07.028Search in Google Scholar PubMed
[21] Oran B, Weisdorf DJ. Survival for older patients with acute myeloid leukemia: a population-based study. Haematologica. 2012;97(12):1916–24.10.3324/haematol.2012.066100Search in Google Scholar PubMed PubMed Central
[22] Park H, Chung H, Lee J, Jang J, Kim Y, Kim SJ, et al. Decitabine as a first-line treatment for older adults newly diagnosed with acute myeloid leukemia. Yonsei Med J. 2017;58(1):35–42.10.3349/ymj.2017.58.1.35Search in Google Scholar PubMed PubMed Central
[23] Levine LB, Roddy JV, Kim M, Li J, Phillips G, Walker AR. A comparison of toxicities in acute myeloid leukemia patients with and without renal impairment treated with decitabine. J Oncol Pharm Pract. 2018;24(4):290–8.10.1177/1078155217702213Search in Google Scholar PubMed PubMed Central
[24] Sun S, Han X, Li X, Song Q, Lu M, Jia M, et al. MicroRNA-212-5p prevents dopaminergic neuron death by inhibiting SIRT2 in MPTP-induced mouse model of Parkinson’s disease. Front Mol Neurosci. 2018;11:381.10.3389/fnmol.2018.00381Search in Google Scholar PubMed PubMed Central
[25] Dix A, Czakai K, Leonhardt I, Schäferhoff K, Bonin M, Guthke R, et al. Specific and novel microRNAs are regulated as response to fungal infection in human dendritic cells. Front Microbiol. 2017;8:270.10.3389/fmicb.2017.00270Search in Google Scholar PubMed PubMed Central
[26] Lv ZD, Yang DX, Liu XP, Jin LY, Wang XG, Yang ZC, et al. MiR-212-5p suppresses the epithelial-mesenchymal transition in triple-negative breast cancer by targeting Prrx2. Cell Physiol Biochem. 2017;44(5):1785–95.10.1159/000485785Search in Google Scholar PubMed
[27] Li L, Li Y, Huang Y, Ouyang Y, Zhu Y, Wang Y, et al. Long non-coding RNA MIF-AS1 promotes gastric cancer cell proliferation and reduces apoptosis to upregulate NDUFA4. Cancer Sci. 2018;109(12):3714–25.10.1111/cas.13801Search in Google Scholar PubMed PubMed Central
[28] Wang Y, Wang C, Chen C, Wu F, Shen P, Zhang P, et al. Long non-coding RNA NEAT1 regulates epithelial membrane protein 2 expression to repress nasopharyngeal carcinoma migration and irradiation-resistance through miR-101-3p as a competing endogenous RNA mechanism. Oncotarget. 2017;8(41):70156–71.10.18632/oncotarget.19596Search in Google Scholar PubMed PubMed Central
[29] Zhou JD, Li XX, Zhang TJ, Xu ZJ, Zhang ZH, Gu Y, et al. MicroRNA-335/ID4 dysregulation predicts clinical outcome and facilitates leukemogenesis by activating PI3K/Akt signaling pathway in acute myeloid leukemia. Aging. 2019;11(10):3376–91.10.18632/aging.101991Search in Google Scholar PubMed PubMed Central
[30] Wang Y, Cao Z, Wang L, Liu S, Cai J. Downregulation of microRNA-142-3p and its tumor suppressor role in gastric cancer. Oncol Lett. 2018;15(5):8172–80.10.3892/ol.2018.8330Search in Google Scholar PubMed PubMed Central
[31] Teng Y, Wang Y, Fu J, Cheng X, Miao S, Wang L. Cyclin T2: a novel miR-15a target gene involved in early spermatogenesis. FEBS Lett. 2011;585(15):2493–500.10.1016/j.febslet.2011.06.031Search in Google Scholar PubMed
[32] Kuypers NJ, Bankston AN, Howard RM, Beare JE, Whittemore SR. Remyelinating oligodendrocyte precursor cell miRNAs from the Sfmbt2 cluster promote cell cycle arrest and differentiation. J Neurosci. 2016;36(5):1698–710.10.1523/JNEUROSCI.1240-15.2016Search in Google Scholar PubMed PubMed Central
© 2020 Lina Xing et al., published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Plant Sciences
- Dependence of the heterosis effect on genetic distance, determined using various molecular markers
- Plant Growth Promoting Rhizobacteria (PGPR) Regulated Phyto and Microbial Beneficial Protein Interactions
- Role of strigolactones: Signalling and crosstalk with other phytohormones
- An efficient protocol for regenerating shoots from paper mulberry (Broussonetia papyrifera) leaf explants
- Functional divergence and adaptive selection of KNOX gene family in plants
- In silico identification of Capsicum type III polyketide synthase genes and expression patterns in Capsicum annuum
- In vitro induction and characterisation of tetraploid drumstick tree (Moringa oleifera Lam.)
- CRISPR/Cas9 or prime editing? – It depends on…
- Study on the optimal antagonistic effect of a bacterial complex against Monilinia fructicola in peach
- Natural variation in stress response induced by low CO2 in Arabidopsis thaliana
- The complete mitogenome sequence of the coral lily (Lilium pumilum) and the Lanzhou lily (Lilium davidii) in China
- Ecology and Environmental Sciences
- Use of phosphatase and dehydrogenase activities in the assessment of calcium peroxide and citric acid effects in soil contaminated with petrol
- Analysis of ethanol dehydration using membrane separation processes
- Activity of Vip3Aa1 against Periplaneta americana
- Thermostable cellulase biosynthesis from Paenibacillus alvei and its utilization in lactic acid production by simultaneous saccharification and fermentation
- Spatiotemporal dynamics of terrestrial invertebrate assemblages in the riparian zone of the Wewe river, Ashanti region, Ghana
- Antifungal activity of selected volatile essential oils against Penicillium sp.
- Toxic effect of three imidazole ionic liquids on two terrestrial plants
- Biosurfactant production by a Bacillus megaterium strain
- Distribution and density of Lutraria rhynchaena Jonas, 1844 relate to sediment while reproduction shows multiple peaks per year in Cat Ba-Ha Long Bay, Vietnam
- Biomedical Sciences
- Treatment of Epilepsy Associated with Common Chromosomal Developmental Diseases
- A Mouse Model for Studying Stem Cell Effects on Regeneration of Hair Follicle Outer Root Sheaths
- Morphine modulates hippocampal neurogenesis and contextual memory extinction via miR-34c/Notch1 pathway in male ICR mice
- Composition, Anticholinesterase and Antipedicular Activities of Satureja capitata L. Volatile Oil
- Weight loss may be unrelated to dietary intake in the imiquimod-induced plaque psoriasis mice model
- Construction of recombinant lentiviral vector containing human stem cell leukemia gene and its expression in interstitial cells of cajal
- Knockdown of lncRNA KCNQ1OT1 inhibits glioma progression by regulating miR-338-3p/RRM2
- Protective effect of asiaticoside on radiation-induced proliferation inhibition and DNA damage of fibroblasts and mice death
- Prevalence of dyslipidemia in Tibetan monks from Gansu Province, Northwest China
- Sevoflurane inhibits proliferation, invasion, but enhances apoptosis of lung cancer cells by Wnt/β-catenin signaling via regulating lncRNA PCAT6/ miR-326 axis
- MiR-542-3p suppresses neuroblastoma cell proliferation and invasion by downregulation of KDM1A and ZNF346
- Calcium Phosphate Cement Causes Nucleus Pulposus Cell Degeneration Through the ERK Signaling Pathway
- Human Dental Pulp Stem Cells Exhibit Osteogenic Differentiation Potential
- MiR-489-3p inhibits cell proliferation, migration, and invasion, and induces apoptosis, by targeting the BDNF-mediated PI3K/AKT pathway in glioblastoma
- Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating the microRNA-34a-5p/NOTCH1 signaling pathway
- Large Brunner’s gland adenoma of the duodenum for almost 10 years
- Neurotrophin-3 accelerates reendothelialization through inducing EPC mobilization and homing
- Hepatoprotective effects of chamazulene against alcohol-induced liver damage by alleviation of oxidative stress in rat models
- FXYD6 overexpression in HBV-related hepatocellular carcinoma with cirrhosis
- Risk factors for elevated serum colorectal cancer markers in patients with type 2 diabetes mellitus
- Effect of hepatic sympathetic nerve removal on energy metabolism in an animal model of cognitive impairment and its relationship to Glut2 expression
- Progress in research on the role of fibrinogen in lung cancer
- Advanced glycation end product levels were correlated with inflammation and carotid atherosclerosis in type 2 diabetes patients
- MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB
- Knockdown of DDX46 inhibits trophoblast cell proliferation and migration through the PI3K/Akt/mTOR signaling pathway in preeclampsia
- Buformin suppresses osteosarcoma via targeting AMPK signaling pathway
- Effect of FibroScan test in antiviral therapy for HBV-infected patients with ALT <2 upper limit of normal
- LncRNA SNHG15 regulates osteosarcoma progression in vitro and in vivo via sponging miR-346 and regulating TRAF4 expression
- LINC00202 promotes retinoblastoma progression by regulating cell proliferation, apoptosis, and aerobic glycolysis through miR-204-5p/HMGCR axis
- Coexisting flavonoids and administration route effect on pharmacokinetics of Puerarin in MCAO rats
- GeneXpert Technology for the diagnosis of HIV-associated tuberculosis: Is scale-up worth it?
- Circ_001569 regulates FLOT2 expression to promote the proliferation, migration, invasion and EMT of osteosarcoma cells through sponging miR-185-5p
- Lnc-PICSAR contributes to cisplatin resistance by miR-485-5p/REV3L axis in cutaneous squamous cell carcinoma
- BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells
- MYL6B drives the capabilities of proliferation, invasion, and migration in rectal adenocarcinoma through the EMT process
- Inhibition of lncRNA LINC00461/miR-216a/aquaporin 4 pathway suppresses cell proliferation, migration, invasion, and chemoresistance in glioma
- Upregulation of miR-150-5p alleviates LPS-induced inflammatory response and apoptosis of RAW264.7 macrophages by targeting Notch1
- Long non-coding RNA LINC00704 promotes cell proliferation, migration, and invasion in papillary thyroid carcinoma via miR-204-5p/HMGB1 axis
- Neuroanatomy of melanocortin-4 receptor pathway in the mouse brain
- Lipopolysaccharides promote pulmonary fibrosis in silicosis through the aggravation of apoptosis and inflammation in alveolar macrophages
- Influences of advanced glycosylation end products on the inner blood–retinal barrier in a co-culture cell model in vitro
- MiR-4328 inhibits proliferation, metastasis and induces apoptosis in keloid fibroblasts by targeting BCL2 expression
- Aberrant expression of microRNA-132-3p and microRNA-146a-5p in Parkinson’s disease patients
- Long non-coding RNA SNHG3 accelerates progression in glioma by modulating miR-384/HDGF axis
- Long non-coding RNA NEAT1 mediates MPTP/MPP+-induced apoptosis via regulating the miR-124/KLF4 axis in Parkinson’s disease
- PCR-detectable Candida DNA exists a short period in the blood of systemic candidiasis murine model
- CircHIPK3/miR-381-3p axis modulates proliferation, migration, and glycolysis of lung cancer cells by regulating the AKT/mTOR signaling pathway
- Reversine and herbal Xiang–Sha–Liu–Jun–Zi decoction ameliorate thioacetamide-induced hepatic injury by regulating the RelA/NF-κB/caspase signaling pathway
- Therapeutic effects of coronary granulocyte colony-stimulating factor on rats with chronic ischemic heart disease
- The effects of yam gruel on lowering fasted blood glucose in T2DM rats
- Circ_0084043 promotes cell proliferation and glycolysis but blocks cell apoptosis in melanoma via circ_0084043-miR-31-KLF3 axis
- CircSAMD4A contributes to cell doxorubicin resistance in osteosarcoma by regulating the miR-218-5p/KLF8 axis
- Relationship of FTO gene variations with NAFLD risk in Chinese men
- The prognostic and predictive value of platelet parameters in diabetic and nondiabetic patients with sudden sensorineural hearing loss
- LncRNA SNHG15 contributes to doxorubicin resistance of osteosarcoma cells through targeting the miR-381-3p/GFRA1 axis
- miR-339-3p regulated acute pancreatitis induced by caerulein through targeting TNF receptor-associated factor 3 in AR42J cells
- LncRNA RP1-85F18.6 affects osteoblast cells by regulating the cell cycle
- MiR-203-3p inhibits the oxidative stress, inflammatory responses and apoptosis of mice podocytes induced by high glucose through regulating Sema3A expression
- MiR-30c-5p/ROCK2 axis regulates cell proliferation, apoptosis and EMT via the PI3K/AKT signaling pathway in HG-induced HK-2 cells
- CTRP9 protects against MIA-induced inflammation and knee cartilage damage by deactivating the MAPK/NF-κB pathway in rats with osteoarthritis
- Relationship between hemodynamic parameters and portal venous pressure in cirrhosis patients with portal hypertension
- Long noncoding RNA FTX ameliorates hydrogen peroxide-induced cardiomyocyte injury by regulating the miR-150/KLF13 axis
- Ropivacaine inhibits proliferation, migration, and invasion while inducing apoptosis of glioma cells by regulating the SNHG16/miR-424-5p axis
- CD11b is involved in coxsackievirus B3-induced viral myocarditis in mice by inducing Th17 cells
- Decitabine shows anti-acute myeloid leukemia potential via regulating the miR-212-5p/CCNT2 axis
- Testosterone aggravates cerebral vascular injury by reducing plasma HDL levels
- Bioengineering and Biotechnology
- PL/Vancomycin/Nano-hydroxyapatite Sustained-release Material to Treat Infectious Bone Defect
- The thickness of surface grafting layer on bio-materials directly mediates the immuno-reacitivity of macrophages in vitro
- Silver nanoparticles: synthesis, characterisation and biomedical applications
- Food Science
- Bread making potential of Triticum aestivum and Triticum spelta species
- Modeling the effect of heat treatment on fatty acid composition in home-made olive oil preparations
- Effect of addition of dried potato pulp on selected quality characteristics of shortcrust pastry cookies
- Preparation of konjac oligoglucomannans with different molecular weights and their in vitro and in vivo antioxidant activities
- Animal Sciences
- Changes in the fecal microbiome of the Yangtze finless porpoise during a short-term therapeutic treatment
- Agriculture
- Influence of inoculation with Lactobacillus on fermentation, production of 1,2-propanediol and 1-propanol as well as Maize silage aerobic stability
- Application of extrusion-cooking technology in hatchery waste management
- In-field screening for host plant resistance to Delia radicum and Brevicoryne brassicae within selected rapeseed cultivars and new interspecific hybrids
- Studying of the promotion mechanism of Bacillus subtilis QM3 on wheat seed germination based on β-amylase
- Rapid visual detection of FecB gene expression in sheep
- Effects of Bacillus megaterium on growth performance, serum biochemical parameters, antioxidant capacity, and immune function in suckling calves
- Effects of center pivot sprinkler fertigation on the yield of continuously cropped soybean
- Special Issue On New Approach To Obtain Bioactive Compounds And New Metabolites From Agro-Industrial By-Products
- Technological and antioxidant properties of proteins obtained from waste potato juice
- The aspects of microbial biomass use in the utilization of selected waste from the agro-food industry
- Special Issue on Computing and Artificial Techniques for Life Science Applications - Part I
- Automatic detection and segmentation of adenomatous colorectal polyps during colonoscopy using Mask R-CNN
- The impedance analysis of small intestine fusion by pulse source
- Errata
- Erratum to “Diagnostic performance of serum CK-MB, TNF-α and hs-CRP in children with viral myocarditis”
- Erratum to “MYL6B drives the capabilities of proliferation, invasion, and migration in rectal adenocarcinoma through the EMT process”
- Erratum to “Thermostable cellulase biosynthesis from Paenibacillus alvei and its utilization in lactic acid production by simultaneous saccharification and fermentation”
Articles in the same Issue
- Plant Sciences
- Dependence of the heterosis effect on genetic distance, determined using various molecular markers
- Plant Growth Promoting Rhizobacteria (PGPR) Regulated Phyto and Microbial Beneficial Protein Interactions
- Role of strigolactones: Signalling and crosstalk with other phytohormones
- An efficient protocol for regenerating shoots from paper mulberry (Broussonetia papyrifera) leaf explants
- Functional divergence and adaptive selection of KNOX gene family in plants
- In silico identification of Capsicum type III polyketide synthase genes and expression patterns in Capsicum annuum
- In vitro induction and characterisation of tetraploid drumstick tree (Moringa oleifera Lam.)
- CRISPR/Cas9 or prime editing? – It depends on…
- Study on the optimal antagonistic effect of a bacterial complex against Monilinia fructicola in peach
- Natural variation in stress response induced by low CO2 in Arabidopsis thaliana
- The complete mitogenome sequence of the coral lily (Lilium pumilum) and the Lanzhou lily (Lilium davidii) in China
- Ecology and Environmental Sciences
- Use of phosphatase and dehydrogenase activities in the assessment of calcium peroxide and citric acid effects in soil contaminated with petrol
- Analysis of ethanol dehydration using membrane separation processes
- Activity of Vip3Aa1 against Periplaneta americana
- Thermostable cellulase biosynthesis from Paenibacillus alvei and its utilization in lactic acid production by simultaneous saccharification and fermentation
- Spatiotemporal dynamics of terrestrial invertebrate assemblages in the riparian zone of the Wewe river, Ashanti region, Ghana
- Antifungal activity of selected volatile essential oils against Penicillium sp.
- Toxic effect of three imidazole ionic liquids on two terrestrial plants
- Biosurfactant production by a Bacillus megaterium strain
- Distribution and density of Lutraria rhynchaena Jonas, 1844 relate to sediment while reproduction shows multiple peaks per year in Cat Ba-Ha Long Bay, Vietnam
- Biomedical Sciences
- Treatment of Epilepsy Associated with Common Chromosomal Developmental Diseases
- A Mouse Model for Studying Stem Cell Effects on Regeneration of Hair Follicle Outer Root Sheaths
- Morphine modulates hippocampal neurogenesis and contextual memory extinction via miR-34c/Notch1 pathway in male ICR mice
- Composition, Anticholinesterase and Antipedicular Activities of Satureja capitata L. Volatile Oil
- Weight loss may be unrelated to dietary intake in the imiquimod-induced plaque psoriasis mice model
- Construction of recombinant lentiviral vector containing human stem cell leukemia gene and its expression in interstitial cells of cajal
- Knockdown of lncRNA KCNQ1OT1 inhibits glioma progression by regulating miR-338-3p/RRM2
- Protective effect of asiaticoside on radiation-induced proliferation inhibition and DNA damage of fibroblasts and mice death
- Prevalence of dyslipidemia in Tibetan monks from Gansu Province, Northwest China
- Sevoflurane inhibits proliferation, invasion, but enhances apoptosis of lung cancer cells by Wnt/β-catenin signaling via regulating lncRNA PCAT6/ miR-326 axis
- MiR-542-3p suppresses neuroblastoma cell proliferation and invasion by downregulation of KDM1A and ZNF346
- Calcium Phosphate Cement Causes Nucleus Pulposus Cell Degeneration Through the ERK Signaling Pathway
- Human Dental Pulp Stem Cells Exhibit Osteogenic Differentiation Potential
- MiR-489-3p inhibits cell proliferation, migration, and invasion, and induces apoptosis, by targeting the BDNF-mediated PI3K/AKT pathway in glioblastoma
- Long non-coding RNA TUG1 knockdown hinders the tumorigenesis of multiple myeloma by regulating the microRNA-34a-5p/NOTCH1 signaling pathway
- Large Brunner’s gland adenoma of the duodenum for almost 10 years
- Neurotrophin-3 accelerates reendothelialization through inducing EPC mobilization and homing
- Hepatoprotective effects of chamazulene against alcohol-induced liver damage by alleviation of oxidative stress in rat models
- FXYD6 overexpression in HBV-related hepatocellular carcinoma with cirrhosis
- Risk factors for elevated serum colorectal cancer markers in patients with type 2 diabetes mellitus
- Effect of hepatic sympathetic nerve removal on energy metabolism in an animal model of cognitive impairment and its relationship to Glut2 expression
- Progress in research on the role of fibrinogen in lung cancer
- Advanced glycation end product levels were correlated with inflammation and carotid atherosclerosis in type 2 diabetes patients
- MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB
- Knockdown of DDX46 inhibits trophoblast cell proliferation and migration through the PI3K/Akt/mTOR signaling pathway in preeclampsia
- Buformin suppresses osteosarcoma via targeting AMPK signaling pathway
- Effect of FibroScan test in antiviral therapy for HBV-infected patients with ALT <2 upper limit of normal
- LncRNA SNHG15 regulates osteosarcoma progression in vitro and in vivo via sponging miR-346 and regulating TRAF4 expression
- LINC00202 promotes retinoblastoma progression by regulating cell proliferation, apoptosis, and aerobic glycolysis through miR-204-5p/HMGCR axis
- Coexisting flavonoids and administration route effect on pharmacokinetics of Puerarin in MCAO rats
- GeneXpert Technology for the diagnosis of HIV-associated tuberculosis: Is scale-up worth it?
- Circ_001569 regulates FLOT2 expression to promote the proliferation, migration, invasion and EMT of osteosarcoma cells through sponging miR-185-5p
- Lnc-PICSAR contributes to cisplatin resistance by miR-485-5p/REV3L axis in cutaneous squamous cell carcinoma
- BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells
- MYL6B drives the capabilities of proliferation, invasion, and migration in rectal adenocarcinoma through the EMT process
- Inhibition of lncRNA LINC00461/miR-216a/aquaporin 4 pathway suppresses cell proliferation, migration, invasion, and chemoresistance in glioma
- Upregulation of miR-150-5p alleviates LPS-induced inflammatory response and apoptosis of RAW264.7 macrophages by targeting Notch1
- Long non-coding RNA LINC00704 promotes cell proliferation, migration, and invasion in papillary thyroid carcinoma via miR-204-5p/HMGB1 axis
- Neuroanatomy of melanocortin-4 receptor pathway in the mouse brain
- Lipopolysaccharides promote pulmonary fibrosis in silicosis through the aggravation of apoptosis and inflammation in alveolar macrophages
- Influences of advanced glycosylation end products on the inner blood–retinal barrier in a co-culture cell model in vitro
- MiR-4328 inhibits proliferation, metastasis and induces apoptosis in keloid fibroblasts by targeting BCL2 expression
- Aberrant expression of microRNA-132-3p and microRNA-146a-5p in Parkinson’s disease patients
- Long non-coding RNA SNHG3 accelerates progression in glioma by modulating miR-384/HDGF axis
- Long non-coding RNA NEAT1 mediates MPTP/MPP+-induced apoptosis via regulating the miR-124/KLF4 axis in Parkinson’s disease
- PCR-detectable Candida DNA exists a short period in the blood of systemic candidiasis murine model
- CircHIPK3/miR-381-3p axis modulates proliferation, migration, and glycolysis of lung cancer cells by regulating the AKT/mTOR signaling pathway
- Reversine and herbal Xiang–Sha–Liu–Jun–Zi decoction ameliorate thioacetamide-induced hepatic injury by regulating the RelA/NF-κB/caspase signaling pathway
- Therapeutic effects of coronary granulocyte colony-stimulating factor on rats with chronic ischemic heart disease
- The effects of yam gruel on lowering fasted blood glucose in T2DM rats
- Circ_0084043 promotes cell proliferation and glycolysis but blocks cell apoptosis in melanoma via circ_0084043-miR-31-KLF3 axis
- CircSAMD4A contributes to cell doxorubicin resistance in osteosarcoma by regulating the miR-218-5p/KLF8 axis
- Relationship of FTO gene variations with NAFLD risk in Chinese men
- The prognostic and predictive value of platelet parameters in diabetic and nondiabetic patients with sudden sensorineural hearing loss
- LncRNA SNHG15 contributes to doxorubicin resistance of osteosarcoma cells through targeting the miR-381-3p/GFRA1 axis
- miR-339-3p regulated acute pancreatitis induced by caerulein through targeting TNF receptor-associated factor 3 in AR42J cells
- LncRNA RP1-85F18.6 affects osteoblast cells by regulating the cell cycle
- MiR-203-3p inhibits the oxidative stress, inflammatory responses and apoptosis of mice podocytes induced by high glucose through regulating Sema3A expression
- MiR-30c-5p/ROCK2 axis regulates cell proliferation, apoptosis and EMT via the PI3K/AKT signaling pathway in HG-induced HK-2 cells
- CTRP9 protects against MIA-induced inflammation and knee cartilage damage by deactivating the MAPK/NF-κB pathway in rats with osteoarthritis
- Relationship between hemodynamic parameters and portal venous pressure in cirrhosis patients with portal hypertension
- Long noncoding RNA FTX ameliorates hydrogen peroxide-induced cardiomyocyte injury by regulating the miR-150/KLF13 axis
- Ropivacaine inhibits proliferation, migration, and invasion while inducing apoptosis of glioma cells by regulating the SNHG16/miR-424-5p axis
- CD11b is involved in coxsackievirus B3-induced viral myocarditis in mice by inducing Th17 cells
- Decitabine shows anti-acute myeloid leukemia potential via regulating the miR-212-5p/CCNT2 axis
- Testosterone aggravates cerebral vascular injury by reducing plasma HDL levels
- Bioengineering and Biotechnology
- PL/Vancomycin/Nano-hydroxyapatite Sustained-release Material to Treat Infectious Bone Defect
- The thickness of surface grafting layer on bio-materials directly mediates the immuno-reacitivity of macrophages in vitro
- Silver nanoparticles: synthesis, characterisation and biomedical applications
- Food Science
- Bread making potential of Triticum aestivum and Triticum spelta species
- Modeling the effect of heat treatment on fatty acid composition in home-made olive oil preparations
- Effect of addition of dried potato pulp on selected quality characteristics of shortcrust pastry cookies
- Preparation of konjac oligoglucomannans with different molecular weights and their in vitro and in vivo antioxidant activities
- Animal Sciences
- Changes in the fecal microbiome of the Yangtze finless porpoise during a short-term therapeutic treatment
- Agriculture
- Influence of inoculation with Lactobacillus on fermentation, production of 1,2-propanediol and 1-propanol as well as Maize silage aerobic stability
- Application of extrusion-cooking technology in hatchery waste management
- In-field screening for host plant resistance to Delia radicum and Brevicoryne brassicae within selected rapeseed cultivars and new interspecific hybrids
- Studying of the promotion mechanism of Bacillus subtilis QM3 on wheat seed germination based on β-amylase
- Rapid visual detection of FecB gene expression in sheep
- Effects of Bacillus megaterium on growth performance, serum biochemical parameters, antioxidant capacity, and immune function in suckling calves
- Effects of center pivot sprinkler fertigation on the yield of continuously cropped soybean
- Special Issue On New Approach To Obtain Bioactive Compounds And New Metabolites From Agro-Industrial By-Products
- Technological and antioxidant properties of proteins obtained from waste potato juice
- The aspects of microbial biomass use in the utilization of selected waste from the agro-food industry
- Special Issue on Computing and Artificial Techniques for Life Science Applications - Part I
- Automatic detection and segmentation of adenomatous colorectal polyps during colonoscopy using Mask R-CNN
- The impedance analysis of small intestine fusion by pulse source
- Errata
- Erratum to “Diagnostic performance of serum CK-MB, TNF-α and hs-CRP in children with viral myocarditis”
- Erratum to “MYL6B drives the capabilities of proliferation, invasion, and migration in rectal adenocarcinoma through the EMT process”
- Erratum to “Thermostable cellulase biosynthesis from Paenibacillus alvei and its utilization in lactic acid production by simultaneous saccharification and fermentation”