Abstract
Oil reservoirs contain large amounts of hydrocarbon rich produced water, trapped in underground channels. Focus of this study was isolation of PHA producers from produced water concomitant with optimization of production using animal fat and glycerol as carbon source. Bacterial strains were identified as Bacillus subtilis (PWA), Pseudomonas aeruginosa (PWC), Bacillus tequilensis (PWF), and Bacillus safensis (PWG) based on 16S rRNA gene sequencing. Similar amounts of PHA were obtained using animal fat and glycerol in comparison to glucose. After 24 h, high PHA production on glycerol and animal fat was shown by strain PWC (5.2 g/ L, 6.9 g/ L) and strain PWF (12.4 g/ L, 14.2 g/ L) among all test strains. FTIR analysis of PHA showed 3-hydroxybutyrate units. The capability to produce PHA in the strains was corroborated by PhaC synthase gene sequencing. Focus of future studies can be the use of lipids and glycerol on industrial scale.
1 Introduction
Oil field operations produce large amount of waste during oil production. Most common waste is produced water accounting for almost 98% of fluid waste. Produced water is composed mainly of hydrocarbons especially phenols, polycyclic aromatic compounds, treating chemicals, radionuclides, dissolved oxygen and dispersed oil (1,2). Overall, produced water has high carbon content and low nitrogen content, which makes it a selective habitat of many microorganisms that thrive in conditions of extreme environmental stress (3). These microorganisms include polyhydroxyalkanoate-producing bacteria, which require stressful and limiting conditions of nutrients, i.e. surplus carbon content and low nitrogen, magnesium and phosphorous content for their successful growth (4). Moreover, PHA producers thrive by conversion of hydrocarbons in produced water to carbon reserves – in form of inclusion bodies.
Polyhydroxyalkanoates (PHAs) are such inclusion bodies – used mainly as storage or energy reserves by the cell (5). These bio-polyesters are biodegradable as well as biocompatible (6). Most common PHAs, to date, are polyhydroxybutyrate (PHB) (7), produced by many bacterial genera including Pseudomonas, Bacillus, Alcaligenes, Rhodococcus, Agrobcterium, Comamonas, Hydrogenophaga, Ralstonia etc. (8). Approximately 150 types of PHA monomers have been reported (9). The properties of PHAs are strongly dependent on their monomeric composition and structures. Incorporation of specific monomers tend to enhance stability (10). Classification of PHA, based on monomeric structure, divides them into short chain length PHA (scl PHA), medium chain length PHA (mcl PHA) and long chain length PHA (lcl PHA) units (11). Scl PHA, ranging from C3 to C5, include 3-hydroxypropionate, 3-hydroxyvalerate etc. are produced mainly by Ralstonia and Alcaligenes species. Mcl PHA, ranging from C6 to C14, include 3-hydroxyhexanoate, 3-hydroxytetradecanoate etc. are produced mainly by Pseudomonas species. Whereas lcl PHA have >C14 PHA units (6). Some bacteria also produce copolymers of PHA (10,12). The chemical composition of PHA also depends on its biosynthetic pathway (13). There are four main classes of PHA synthases. However, the main enzyme needed for PHA production is PhaC synthase. Composition of PhaC synthase varies from species to species accounting for differences in PHA structure and composition (14). There are three main pathways of PHA production, i.e. the acetoacetyl-CoA pathway (for conversion of amino acids to mcl PHA), in situ fatty acid synthesis (for conversion of fatty acids to mcl PHA) and beta-oxidation cycles (for conversion of sugars to scl-PHA) (15,16). Polyhydroxyalkanoates produced by produced water bacteria are mostly mcl PHA, produced mainly by Pseudomonas and Bacillus spp. (10).
Polyhydroxyalkanoates (PHA) are biodegradable plastics that have the potential to effectively replace conventional synthetic and petrochemical-based plastics (6). The biodegradability of PHAs is the main property that is exploited in all commercial ventures (14), i.e. use as packaging material, agricultural implements and in surgical fields (6,9). Commercialization of PHA depends upon their successful production using low cost, effective practices (17). Production costs have to be reduced to the extent that the process is feasible. About 40-60%, production costs are concerned only with raw materials (17). Some approaches include use of low cost resources (6,15), use of biomass as feedstock, use of organic wastes as carbon source (18,19), use of genetic manipulation and recombinant methodologies. Use of process control strategies has also been employed to increase PHA production (18,20). Recent studies have also focused on manipulating biosynthetic pathways of production either to increase production (21) or to produce novel product (17,22). Gedikli et al. reported production of thermostable PHB by Geobacillus kaustophilus (23).
Produced water is a major waste of oil drilling processes (1). It has high hydrocarbon carbon content and serves as habitat for plethora of microbiota that flourishes in extreme environment. This microbiota mainly bacteria break down complex hydrocarbons and produce important biopolymers. Polyhydroxyalkanoate producing bacteria use hydrocarbons present in produced water for bioconversion of fatty acids to mcl PHA (24). Present study was planned in two main phases having separate objectives. First objective of this study was to isolate bacterial strains from produced water with the capability to utilize hydrocarbons for biopolymers production such as polyhydroxyalkanoates. Thereby, use the surplus amounts of produced water in a way that has potential for environmental conservation and producing environment friendly biodegradable polymers (25). In the first phase, produced water samples were collected from Potwar oil fields, Pakistan. Polyhydroxyalkanoate producers were screened by growth on PHA detection media and further confirmation was done by sequencing of phaC and phaC1 gene. The bacterial strains with higher PHA production were identified as Bacillus subtilis (PWA), Bacillus tequilensis (PWF), Bacillus safensis (PWG) and Pseudomonas aeruginosa (PWC) by 16S rRNA sequencing. Second objective of this study was to optimize PHA production using hydrocarbon sources that are similar in complexity to those found in produced water but cheaper, renewable, structurally diverse, and non-fossil fuel based, i.e. animal fat (26) and glycerol (27). This optimization by mapping PHA production, in a sustainable manner, has potential for industrial scale studies by lowering production costs (28). In the second phase, bulk production and extraction of polyhydroxyalkanoates was assessed using three different non-fossil fuel based carbon sources, as initiative to reserve fossil fuel based sources and minimize production costs (29).
2 Materials and methods
2.1 Sample collection, isolation and identification of bacterial strains
Produced water samples were collected in plastic sterilized bottles from Potwar oil fields and stored at 4°C. Sample was appropriately analyzed for many parameters including temperature, pH, odor, texture, and color. Qualitative characterization of sample was based on methodologies reported by Openshaw (30) and Dey (31). Isolation of bacterial strains was performed according to serial dilution method, as described by James and Natalie [32], using Luria-Bertani Agar as seed medium. Viable cell counts were measured after 24 h incubation. Bacterial colonies with distinguishing features were selected from the mixed culture plates to obtain pure colonies. Preliminary identification of isolates was done by microscopic measurements of bacterial cell, gram staining, spore staining, capsule staining, catalase activity test, oxidase test, DNase test, starch hydrolysis test, citrate utilization test, motility test and urease activity test etc. (32,33). Genomic DNA was isolated as described by Sambrooke et al. (34). 16S rRNA gene sequencing of selected bacterial strains was done as commercial service by Macrogen Inc., Seoul, Korea, (https://dna.macrogen.com/eng/support/ces/guide/universal_primer.jsp). Forward and reverse sequences were provided separately. Reverse sequence was converted to complementary sequence with Chromas Pro 2.6.5 software (35). Forward and reverse sequences were aligned and assembled to obtain consensus sequence using Cap3 software (36). Sequences were inspected for maximum homology against GenBank using BlastN (37). Phylogenetic trees were constructed for sequences using MEGA4 by neighbor joining method (38).
2.2 Screening of polyhydroxyalkanoate (PHA) producers
Isolated bacterial strains were screened for PHA production ability by using PHA detection media (39) agar plates (40) supplemented with Nile blue A (41, 42, 43, 44) or Nile red (45, 46, 47) for direct screening. After 24 h incubation, all plates were observed under UV light. Ability of strains to produce PHA was confirmed by staining of screened colonies with Sudan black B dye to visualize PHA granules (43). After direct screening and staining, PHA production was further verified by culturing selected strains on PHA detection media supplemented with Nile blue (42).
2.3 Optimization of polyhydroxyalkanoate (PHA) production
Three unrelated carbon sources namely glucose, glycerol and animal fat oil were used for optimization of PHA production. Glucose was selected as a monomeric, easily available carbon source, to compare production kinetics (48). Glucose solution was prepared and autoclaved for sterilization. Glycerol and animal fat oil were selected as biochemically, structurally complex carbon sources (49,50). Waste glycerol, an industrial byproduct, was collected and sterilized by autoclaving. Animal fat oil was extracted by heating animal fat (51). The residue obtained was decanted and filtered to obtain oil. Each carbon source was used in 2% v/v concentration in one liter of PHA detection media. Growth kinetic studies of PHA producers conducted in 500 mL flasks containing 300 mL PHA detection media supplemented with 2% carbon source (glucose, glycerol or animal fat oil), were repeated three times, to obtain mean values. Culture densities were recorded at 600 nm using spectrophotometer (52).
2.4 Polyhydroxyalkanoate (PHA) extraction
Culture broth was collected and centrifuged at 4000 rpm for 15 min. Supernatant was discarded and tubes containing biomass pellet were placed at −4°C overnight. Dry pellet was obtained by lyophilizing at 0.011 mbar and −60°C and dry cell weight (biomass) was weighed. Pellet was treated with 0.25% SDS at 25°C and pH 10 for 15 min, followed by treatment with 5.25% sodium hypochlorite at room temperature and pH 10 for 5 min. Mixture was centrifuged; pellet was washed with acetone and centrifuged again. Crude PHA pellet was suspended in chloroform (10 times the volume of pellet) to dissolve PHA and incubated for 48 h at room temperature. After incubation, PHA layer was separated by filtration. Chloroform was dried by evaporation and weight of dried PHA films was measured in grams (53). Percentage of PHA (% PHA) was calculated as follows:
Timely variations in culture densities, biomass, and PHA production were recorded, over a period of 96 h, in triplicate studies. Standard error for mean values was calculated.
2.5 Fourier transform infrared (FT-IR) spectroscopy
Fourier transform infrared (FT-IR) spectroscopic analysis of extracted PHA samples was conducted (54,55), to identify the functional groups and to record PHA spectrum around scan range 400 to 4000 cm−1, at Research Centre, Lahore Women’s University.
2.6 Molecular analysis of synthase gene
Polyhydroxyalkanoate synthase gene was amplified using F-gen (CCGCAATTGAACAAGTTCTACCT) and R-gen (CGGGAGACGCGTGGTGTCGTTG) primers by PCR (56). Initial denaturation was at 95°C for 10 min. Final extension was at 72°C for 10 min. PCR was run for 35 cycles. Each cycle consisted of denaturation at 95°C for 45 s, annealing at 60.7°C for 45 s and extension at 72°C for 1 min. Amplicons were sequenced by Sanger dideoxy sequencing. Partial sequences of PHA synthase genes, phaC and phaC1 were inspected for maximum homology using BlastN and submitted to GenBank under accession numbers MH384823 to MH384825 and MH400895. Sequences were translated using ExPASy to determine reading frames. Translated sequences were aligned with similar sequences by using BioEdit 7.2.6 software to corroborate biological PHA production capability. Sequences were also analyzed for determination of conserved domains against NCBI conserved domain database (57,58).
3 Results
3.1 Sample collection, isolation and identification of bacterial strains
Produced water sample had light brown color, diesel like smell and oily texture. Temperature and pH of sample were noted as 27°C and 6.0, respectively. Positive results for qualitative characterization of sample were obtained indicating the presence of nitrogen, halogens, sulfur, lipids, aldehydes, alcohols, phenols, carboxylic acids, and dissolved carbon dioxide. Bacterial colony forming unit of each dilution of sample was calculated and was observed as highest in dilution 10−1, which had 263 discrete colonies. Out of thirteen bacterial isolates, eleven were gram-positive rods (Figure 1a), while remaining two were gram-negative rod (Figure 1b) and gram-positive cocci (Figure 1c). According to morphological and biochemical characterization results, these isolates belong to genus Pseudomonas, Bacillus and Rhodococcus (Supplementary data Table 1). Strains PWA, PWC, PWF, and PWG were identified as Bacillus subtilis (MH142143), Pseudomonas aeruginosa (MH142144), Bacillus tequilensis (MH142145) and Bacillus safensis (MH142146) respectively by 16S rRNA gene sequencing (Table 1). Strain PWA was identified as Bacillus subtilis (MH142143) as it showed 100% homology to Bacillus subtilis (MG434569.1). Strain PWC, identified as Pseudomonas aeruginosa (MH142144), showed 99% homology to Pseudomonas aeruginosa (MG818964.1). Strain PWF showed 99% homology to Bacillus tequilensis (MF521563.1) and was identified as Bacillus tequilensis (MH142145), whereas strain PWG identified as Bacillus safensis (MH142146) showed 99% homology to Bacillus safensis (MG432700.1).

Gram staining micrograph of (a) Bacillus subtilis shows gram-positive bacilli in chains. (b) Pseudomonas aeruginosa shows gram-negative bacilli. (c) Rhodococcus shows gram-positive cocci.
PHA producing bacteria isolated from Potwar oil field produced water.
| Strain name | GenBank accession number | Closest related classified organism | Sequence similarity (%) |
|---|---|---|---|
| PWA | MH142143 | Bacillus subtilis (MG434569.1) | 100% |
| PWC | MH142144 | Pseudomonas aeruginosa (MG818964.1) | 100% |
| PWF | MH142145 | Bacillus tequilensis (MF521563.1) | 99% |
| PWG | MH142146 | Bacillus safensis (MG432700.1) | 99% |
3.2 Screening of polyhydroxyalkanoate (PHA) producers
Bacterial strains were screened for PHA production and six out of thirteen were found positive. These six strains gave fluorescence on Nile blue and Nile red supplemented PHA detection media. On Nile blue A supplemented plates, blue fluorescence was observed (Figures 2a and 2b) while on Nile red supplemented plates; green fluorescence was observed, due to binding of dye molecules to PHA granules (Figure 2c). On Sudan Black B staining of these strains, black granules of PHA were observed against pink background (Figure 2d). Results for verification of PHA production indicated strains PWF and PWC as the most potent PHA producing bacteria.

PHA production in live cells and under light microscope. (a,b) Screening on Nile blue containing PHA detection media demonstrates blue fluorescence under UV light by Bacillus subtilis and Bacillus tequilensis respectively. (c) Screening on Nile red containing PHA detection media demonstrates green fluorescence under UV light by Pseudomonas aeruginosa. (d) Sudan Black B staining micrograph of Bacillus subtilis shows presence of PHA granules (as indicated by arrows).
3.3 Kinetics of polyhydroxyalkanoate (PHA) production
All strains showed highest growth on glucose, followed by growth on animal fat oil. While lowest growth was observed on glycerol (Supplementary material – Figure S1). Strain PWA (MH142143) showed almost similar growth rates on PHA detection media supplemented with glucose, glycerol, or animal fat oil. Strain PWC (MH142144) and PWF (MH142145) showed higher growth rates on animal fat oil, followed closely by growth rates on glycerol supplemented PHA detection media. However, growth rates on all carbon sources were almost same up to 48 h. Strain PWG (MH142146) showed higher growth rate on glycerol, but comparatively lower growth rates on animal fat oil. PHA production rates on animal fat oil followed closely. PHA production by PWA and PWG increased exponentially. PHA productions by PWA on glycerol and animal fat oil after 24 h were 4.6 g/L (11%) and 4.0 g/L (9%), respectively. PHA productions by PWG on glycerol and animal fat oil after 24 h were 6.4 g/L (27%) and 6.1 g/L (27%), respectively. Highest PHA production was shown by PWF (as shown in Figure 3) followed by PWC (as shown in Figure 4). After 24 h of incubation, PWC and PWF showed 5.2 g/ L (15%) and 12.4 g/L (32%) production on glycerol, respectively. Polyhydroxyalkanoate production by PWF on glycerol increased exponentially and was highest (49.4 g/L; 42%) after 96 h. Polyhydroxyalkanoate production by PWC (MH142144; Pseudomonas aeruginosa) increased exponentially from 24 h mark. Mapping production statistics showed 8.7 g/L (17%), 14.8 g/L (20%) and 27.9 g/L (26%) production by PWC and 22.3 g/ L (36%), 32.4 g/L (37%) and 49.4 g/L (42%) production by PWF, after 48, 72, and 96 h, respectively. PHA production, after 24 h, on animal fat oil by PWC was 6.9 g/ L (20%). Highest PHA production (14.2 g/L; 40%) by strain PWF was on animal fat oil after 24 h. After 24 h, percentage PHA decreased gradually. PHA production on animal fat oil resulted in 10.4 g/L (18%), 16.2 g/L (22%) and 29.4 g/L (26%) production by PWC and 24.5 g/L (39%), 35.4 g/L (37%) and 42.1 g/ L (36%) production by PWF, after 48, 72 and 96 h, respectively.

PHA production by strain PWF (Bacillus tequilensis; MH142145). PHA production by strain PWF (Bacillus tequilensis; MH142145) was highest, after 96 h on glycerol and after 24 h on animal fat oil. Biomasses and percentage PHA plotted against time are the mean of values recorded, during triplicate experiment. Standard error was calculated.

PHA production by strain PWC (Pseudomonas aeruginosa; MH142144). PHA production by strain PWC (Pseudomonas aeruginosa; MH142144) on all carbon sources was highest after 96 h. Biomasses and percentage PHA plotted against time are the mean of values recorded, during triplicate experiment. Standard error was calculated.
3.4 FT-IR analysis of polyhydroxyalkanoate (PHA)
FT-IR spectroscopy results indicated PHA samples from Pseudomonas aeruginosa (see Figure 5) and Bacillus tequilensis (see Figure 6) having 3-hydroxybutyrate units, identifying PHA as polyhydroxybutyrate (PHB) (55). Absorption bands of 1720.53 cm−1 and 1721.50 cm−1 (reported to be PHA marker bands) were assigned to stretching vibrations of carbonyl (C = O) ester bond. FTIR spectrum absorption bands at 3582.62 cm−1 and 3744.86 cm−1 were assigned to hydroxyl group (OH). Absorption at 2929.92 cm−1 was assigned to lateral monomeric chains asymmetric CH2-CH3. Absorption at 1456.28 cm−1 was assigned to the intracellular amide (–CO–N–) II found in bacteria. Absorption peak at 1379.13 cm−1 was assigned to terminal CH3 groups. While absorption peaks at 1277.86 cm−1 and 1274.97 cm−1 were assigned to stretching vibrations of asymmetric C–O–C. Series of absorption bands from 605.66 cm−1 to 1101.3 cm−1 and 603.66 cm−1 to 1101.37 cm−1 were assigned to C–O and C–C stretching vibrations.

FTIR spectrum of PHA produced by strain PWC (Pseudomonas aeruginosa; MH142144) showing absorption band at 1720.53 cm−1 which is a reported PHA marker band (C=O bond).

FTIR spectrum of PHA produced by strain PWF (Bacillus tequilensis; MH142145) showing absorption band at 1721.50 cm−1 which is a reported PHA marker band (C=O bond).
3.5 Molecular analysis of synthase gene
PHA Synthase gene phaC of strains PWA (MH384823), PWF (MH384824), PWG (MH384825) showed 91% homology to Bacterium TERI PHA synthase (phaC) gene (GU196137.1). While phaC1 gene of strain PWC showed 100% homology to Pseudomonas aeruginosa PHA synthase (phaC1) gene (LT883143.1) (Table 2). Aligning of sequences using BioEdit 7.2.6 software determined presence of variable and constant regions in phaC and phaC1 genes. Presence of conserved domains in sequences determined against NCBI conserved sequence domain (57,58) indicated that strains PWA, PWC, PWF, and PWG contain conversed domains of N terminal of Poly-beta-hydroxybutyrate from nucleotide 2 to 502, 59 to 502, 1 to 504, and 36 to 505, respectively.
Sequencing of gene phaC in produced water isolates.
| Strain | GenBank accession number | Closest related classified organism | Gene | Group of PHA genes | Sequence similarity (%) |
|---|---|---|---|---|---|
| PWA | MH384823 | Bacterium TERI (GU196137.1) | phaC | Group IV | 91% |
| PWC | MH400895 | Pseudomonas aeruginosa | phaC1 | Group II | 100% |
| (LT883143.1) | |||||
| PWF | MH384824 | Bacterium TERI (GU196137.1) | phaC | Group IV | 91% |
| PWG | MH384825 | Bacterium TERI (GU196137.1) | phaC | Group IV | 91% |
4 Discussion
It is well known that produced water has high quantities of dissolved crude oil, petroleum and related hydrocarbons (1). This carbon rich composition also makes it an ideal environment for many polyhydroxyalkanoates producing bacterial species since PHA inclusion bodies are produced as energy reserves in the presence of high carbon content (2,59). In the current study, isolation of PHA producing bacteria from produced water presents significant two-fold results in environmental studies (60). Firstly, produced water was utilized for isolation of bacteria resulting in biological clean-up of environment (61). Secondly, these bacteria demonstrate the ability to produce large quantities of useful biopolymer PHA. Out of thirteen isolates, 46% were PHA producers. Among selected strains, PWC; Pseudomonas aeruginosa and PWF; Bacillus tequilensis were able to grow efficiently on PHA detection media supplemented with all carbon sources. Glucose, because of its monomeric composition provides a readily available, easily replenishable supply of carbon. Overall, highest growth rates were observed on glucose as it is easily accessible and bacteria can readily utilize it (48). In comparison, glycerol (49) and animal fat oil (50,51) were utilized as feedstock to reduce production costs. Glycerol is a main byproduct of biodiesel industry (62). While animal fat is the main agro-industrial waste. It was selected especially due to its complex hydrocarbon rich content, which provides an environment similar in composition to that of produced water. Use of animal fat oil verified the fatty acid biodegradative activity of isolated strains (50,51). Microbiota of produced water especially PHA producers can successfully degrade complex fatty acids and utilize catabolic byproducts as a carbon source (59). Thus, growth rates on animal fat oil were higher than growth rates on glucose. Lowest growth rates were observed on glycerol except by strain PWG. This is because glycerol is only catabolized into simple components by some microorganisms. Therefore, use of glycerol imparts an evolutionary and biodegradability advantage to these PHA producers due to bacterial selectivity for glycerol (49).
PHA production by bacterium PWA increased exponentially after 24 h on both glycerol (4.6 g/ L; 11%) and animal fat oil (4.0 g/ L; 9%). Mohapatra et al. reported 3.09 g/ L PHA production using different carbon and nitrogen compositions (63). Ray et al. reported 0.455 g/L PHA production by mixed Bacillus subtilis culture using crude glycerol (64). Mohandas et al. reported 2.54 ± 0.07 g/L PHA yield by Bacillus cereus using glycerol (65). Differences in production kinetics could be due to differences in metabolic activity of PHA synthase enzymes. PHA production by PWG remained almost same up to 96 h, although biomass increased exponentially. On glycerol and animal fat oil, production after 24 h was 6.4 g/ L (27%) and 6.1 g/ L (27%), respectively. Madhumathi et al. reported 6.41 g/ L PHA production after 48 h. Comparatively, PWG shows high production, which could be because of its selective ability to utilize glycerol efficiently (66).
Strain PWC produced 26% PHA after 96 h on both glycerol (27.9 g/L) and animal fat oil (29.4 g/L) (Figure 4). In a similar study, Abid et al. reported 50.27% PHA production by Pseudomonas aeruginosa using soybean oil (67). Gatea et al. reported 100 mg/L PHA production by Pseudomonas aeruginosa using waste cooking oil (68). Although both previous studies and this study use fatty acids for PHA production, bioconversion pathways for vegetable oil and animal fat oil could be different (24,69).
Polyhydroxyalkanoate production by strain PWF (MH142145; Bacillus tequilensis) was highest amongst all isolated strains (Figure 3). Moralejo-Garate et al. also reported high PHA production (80%) on glycerol by Bacillus tequilensis (70). High PHA production rates on glycerol could be due to increased enzymatic activity. Glycerol has been reported to enhance PHA production in Pseudomonas putida by Fontaine et al. (71) and in Cupriavidus eutrophus by Volova et al. (72). Chandani et al. reported 87% to 52% PHA production by Bacillus tequilensis (73). Reddy et al. reported 59% PHA production on fatty acid waste by Bacillus tequilensis (74). This comparative decrease in production could be due to exhaustion of fatty acids in media after initial burst of PHA bioconversion. It could be due to adaption of bacteria from carbon rich environment of produced water to limited carbon media. Oliveira et al. have reported effect on PHA production rates due to carbon exhaustion in media (75).
PHA samples of strains PWC (Figure 5) and PWF (Figure 6) were identified as polyhydroxybutyrate (PHB) due to presence of 3-hydroxybutyrate units. Absorption bands at 1720.53 cm−1 and 1721.50 cm−1 (reported PHA marker bands) were observed. Hassan et al. reported peaks for ester carbonyl group at 1721 cm−1 (76).
Strains PWA (MH142143), PWC (MH142144), PWF (MH142145), and PWG (MH142146) were identified as Bacillus subtilis, Pseudomonas aeruginosa, Bacillus tequilensis, and Bacillus safensis by 16S rRNA sequences (Table 1). PCR amplicons of PHA genes showed resemblance to phaC of PHA synthases Group IV and phaC1 of Group II (Table 2). Homology against conserved domains showed resemblance to N terminal of poly-beta-hydroxybutyrate polymerase (PhaC) (58).
PHA is a very significant product of microorganisms, having a plethora of advantages in environmental sectors as well as petroleum and biodiesel industries. Productions of high quantities of PHA are needed to replace their synthetic counterparts. High production of PHA over a wide range of renewable carbon sources such as animal fat oil, therefore, goes a long way to further their advantage over the fuel consuming production of their counterparts. Bacillus tequilensis and Pseudomonas aeruginosa isolated from produced water, in this study, can be used for high yield of PHA utilizing low cost resources and practices.
5 Conclusion
In this study, produced water was found to be a rich source for successful isolation of polyhydroxyalkanoate producing bacteria. Additionally, the use of cheap, readily renewable, non-fossil fuel based carbon sources, i.e. glycerol and animal fat for production optimization was explored, with significant results shown by bacterial strains PWC and PWF for PHA production. FTIR results and phaC gene sequences corroborated the capability to produce PHA by the analyzed bacterial strains. Future studies can focus on identifying other such carbon sources and designing strategies based on reducing cost of production. The potential of strains isolated in the current study can be explored for industrial scale studies defining a low cost, resource conserving innovative.
References
1 Igunnu E.T., Chen G.Z., Produced water treatment technologies. LCT, 2012, 9(3), 157-177.10.1093/ijlct/cts049Search in Google Scholar
2 Akob D.M., Cozzarelli I.M., Dunlap D.S., Rowan E.L., Lorah M.M., Organic and inorganic composition and microbiology of produced waters from Pennsylvania shale gas wells. Appl. Geochem., 2015, 60, 116-125.10.1016/j.apgeochem.2015.04.011Search in Google Scholar
3 Hashemi S.Z., Fooladi J., Ebrahimipour G., Khodayari S., Isolation and Identification of Crude Oil Degrading and Biosurfactant Producing Bacteria from the Oil-Contaminated Soils of Gachsaran. Appl. Food. Biotechnol., 2016, 3(2), 83-89.Search in Google Scholar
4 Elain A., Le Grand A., Corre Y.-M., Le Fellic M., Hachet N., Le Tilly V., et al., Valorisation of local agro-industrial processing waters as growth media for polyhydroxyalkanoates (PHA) production. Ind. Crop. Prod., 2016, 80, 1-5.10.1016/j.indcrop.2015.10.052Search in Google Scholar
5 Muhammadi S., Afzal M., Hameed S., Bacterial polyhydroxyalkanoates-eco-friendly next generation plastic: production, biocompatibility, biodegradation, physical properties and applications. Green Chem. Lett. Rev., 2015, 8(3-4), 56-77.10.1080/17518253.2015.1109715Search in Google Scholar
6 Povolo S., Romanelli M.G., Basaglia M., Ilieva V.I., Corti A., Morelli A., et al., Polyhydroxyalkanoate biosynthesis by Hydrogenophaga pseudoflava DSM1034 from structurally unrelated carbon sources. New Biotechnol., 2013, 30(6), 629-634.10.1016/j.nbt.2012.11.019Search in Google Scholar
7 Santhanam A., Sasidharan S., Microbial production of polyhydroxy alkanotes (PHA) from Alcaligens spp. and Pseudomonas oleovorans using different carbon sources. Afr. J. Biotechnol., 2010, 9(21), 3144-3150.Search in Google Scholar
8 Lee E.Y., Kang S.H., Choi C.Y., Biosynthesis of poly (3-hydroxybutyrate-co-3-hydroxyvalerate) by newly isolated Agrobacterium sp. SH-1 and GW-014 from structurally unrelated single carbon substrates. J. Ferment. Bioeng., 1995, 79(4), 328-334.10.1016/0922-338X(95)93990-2Search in Google Scholar
9 Shah Tejas V., Vasava Dilip V., A glimpse of biodegradable polymers and their biomedical applications. e-Polymers, 2019, 19(1), 385.10.1515/epoly-2019-0041Search in Google Scholar
10 Khosravi-Darani K., Mokhtari Z.-B., Amai T., Tanaka K., Microbial production of poly (hydroxybutyrate) from C 1 carbon sources. Appl. Microbiol. Biot., 2013, 97(4), 1407-1424.10.1007/s00253-012-4649-0Search in Google Scholar PubMed
11 Singh A., Mallick N., Enhanced production of SCL-LCL-PHA co- polymer by sludge-isolated Pseudomonas aeruginosa MTCC 7925. Lett. Appl. Microbiol., 2008, 46(3), 350-357.10.1111/j.1472-765X.2008.02323.xSearch in Google Scholar PubMed
12 Anjum A., Zuber M., Zia K.M., Noreen A., Anjum M.N., Tabasum S., Microbial production of polyhydroxyalkanoates (PHAs) and its copolymers: a review of recent advancements. Int. J. Biol. Macromol., 2016, 89, 161-174.10.1016/j.ijbiomac.2016.04.069Search in Google Scholar PubMed
13 Koller M., Vadlja D., Braunegg G., Atlić A., Horvat P., Formal-and high-structured kinetic process modelling and footprint area analysis of binary imaged cells: Tools to understand and optimize multistage-continuous PHA biosynthesis. EuroBiotech. J., 2017, 1(3), 203-211.10.24190/ISSN2564-615X/2017/03.01Search in Google Scholar
14 Pantazaki A.A., Papaneophytou C.P., Lambropoulou D.A., Simultaneous polyhydroxyalkanoates and rhamnolipids production by Thermus thermophilus HB8. AMB Express, 2011, 1(1), 17.10.1186/2191-0855-1-17Search in Google Scholar
15 Tsuge T., Metabolic improvements and use of inexpensive carbon sources in microbial production of polyhydroxyalkanoates. J. Biosci. Bioeng., 2002, 94(6), 579-584.10.1016/S1389-1723(02)80198-0Search in Google Scholar
16 Chen G.-Q., Jiang X.-R., Guo Y., Synthetic biology of microbes synthesizing polyhydroxyalkanoates (PHA). Synth. Syst. Biotechnol., 2016, 1(4), 236-242.10.1016/j.synbio.2016.09.006Search in Google Scholar
17 Mahishi L., Tripathi G., Rawal S., Poly (3-hydroxybutyrate) (PHB) synthesis by recombinant Escherichia coli harbouring Streptomyces aureofaciens PHB biosynthesis genes: effect of various carbon and nitrogen sources. Microbiol. Res., 2003, 158(1), 19-27.10.1078/0944-5013-00161Search in Google Scholar
18 Vargas A., Montaño L., Amaya R., Enhanced polyhydroxyalkanoate production from organic wastes via process control. Bioresource Technol., 2014, 156, 248-255.10.1016/j.biortech.2014.01.045Search in Google Scholar
19 Hassan M., Bakhiet E., Hussein H., Ali S., Statistical optimization studies for polyhydroxybutyrate (PHB) production by novel Bacillus subtilis using agricultural and industrial wastes. Int. J. Environ. Sci. Te., 2019, 16(7), 3497-3512.10.1007/s13762-018-1900-ySearch in Google Scholar
20 Porras M.A., Ramos F.D., Diaz M.S., Cubitto M.A., Villar M.A., Modeling the bioconversion of starch to P (HB-co-HV) optimized by experimental design using Bacillus megaterium BBST4 strain. Environ. Technol., 2019, 40(9), 1185-1202.10.1080/09593330.2017.1418436Search in Google Scholar
21 Dhangdhariya J.H., Dubey S., Trivedi H.B., Pancha I., Bhatt J.K., Dave B.P., et al., Polyhydroxyalkanoate from marine Bacillus megaterium using CSMCRI‘s Dry Sea Mix as a novel growth medium. Int. J. Biol. Macromol., 2015, 76, 254-261.10.1016/j.ijbiomac.2015.02.009Search in Google Scholar
22 Shi H., Shiraishi M., Shimizu K., Metabolic flux analysis for biosynthesis of poly (β-hydroxybutyric acid) in Alcaligenes eutrophus from various carbon sources. J. Ferment. Bioeng., 1997, 84(6), 579-587.10.1016/S0922-338X(97)81915-0Search in Google Scholar
23 Gedikli S., Çelik P.A., Demirbilek M., Mutlu M.B., Denkbaş E.B., Çabuk A., Experimental Exploration of Thermostable Poly (β-Hydroxybutyrates) by Geobacillus kaustophilus Using Box-Behnken Design. J. Polym. Environ., 2019, 27(2), 245-255.10.1007/s10924-018-1335-zSearch in Google Scholar
24 Magdouli S., Brar S.K., Blais J.-F., Tyagi R.D., How to direct the fatty acid biosynthesis towards polyhydroxyalkanoates production? Biomass Bioenerg., 2015, 74, 268-279.10.1016/j.biombioe.2014.12.017Search in Google Scholar
25 Kumar P., Ray S., Kalia V.C., Production of co-polymers of polyhydroxyalkanoates by regulating the hydrolysis of biowastes. Bioresource Technol., 2016, 200, 413-419.10.1016/j.biortech.2015.10.045Search in Google Scholar PubMed
26 Garcia N.H., Strazzera G., Frison N., Bolzonella D., Volatile Fatty Acids Production from Household Food Waste. Chem. Engineer. Trans., 2018, 64, 103-108.Search in Google Scholar
27 Burniol-Figols A., Varrone C., Daugaard A.E., Le S.B., Skiadas I.V., Gavala H. N., Polyhydroxyalkanoates (PHA) production from fermented crude glycerol: Study on the conversion of 1, 3-propanediol to PHA in mixed microbial consortia. Water Res., 2018, 128, 255-266.10.1016/j.watres.2017.10.046Search in Google Scholar PubMed
28 Koller M., Maršálek L., de Sousa Dias M.M., Braunegg G., Producing microbial polyhydroxyalkanoate (PHA) biopolyesters in a sustainable manner. New Biotechnol., 2017, 37, 24-38.10.1016/j.nbt.2016.05.001Search in Google Scholar PubMed
29 Cruz M.V., Freitas F., Paiva A., Mano F., Dionísio M., Ramos A.M., et al., Valorization of fatty acids-containing wastes and byproducts into short-and medium-chain length polyhydroxyalkanoates. New Biotechnol., 2016, 33(1), 206-215.10.1016/j.nbt.2015.05.005Search in Google Scholar PubMed
30 Openshaw H.T., A laboratory manual of qualitative organic analysis. At The University. Cambridge, 1948.Search in Google Scholar
31 Dey B., Raman M., Laboratory manual of organic chemistry. G. Srinivasachari and Sons, Madras, 1941.Search in Google Scholar
32 James C., Natalie S., Microbiology. A laboratory manual. Pearson Education, 2014.Search in Google Scholar
33 Harley J.P., Prescott L.M., Laboratory exercises in microbiology. McGraw-Hill, 2005.Search in Google Scholar
34 Sambrook J., Fritsch E.F., Maniatis T., Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, 1989.Search in Google Scholar
35 McCarthy C., Chromas: version 2.0. Technelysium PTY, Australia, 1996, 1(1), 39.Search in Google Scholar
36 Huang X., Madan A., CAP3: A DNA sequence assembly program. Genome Res., 1999, 9(9), 868-877.10.1101/gr.9.9.868Search in Google Scholar PubMed PubMed Central
37 Dumontier M., Hogue C.W., NBLAST: a cluster variant of BLAST for NxN comparisons. BMC Bioinformatics, 2002, 3(1), 13.10.1186/1471-2105-3-13Search in Google Scholar PubMed PubMed Central
38 Kumar S., Nei M., Dudley J., Tamura K., MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform., 2008, 9(4), 299-306.10.1093/bib/bbn017Search in Google Scholar PubMed PubMed Central
39 Rehman S., Jamil N., Husnain S., Screening of different contaminated environments for polyhydroxyalkanoates-producing bacterial strains. Biologia, 2007, 62(6), 650-656.10.2478/s11756-007-0144-ySearch in Google Scholar
40 Chaudhry W.N., Jamil N., Ali I., Ayaz M.H., Hasnain S., Screening for polyhydroxyalkanoate (PHA)-producing bacterial strains and comparison of PHA production from various inexpensive carbon sources. Ann. Microbiol., 2011, 61(3), 623-629.10.1007/s13213-010-0181-6Search in Google Scholar
41 Oshiki M., Satoh H., Mino T., Rapid quantification of polyhydroxyalkanoates (PHA) concentration in activated sludge with the fluorescent dye Nile blue A. Water Sci. Technol., 2011, 64(3), 747-753.10.2166/wst.2011.707Search in Google Scholar
42 Ostle A.-G., Holt J., Nile blue A as a fluorescent stain for poly-beta-hydroxybutyrate. Appl. Environ. Microb., 1982, 44(1), 238-241.10.1128/aem.44.1.238-241.1982Search in Google Scholar
43 Phanse N., Chincholikar A., Patel B., Rathore P., Vyas P., Patel M., Screening of PHA (poly hydroxyalkanoate) producing bacteria from diverse sources. IJB, 2011, 1, 27-32.Search in Google Scholar
44 Kitamura S., Doi Y., Staining method of poly (3-hydroxyalkanoic acids) producing bacteria by Nile blue. Biotechnol. Tech., 1994, 8(5), 345-350.10.1007/BF02428979Search in Google Scholar
45 Spiekermann P., Rehm B.H., Kalscheuer R., Baumeister D., Steinbüchel A., A sensitive, viable-colony staining method using Nile red for direct screening of bacteria that accumulate polyhydroxyalkanoic acids and other lipid storage compounds. Arch. Microbiol., 1999, 171(2), 73-80.10.1007/s002030050681Search in Google Scholar
46 Greenspan P., Mayer E.P., Fowler S.D., Nile red: a selective fluorescent stain for intracellular lipid droplets. J. Cell. Biol., 1985, 100(3), 965-973.10.1083/jcb.100.3.965Search in Google Scholar
47 Serafim L.S.S., Lemos P.C., Levantesi C., Tandoi V., Santos H., Reis M.A., Methods for detection and visualization of intracellular polymers stored by polyphosphate-accumulating microorganisms. J. Microbiol. Meth., 2002, 51(1), 1-18.10.1016/S0167-7012(02)00056-8Search in Google Scholar
48 Kim G.J., Lee I.Y., Yoon S.C., Shin Y.C., Park Y.H., Enhanced yield and a high production of medium-chain-length poly (3-hydroxyalkanoates) in a two-step fed-batch cultivation of Pseudomonas putida by combined use of glucose and octanoate. Enzyme Microb. Tech., 1997, 20(7), 500-505.10.1016/S0141-0229(96)00179-2Search in Google Scholar
49 Mothes G., Schnorpfeil C., Ackermann J.U., Production of PHB from crude glycerol. Eng. Life Sci., 2007, 7(5), 475-479.10.1002/elsc.200620210Search in Google Scholar
50 Ashby R., Foglia T., Poly (hydroxyalkanoate) biosynthesis from triglyceride substrates. Appl. Microbiol. Biot., 1998, 49(4), 431-437.10.1007/s002530051194Search in Google Scholar
51 Akiyama M., Taima Y., Doi Y., Production of poly (3-hydroxyalkanoates) by a bacterium of the genus Alcaligenes utilizing long-chain fatty acids. Appl. Microbiol. Biot., 1992, 37(6), 698-701.10.1007/BF00174830Search in Google Scholar
52 Teeka J., Imai T., Cheng X., Reungsang A., Higuchi T., Yamamoto K., et al., Screening of PHA-producing bacteria using biodiesel-derived waste glycerol as a sole carbon source. J. Water Environ. Tech., 2010, 8(4), 373-381.10.2965/jwet.2010.373Search in Google Scholar
53 Van Doan T., Hoi L.T., Phong T.H., Recovery of Poly (3-hydroxybutyrate) from Yangia sp. ND199 by Simple Digestion with sodium hypochlorite. Vietnam J. Sci. Technol., 2015, 53(6), 706.Search in Google Scholar
54 Shah K., FTIR analysis of polyhydroxyalkanoates by a locally isolated novel Bacillus sp. AS 3-2 from soil of Kadi region, North Gujarat, India. J. Biochem. Technol., 2012, 3(4), 380-383.Search in Google Scholar
55 Gumel A.M., Annuar M.S.M., Heidelberg T., Biosynthesis and characterization of polyhydroxyalkanoates copolymers produced by Pseudomonas putida Bet001 isolated from palm oil mill effluent. PLoS One, 2012, 7(9), e45214.10.1371/journal.pone.0045214Search in Google Scholar PubMed PubMed Central
56 Cameron S., Phenotypic and genotypic investigations into fluoroquinolone resistance in the genus Acinetobacter PhD thesis, University of Dundee, 2002.Search in Google Scholar
57 Metzker M.L., Caskey C.T., Polymerase chain reaction (PCR). eLS, 2009.10.1002/9780470015902.a0000998.pub2Search in Google Scholar
58 Marchler-Bauer A., Derbyshire M.K., Gonzales N.R., Lu S., Chitsaz F., Geer L.Y., et al., CDD: NCBI‘s conserved domain database. Nucleic Acids Res., 2014, 43(D1), D222-D226.10.1093/nar/gku1221Search in Google Scholar PubMed PubMed Central
59 Goudarztalejerdi A., Tabatabaei M., Eskandari M., Mowla D., Iraji A., Evaluation of bioremediation potential and biopolymer production of pseudomonads isolated from petroleum hydrocarbon-contaminated areas. Int. J. Environ. Sci. Te., 2015, 12(9), 2801-2808.10.1007/s13762-015-0779-0Search in Google Scholar
60 Rajagopalan R., Environmental studies: from crisis to cure. Oxford University Press, 2015.Search in Google Scholar
61 Kuppusamy S., Palanisami T., Megharaj M., Venkateswarlu K., Naidu R., Ex-situ remediation technologies for environmental pollutants: a critical perspective. Rev. Environ. Contam. T., 2016, 236.10.1007/978-3-319-20013-2_2Search in Google Scholar PubMed
62 Cavalheiro J.M., de Almeida M.C.M., Grandfils C., Da Fonseca M., Poly (3-hydroxybutyrate) production by Cupriavidus necator using waste glycerol. Process Biochem., 2009, 44(5), 509-515.10.1016/j.procbio.2009.01.008Search in Google Scholar
63 Mohapatra S., Mohanta P., Sarkar B., Daware A., Kumar C., Samantaray D., Production of polyhydroxyalkanoates (PHAs) by Bacillus strain isolated from waste water and its biochemical characterization. Proc. Natl. Acad. Sci. India. Sect. B. Biol. Sci., 2017, 87(2), 459-466.10.1007/s40011-015-0626-6Search in Google Scholar
64 Ray S., Sharma R., Kalia V.C., Co-utilization of crude glycerol and biowastes for producing polyhydroxyalkanoates. Indian J. Microbiol., 2018, 58(1), 33-38.10.1007/s12088-017-0702-0Search in Google Scholar PubMed PubMed Central
65 Mohandas S.P., Balan L., Jayanath G., Anoop B., Philip R., Cubelio S.S., et al., Biosynthesis and characterization of polyhydroxyalkanoate from marine Bacillus cereus MCCB 281 utilizing glycerol as carbon source. Int. J. Biol. Macromol., 2018, 119, 380-392.10.1016/j.ijbiomac.2018.07.044Search in Google Scholar PubMed
66 Madhumathi R., Muthukumar K., Velan M., Optimization of polyhydroxybutyrate production by Bacillus safensis EBT1. CLEAN-Soil Air Water, 2016, 44(8), 1066-1074.10.1002/clen.201500163Search in Google Scholar
67 Abid S., Raza Z.A., Hussain T., Production kinetics of polyhydroxyalkanoates by using Pseudomonas aeruginosa gamma ray mutant strain EBN-8 cultured on soybean oil. 3 Biotech., 2016, 6(2), 142.10.1007/s13205-016-0452-4Search in Google Scholar PubMed PubMed Central
68 Gatea I.H., Haider N.H., Khudair S.H., Bioplastic (Poly-3-Hydroxybutyrate) production by local Pseudomonas aeruginosa isolates utilizing waste cooking oil. World J. Pharm. Res., 2017, 6(8), DOI:10.20959/wjpr20178-8631.10.20959/wjpr20178-8631Search in Google Scholar
69 Jimenez-Diaz L., Caballero A., Segura A., Pathways for the Degradation of Fatty Acids in Bacteria. Aerobic Utilization of Hydrocarbons, Oils and Lipids, 2017.10.1007/978-3-319-39782-5_42-1Search in Google Scholar
70 Moralejo-Gárate H., Mar’atusalihat E., Kleerebezem R., van Loosdrecht M.C., Microbial community engineering for biopolymer production from glycerol. Appl. Microbiol. Biot., 2011, 92(3), 631-639.10.1007/s00253-011-3359-3Search in Google Scholar PubMed
71 Fontaine P., Mosrati R., Corroler D., Medium chain length polyhydroxyalkanoates biosynthesis in Pseudomonas putida mt-2 is enhanced by co-metabolism of glycerol/octanoate or fatty acids mixtures. Int. J. Biol. Macromol., 2017, 98, 430-435.10.1016/j.ijbiomac.2017.01.115Search in Google Scholar PubMed
72 Volova T., Demidenko A., Kiselev E., Baranovskiy S., Shishatskaya E., Zhila N., Polyhydroxyalkanoate synthesis based on glycerol and implementation of the process under conditions of pilot production. Appl. Microbiol. Biot., 2019, 103(1), 225-237.10.1007/s00253-018-9460-0Search in Google Scholar PubMed
73 Chandani N., Mazumder P., Bhattacharjee A., Production of polyhydroxybutyrate (biopolymer) by Bacillus tequilensis NCS-3 isolated from municipal waste areas of Silchar, Assam. Int. J. Sci. Res., 2014, 3(12), 198-203.Search in Google Scholar
74 Reddy M.V., Amulya K., Rohit M., Sarma P., Mohan S.V., Valorization of fatty acid waste for bioplastics production using Bacillus tequilensis integration with dark-fermentative hydrogen production process. Int. J. Hydrogen Energ., 2014, 39(14), 7616-7626.10.1016/j.ijhydene.2013.09.157Search in Google Scholar
75 Oliveira C.S., Silva C.E., Carvalho G., Reis M.A., Strategies for efficiently selecting PHA producing mixed microbial cultures using complex feedstocks: Feast and famine regime and uncoupled carbon and nitrogen availabilities. New Biotechnol., 2017, 37, 69-79.10.1016/j.nbt.2016.10.008Search in Google Scholar PubMed
76 Hassan M.A., Bakhiet E.K., Ali S.G., Hussien H.R., Production and characterization of polyhydroxybutyrate (PHB) produced by Bacillus sp. isolated from Egypt. J. Appl. Pharm. Sci., 2016, 6(4), 46-51.10.7324/JAPS.2016.60406Search in Google Scholar
© 2020 Sohail et al., published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Regular Articles
- The regulatory effects of the number of VP(N-vinylpyrrolidone) function groups on macrostructure and photochromic properties of polyoxometalates/copolymer hybrid films
- How the hindered amines affect the microstructure and mechanical properties of nitrile-butadiene rubber composites
- Novel benzimidazole-based conjugated polyelectrolytes: synthesis, solution photophysics and fluorescent sensing of metal ions
- Study on the variation of rock pore structure after polymer gel flooding
- Investigation on compatibility of PLA/PBAT blends modified by epoxy-terminated branched polymers through chemical micro-crosslinking
- Investigation on degradation mechanism of polymer blockages in unconsolidated sandstone reservoirs
- Investigation on the effect of active-polymers with different functional groups for EOR
- Fabrication and characterization of hexadecyl acrylate cross-linked phase change microspheres
- Surface-induced phase transitions in thin films of dendrimer block copolymers
- ZnO-assisted coating of tetracalcium phosphate/ gelatin on the polyethylene terephthalate woven nets by atomic layer deposition
- Animal fat and glycerol bioconversion to polyhydroxyalkanoate by produced water bacteria
- Effect of microstructure on the properties of polystyrene microporous foaming material
- Synthesis of amphiphilic poly(ethylene glycol)-block-poly(methyl methacrylate) containing trityl ether acid cleavable junction group and its self-assembly into ordered nanoporous thin films
- On-demand optimize design of sound-absorbing porous material based on multi-population genetic algorithm
- Enhancement of mechanical, thermal and water uptake performance of TPU/jute fiber green composites via chemical treatments on fiber surface
- Enhancement of mechanical properties of natural rubber–clay nanocomposites through incorporation of silanated organoclay into natural rubber latex
- Preparation and characterization of corn starch/PVA/glycerol composite films incorporated with ε-polylysine as a novel antimicrobial packaging material
- Preparation of novel amphoteric polyacrylamide and its synergistic retention with cationic polymers
- Effect of montmorillonite on PEBAX® 1074-based mixed matrix membranes to be used in humidifiers in proton exchange membrane fuel cells
- Insight on the effect of a piperonylic acid derivative on the crystallization process, melting behavior, thermal stability, optical and mechanical properties of poly(l-lactic acid)
- Lipase-catalyzed synthesis and post-polymerization modification of new fully bio-based poly(hexamethylene γ-ketopimelate) and poly(hexamethylene γ-ketopimelate-co-hexamethylene adipate) copolyesters
- Dielectric, mechanical and thermal properties of all-organic PI/PSF composite films by in situ polymerization
- Morphological transition of amphiphilic block copolymer/PEGylated phospholipid complexes induced by the dynamic subtle balance interactions in the self-assembled aggregates
- Silica/polymer core–shell particles prepared via soap-free emulsion polymerization
- Antibacterial epoxy composites with addition of natural Artemisia annua waste
- Design and preparation of 3D printing intelligent poly N,N-dimethylacrylamide hydrogel actuators
- Multilayer-structured fibrous membrane with directional moisture transportability and thermal radiation for high-performance air filtration
- Reaction characteristics of polymer expansive jet impact on explosive reactive armour
- Synthesis of a novel modified chitosan as an intumescent flame retardant for epoxy resin
- Synthesis of aminated polystyrene and its self-assembly with nanoparticles at oil/water interface
- The synthesis and characterisation of porous and monodisperse, chemically modified hypercrosslinked poly(acrylonitrile)-based terpolymer as a sorbent for the adsorption of acidic pharmaceuticals
- Crystal transition and thermal behavior of Nylon 12
- All-optical non-conjugated multi-functionalized photorefractive polymers via ring-opening metathesis polymerization
- Fabrication of LDPE/PS interpolymer resin particles through a swelling suspension polymerization approach
- Determination of the carbonyl index of polyethylene and polypropylene using specified area under band methodology with ATR-FTIR spectroscopy
- Synthesis, electropolymerization, and electrochromic performances of two novel tetrathiafulvalene–thiophene assemblies
- Wetting behaviors of fluoroterpolymer fiber films
- Plugging mechanisms of polymer gel used for hydraulic fracture water shutoff
- Synthesis of flexible poly(l-lactide)-b-polyethylene glycol-b-poly(l-lactide) bioplastics by ring-opening polymerization in the presence of chain extender
- Sulfonated poly(arylene ether sulfone) functionalized polysilsesquioxane hybrid membranes with enhanced proton conductivity
- Fmoc-diphenylalanine-based hydrogels as a potential carrier for drug delivery
- Effect of diacylhydrazine as chain extender on microphase separation and performance of energetic polyurethane elastomer
- Improved high-temperature damping performance of nitrile-butadiene rubber/phenolic resin composites by introducing different hindered amine molecules
- Rational synthesis of silicon into polyimide-derived hollow electrospun carbon nanofibers for enhanced lithium storage
- Synthesis, characterization and properties of phthalonitrile-etherified resole resin
- Highly thermally conductive boron nitride@UHMWPE composites with segregated structure
- Synthesis of high-temperature thermally expandable microcapsules and their effects on foaming quality and surface quality of foamed ABS materials
- Tribological and nanomechanical properties of a lignin-based biopolymer
- Hydroxyapatite/polyetheretherketone nanocomposites for selective laser sintering: Thermal and mechanical performances
- Synthesis of a phosphoramidate flame retardant and its flame retardancy on cotton fabrics
- Preparation and characterization of thermoresponsive poly(N-isopropylacrylamide) copolymers with enhanced hydrophilicity
- Fabrication of flexible SiO2 nanofibrous yarn via a conjugate electrospinning process
- Silver-loaded carbon nanofibers for ammonia sensing
- Polar migration behavior of phosphonate groups in phosphonate esterified acrylic grafted epoxy ester composites and their role in substrate protection
- Solubility and diffusion coefficient of supercritical CO2 in polystyrene dynamic melt
- Curcumin-loaded polyvinyl butyral film with antibacterial activity
- Experimental-numerical studies of the effect of cell structure on the mechanical properties of polypropylene foams
- Experimental investigation on the three-dimensional flow field from a meltblowing slot die
- Enhancing tribo-mechanical properties and thermal stability of nylon 6 by hexagonal boron nitride fillers
- Preparation and characterization of electrospun fibrous scaffolds of either PVA or PVP for fast release of sildenafil citrate
- Seawater degradation of PLA accelerated by water-soluble PVA
- Review Article
- Mechanical properties and application analysis of spider silk bionic material
- Additive manufacturing of PLA-based scaffolds intended for bone regeneration and strategies to improve their biological properties
- Structural design toward functional materials by electrospinning: A review
- Special Issue: XXXII National Congress of the Mexican Polymer Society
- Tailoring the morphology of poly(high internal phase emulsions) synthesized by using deep eutectic solvents
- Modification of Ceiba pentandra cellulose for drug release applications
- Redox initiation in semicontinuous polymerization to search for specific mechanical properties of copolymers
- pH-responsive polymer micelles for methotrexate delivery at tumor microenvironments
- Microwave-assisted synthesis of the lipase-catalyzed ring-opening copolymerization of ε-caprolactone and ω-pentadecanolactone: Thermal and FTIR characterization
- Rapid Communications
- Pilot-scale production of polylactic acid nanofibers by melt electrospinning
- Erratum
- Erratum to: Synthesis and characterization of new macromolecule systems for colon-specific drug delivery
Articles in the same Issue
- Regular Articles
- The regulatory effects of the number of VP(N-vinylpyrrolidone) function groups on macrostructure and photochromic properties of polyoxometalates/copolymer hybrid films
- How the hindered amines affect the microstructure and mechanical properties of nitrile-butadiene rubber composites
- Novel benzimidazole-based conjugated polyelectrolytes: synthesis, solution photophysics and fluorescent sensing of metal ions
- Study on the variation of rock pore structure after polymer gel flooding
- Investigation on compatibility of PLA/PBAT blends modified by epoxy-terminated branched polymers through chemical micro-crosslinking
- Investigation on degradation mechanism of polymer blockages in unconsolidated sandstone reservoirs
- Investigation on the effect of active-polymers with different functional groups for EOR
- Fabrication and characterization of hexadecyl acrylate cross-linked phase change microspheres
- Surface-induced phase transitions in thin films of dendrimer block copolymers
- ZnO-assisted coating of tetracalcium phosphate/ gelatin on the polyethylene terephthalate woven nets by atomic layer deposition
- Animal fat and glycerol bioconversion to polyhydroxyalkanoate by produced water bacteria
- Effect of microstructure on the properties of polystyrene microporous foaming material
- Synthesis of amphiphilic poly(ethylene glycol)-block-poly(methyl methacrylate) containing trityl ether acid cleavable junction group and its self-assembly into ordered nanoporous thin films
- On-demand optimize design of sound-absorbing porous material based on multi-population genetic algorithm
- Enhancement of mechanical, thermal and water uptake performance of TPU/jute fiber green composites via chemical treatments on fiber surface
- Enhancement of mechanical properties of natural rubber–clay nanocomposites through incorporation of silanated organoclay into natural rubber latex
- Preparation and characterization of corn starch/PVA/glycerol composite films incorporated with ε-polylysine as a novel antimicrobial packaging material
- Preparation of novel amphoteric polyacrylamide and its synergistic retention with cationic polymers
- Effect of montmorillonite on PEBAX® 1074-based mixed matrix membranes to be used in humidifiers in proton exchange membrane fuel cells
- Insight on the effect of a piperonylic acid derivative on the crystallization process, melting behavior, thermal stability, optical and mechanical properties of poly(l-lactic acid)
- Lipase-catalyzed synthesis and post-polymerization modification of new fully bio-based poly(hexamethylene γ-ketopimelate) and poly(hexamethylene γ-ketopimelate-co-hexamethylene adipate) copolyesters
- Dielectric, mechanical and thermal properties of all-organic PI/PSF composite films by in situ polymerization
- Morphological transition of amphiphilic block copolymer/PEGylated phospholipid complexes induced by the dynamic subtle balance interactions in the self-assembled aggregates
- Silica/polymer core–shell particles prepared via soap-free emulsion polymerization
- Antibacterial epoxy composites with addition of natural Artemisia annua waste
- Design and preparation of 3D printing intelligent poly N,N-dimethylacrylamide hydrogel actuators
- Multilayer-structured fibrous membrane with directional moisture transportability and thermal radiation for high-performance air filtration
- Reaction characteristics of polymer expansive jet impact on explosive reactive armour
- Synthesis of a novel modified chitosan as an intumescent flame retardant for epoxy resin
- Synthesis of aminated polystyrene and its self-assembly with nanoparticles at oil/water interface
- The synthesis and characterisation of porous and monodisperse, chemically modified hypercrosslinked poly(acrylonitrile)-based terpolymer as a sorbent for the adsorption of acidic pharmaceuticals
- Crystal transition and thermal behavior of Nylon 12
- All-optical non-conjugated multi-functionalized photorefractive polymers via ring-opening metathesis polymerization
- Fabrication of LDPE/PS interpolymer resin particles through a swelling suspension polymerization approach
- Determination of the carbonyl index of polyethylene and polypropylene using specified area under band methodology with ATR-FTIR spectroscopy
- Synthesis, electropolymerization, and electrochromic performances of two novel tetrathiafulvalene–thiophene assemblies
- Wetting behaviors of fluoroterpolymer fiber films
- Plugging mechanisms of polymer gel used for hydraulic fracture water shutoff
- Synthesis of flexible poly(l-lactide)-b-polyethylene glycol-b-poly(l-lactide) bioplastics by ring-opening polymerization in the presence of chain extender
- Sulfonated poly(arylene ether sulfone) functionalized polysilsesquioxane hybrid membranes with enhanced proton conductivity
- Fmoc-diphenylalanine-based hydrogels as a potential carrier for drug delivery
- Effect of diacylhydrazine as chain extender on microphase separation and performance of energetic polyurethane elastomer
- Improved high-temperature damping performance of nitrile-butadiene rubber/phenolic resin composites by introducing different hindered amine molecules
- Rational synthesis of silicon into polyimide-derived hollow electrospun carbon nanofibers for enhanced lithium storage
- Synthesis, characterization and properties of phthalonitrile-etherified resole resin
- Highly thermally conductive boron nitride@UHMWPE composites with segregated structure
- Synthesis of high-temperature thermally expandable microcapsules and their effects on foaming quality and surface quality of foamed ABS materials
- Tribological and nanomechanical properties of a lignin-based biopolymer
- Hydroxyapatite/polyetheretherketone nanocomposites for selective laser sintering: Thermal and mechanical performances
- Synthesis of a phosphoramidate flame retardant and its flame retardancy on cotton fabrics
- Preparation and characterization of thermoresponsive poly(N-isopropylacrylamide) copolymers with enhanced hydrophilicity
- Fabrication of flexible SiO2 nanofibrous yarn via a conjugate electrospinning process
- Silver-loaded carbon nanofibers for ammonia sensing
- Polar migration behavior of phosphonate groups in phosphonate esterified acrylic grafted epoxy ester composites and their role in substrate protection
- Solubility and diffusion coefficient of supercritical CO2 in polystyrene dynamic melt
- Curcumin-loaded polyvinyl butyral film with antibacterial activity
- Experimental-numerical studies of the effect of cell structure on the mechanical properties of polypropylene foams
- Experimental investigation on the three-dimensional flow field from a meltblowing slot die
- Enhancing tribo-mechanical properties and thermal stability of nylon 6 by hexagonal boron nitride fillers
- Preparation and characterization of electrospun fibrous scaffolds of either PVA or PVP for fast release of sildenafil citrate
- Seawater degradation of PLA accelerated by water-soluble PVA
- Review Article
- Mechanical properties and application analysis of spider silk bionic material
- Additive manufacturing of PLA-based scaffolds intended for bone regeneration and strategies to improve their biological properties
- Structural design toward functional materials by electrospinning: A review
- Special Issue: XXXII National Congress of the Mexican Polymer Society
- Tailoring the morphology of poly(high internal phase emulsions) synthesized by using deep eutectic solvents
- Modification of Ceiba pentandra cellulose for drug release applications
- Redox initiation in semicontinuous polymerization to search for specific mechanical properties of copolymers
- pH-responsive polymer micelles for methotrexate delivery at tumor microenvironments
- Microwave-assisted synthesis of the lipase-catalyzed ring-opening copolymerization of ε-caprolactone and ω-pentadecanolactone: Thermal and FTIR characterization
- Rapid Communications
- Pilot-scale production of polylactic acid nanofibers by melt electrospinning
- Erratum
- Erratum to: Synthesis and characterization of new macromolecule systems for colon-specific drug delivery