Home Highly Cr(vi)-tolerant Staphylococcus simulans assisting chromate evacuation from tannery effluent
Article Open Access

Highly Cr(vi)-tolerant Staphylococcus simulans assisting chromate evacuation from tannery effluent

  • Asma Kalsoom , Rida Batool EMAIL logo and Nazia Jamil
Published/Copyright: May 5, 2021
Download Article (PDF)
Become an author with De Gruyter Brill
Submit Manuscript Author Information
Green Processing and Synthesis
From the journal Green Processing and Synthesis Volume 10 Issue 1

Abstract

Chromium(vi) contaminated sites have been targeted for studying highly chromate-resistant bacteria. From a total of 23 Cr(vi)-resistant bacteria isolated on Luria-Bertani agar medium supplemented with K2CrO4 (1,500 μg/mL), only one strain UT8 (Staphylococcus simulans) was able to tolerate high concentration of chromate, i.e., up to 200 mg/mL in agar medium from tannery effluent. In acetate minimal medium (AMM), it showed maximum tolerance of up to 2,500 μg/mL. Cr(vi) removal potential was 94.6% after 24 h (K2CrO4 1,500 μg/mL). Parametric conditions were optimized in AMM to attain maximum chromate removal. Exopolysaccharides extracted from bacterial cells exposed to chromate exhibited major absorption shifts from 2,500 to 500 cm−1 revealed by Fourier transform infrared spectroscopy. Energy-disperse X-ray spectroscopy further confirmed the adsorption of oxyanions to the bacterial cells. Surface topography of the Cr(vi) treated cells showed transformation into concave shape by scanning electron microscopy. The presence of resistance genes, i.e., chromate reductase (chrR) and class I integrase (intI1), further confirmed tolerance toward chromate. Microarray data analysis of transcriptional gene expression suggested upregulation of cys gene cluster under chromate exposure. Concisely, the present investigations revealed the potential of S. simulans to be an effective candidate for chromate reclamation of wastewater.

Graphical abstract

Chromate-resistant bacterium UT8 was isolated from tannery effluent. The cultural conditions for strain UT8 were optimized for maximum chromate removal and exopolymer production. SEM-EDS analysis of strain UT8 revealed variations under Cr(vi) stress related to nonstress. The FTIR analysis of exopolymer under chromate stress indicated vibrational shifts for metal ion chelation.

Keywords: chromium resistance; tannery effluent; scanning electron microscopy; heavy metals; environmental contamination

1 Introduction

In the recent years, a boom in industrial activities and population boom has been witnessed, which led to environmental pollution. The inappropriate methods of waste disposal have caused the accumulation of transition metals, such as chromium (Cr), lead, cadmium, mercury, selenium, etc., in water bodies [1]. These activities are responsible for various health problems. One of the most important metal ion contaminants is Cr which is an inorganic compound present in two stable oxidation states, i.e., Cr(iii) and Cr(vi) [2]. Effluents from cement, stainless steel, paint pigments, wood preservation, and leather tanning industries increased the Cr(vi) concentrations in the environment, which is an alarming situation from the environmental safety perspective [3]. Cr(vi) is a recognized carcinogen with other toxic properties such as high water solubility, strong oxidizer, causing protein interference, and mutagenic properties. Along with these properties, Cr(vi) compounds persistent in the environment are nondegradable [4]. Cr(iii) is nontoxic and present in insoluble compounds such as oxides and hydroxides at pH >5 [3]. The reduction of Cr(vi) into Cr(iii) can be achieved by bioelectrochemcial, biological, and chemical approaches [5]. Conventional methods, such as ion exchange, precipitation, solvent extraction, adsorption, membrane separation, etc., were usually applied for Cr(vi) removal; however, these procedures are costly in terms of energy usage, treatment, and sludge disposal [6].

Bioremediation is the removal of toxic pollutants by microorganisms. Microbes are particularly useful in remediating Cr(vi) polluted sites as they reduce Cr(vi) to Cr(iii). Hence, the removal of chromate by biological treatment is economical, environmentally safe, innocuous, and free from the formation of harmful secondary compounds [7]. Microorganisms develop various mechanisms to deal with environmental stress conditions such as direct and indirect removal of oxyanions, uptake through adsorption, DNA methylation, and efflux of metal ions. In the direct approach, microbes reduce Cr(vi) into Cr(iii) enzymatically, whereas in indirect method it forms complex compounds with metabolites [8]. Bioremediation also comprises an additional mechanism, i.e., chromate resistance which converts Cr(vi) to Cr(iii) [9]. Chromate-tolerant bacteria also consists of various chromate reductases such as chrR, nfsA, YieF, and NemA, which catalyze the reduction of Cr(vi) to Cr(iii) facilitating the electron transfer from electron donor NAD(P)H to the former and instantaneously generating a reactive oxygen species by two pathways such as class I (“tight”) and class II (“semitight”). These reductases are found in the cytoplasm as soluble fractions or attached to the bacterial cell membrane [10]. Along with that, the presence of integrons (mobile genetic determinants) in bacteria is also important for the spread of antibiotic and heavy metal resistance such as class I integrase (intI1) gene. These integrases have a major role in the dissemination of antibiotic and other resistance genes in gram-positive and gram-negative bacteria [11]. Hence, this study purposes to estimate the chromate removal potential of Cr(vi)-resistant strain isolated from tannery waste, detect chromate genetic determinants and integron gene, and also examine the ultrastructural alterations in surface texture and morphology of bacterium through scanning electron microscopy-energy-disperse X-ray spectroscopy (SEM-EDS) in order to understand the new findings of adaptive cellular mechanisms under Cr(vi) stress.

1.1 Novelty statement

Tannery effluent is considered a source for the isolation of Cr(vi)-tolerant bacterial strains. So these can be employed at chromate polluted sites for remediation purposes. This approach is environmentally safe and inexpensive as compared to the conventional physiochemical remediation methods. Despite high chromate tolerance, Cr(vi)-resistant bacteria also carry resistance to other heavy metals, which are also present in the effluent. Various reports have illustrated enhancing chromate removal ability by optimizing the cultural conditions.

In the present study, a high chromate tolerant bacterium UT8 was isolated from tannery effluent. This strain was able to tolerate higher chromate concentration in the agar medium. Maximum chromate removal activity (94.6%) was observed after 24 h of incubation. This study carried out detailed optimization studies to attain maximum chromate removal potential along with exopolymer production.

Results confirmed higher chromate removal along with excellent exopolysaccharide (EPS) production by strain UT8 as compared to other bacterial strains.

2 Materials and methods

2.1 Chemicals and reagents

All reagents and chemicals used in the present study were of American Chemical Society analytical grade. Following metal compounds such as K2CrO4, NiCl2, CuCl2, ZnCl2, PbCl2, CoCl2, HgCl2, and 1,5-diphenylcarbazide (DPC) were procured from Sigma-Aldrich (St. Louis, MO, USA). The stock solutions of metals mentioned above were prepared in ultrapure Milli-Q water and stored in amber glass bottles in a dark environment.

2.2 Collection of tannery liquid waste

Tannery liquid waste was obtained in sterilized glass bottles from the leather tanning industry in Kasur (Pakistan). The physiochemical characteristics of the collected sample, such as pH, temperature, color, odor, and Cr(vi) concentration (µg/mL) were measured. Under aseptic conditions, the sample was instantly brought to the laboratory in an ice container and further utilized as a source for inoculum to isolate bacteria capable of chromate removal under aerobic conditions.

2.3 Isolation and characterization of chromate-tolerant bacteria

For isolation of chromate-resistant bacteria, 50 μL of serially diluted tannery sample was spread on Luria-Bertani (LB) agar plates augmented with potassium chromate (1,500 μg/mL) and incubated for 24–48 h at 37°C temperature. The morphologically diverse bacterial colonies were picked up and restreaked. Minimum inhibitory concentration (MIC) of chromate was determined by subsequent subculturing on LB and acetate minimal medium (AMM) agar media supplemented with increasing K2CrO4 concentration (2–200 mg/mL). Of 23, only 1 bacterium UT8, was able to withstand high chromate concentration, and it was further purified by three subsequent quadrant streaks on LB agar to obtain a monotype of the isolate. Morphological and biochemical presumptive identification was performed by various tests such as catalase, oxidase, starch hydrolysis, and motility [5].

2.4 16S rRNA gene sequencing

The 16S rRNA sequencing of highly Cr(vi)-resistant strain was done to confirm its taxonomic identity. For this purpose, a purified and isolated bacterial colony of strain UT8 was sent to Macrogen (Seoul, Korea). Almost complete 16S rRNA sequence was determined with primers 518F (CCAGCAGCCGCGGTAATACG) and 800F (TACCAGGGTATCTAATCC), selected for their comprehensive range of both archaea and eubacteria and also consisted of variable V5 and V6 regions of the 16S rRNA gene. The obtained sequence was analyzed in BLAST. The close neighboring sequences were downloaded and aligned using Clustal W version 1.6. Phylogenetic tree was constructed using the neighbor joining algorithm with 1,000 replicates in the bootstrap method in MEGA-X software [12].

2.5 Multiple metal and antibiotic tolerance

The selected chromate-tolerant bacterial strain was subjected to a multiple heavy metals and antibiotic-tolerance examination for determining the resistance potential against other toxic metals and antibiotics. Tolerance study against heavy metals such as NiCl2, CuCl2, ZnCl2, PbCl2, CoCl2, and HgCl2 was carried out in terms of MIC on LB agar plates. The stock solutions (stock 1 g/10 mL) of described metal salts were prepared in distilled water and autoclaved. The LB agar plates supplemented with increasing concentrations (10–1000 μg/mL) of described metals were streaked with selected chromate-resistant bacterium UT8 and incubated under optimum growth conditions for 48 h. MIC was designated as the lowest metal concentration at which no visible bacterial growth is seen. The LB agar plates with no addition of metal solutions were taken as the control. Antibiotics such as chloramphenicol, streptomycin, and ampicillin were also used in a similar way (stock 0.1 g/10 mL) with different concentrations (10–40 μg/mL) [13].

2.6 Bacterial growth and chromate removal potential

The growth attributes of chromate-resistant bacterium and its removal potential was investigated by culturing the bacterium in Erlenmeyer flasks (250 mL) containing 100 mL of autoclaved LB broth in the presence and absence of Cr(vi) (1,500 μg/mL). The flasks were kept in a shaking incubator at 120 rpm at 37°C temperature for 96 h. The control was also placed without the inoculation of the respective bacterial culture. The bacterial growth was observed by UV-Vis spectrophotometer at regular intervals in case of increase in culture absorbance at 600 nm, and Cr(vi) removal potential was estimated by chromate-specific colorimetric DPC method at 540 nm in case of a decrease in chromate concentration [14]. The percentage of chromate removal was calculated by using the following formula:

(1) % chromium (VI) removal = A i – A f / A i × 100

where A i – initial chromate concentration (μg/mL) and A f – final chromate concentration (μg/mL).

2.7 Ultrastructural microscopic investigation through SEM-EDS

SEM analysis was performed to explore bacterial cell morphology for ultrastructural adaptations under Cr(vi) exposure. For this purpose, strain UT8 was grown in LB broth under optimized conditions for 48 h under chromate stress (1,500 μg/mL). Bacterial culture with no chromate exposure was taken as a control. The cultures were centrifuged at 8,000 g for 5 min at 4°C to obtain a cell pellet. For fixing the cells, 5% glutaraldehyde was used for 12 h at 4°C and then dehydrated with increasing ethanol concentrations for 15 min (30%, 50%, 70%, 80%, 95%, and 100%) and finally freeze-dried. After that, the sample was observed by FEI Nova 450 NanoSEM using the built-in Everhart-Thornley detector (ETD) and through lens detector (TLD) detectors with an EDS [15].

2.8 Optimization of parametric conditions and infrared spectral analysis by Fourier transform infrared spectroscopy (FTIR)

It is essential to ascertain the parametric conditions to obtain a significant output of bacterial growth, EPS content, and chromate removal. Hence, the impact of temperature (28°C, 37°C, and 42°C), pH (5, 7, and 9), chromate concentration (500, 1,000, and 1,500 μg/mL), carbon (glucose, gluconate, citrate, and acetate), and nitrogen (peptone, yeast extract, ammonium sulfate, and tryptone) source was investigated both with and without Cr(vi) (1,000 μg/mL) treatment. The pH was maintained at 7.2 ± 0.1, temperature at 37°C, and agitation speed at 120 rpm. AMM and LB broth media were used and inoculated with log phase cells of strain UT8 (100 mL). Each set of experiments was set up to 96 h with duplication. At regular intervals, culture was withdrawn to monitor chromate removal, EPS production, and biomass determination [16,17]. EPS pellet was obtained by cold ethanol precipitation method, and KBr disc method was applied for FTIR analysis (Perkin Elmer spectrum BX FTIR system, Beaconsfield, Buckinghamshire). For FTIR analysis, samples were examined within the range of 500–4,000 cm−1. Transmission mode got the information related to functional groups attached to EPS for chelation of chromate ions [18].

2.9 Molecular characterization of chrR and intI1 genes

2.9.1 Extraction of genomic DNA

Total genomic DNA of chromate-resistant bacterium UT8 was extracted by commercially available GeneJET genomic DNA purification kit by Thermo Fisher Scientific (Waltham, Massachusetts, USA). Overnight culture grown in the presence of Cr(vi) was taken in microcentrifuge tube and DNA was extracted according to the manufacturer’s instructions. The DNA was electrophoresed on an agarose gel (1%) in TAE buffer and further visualized under UV (Dolphin-DOC, WEALTEC) and stored at −20°C prior to utilization.

2.9.2 Detection of chrR and intI1 genes and bioinformatics

The PCR amplification of partial chrR and intI1 genes was performed on the bases of previously reported primers by Baldiris et al. (2018) and Ashayeri-Panah et al. (2014), respectively (Table S1) [10,19]. The annealing temperature for chrR and intI1 was 56°C and 58°C, respectively, for 45 s. PCR amplification reactions of both the genes were prepared in 30 µL total volume containing 3 µL nuclease free water, 5 µL primers (10 pmol each primer), 7 µL genomic DNA, and 15 µL Taq PCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA). The reaction mixture was subjected to a thermocycler (Kyratec SuperCycler Thermal Cycler, SC300G) with a program of the following steps: initial denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 45 s, elongation at 72°C for 45 s, and a final elongation step at 72°C for 10 min. PCR amplicons were visualized by gel electrophoresis for 1 h at 100 V on a 0.5% agarose gel in TAE buffer comprising 0.5 mg/mL ethidium bromide.

Publicly accessible database Gene NCBI was used to obtain the gene sequences already published by Gene IDs: 45523152, 58531901, 58454607, and 57455938 for chrR gene in Pseudomonas species and 60546277, 48593718, 58521083 for nfsA gene in Staphylococcus species. Both the gene sequences were aligned and analyzed by neighbor joining method for construction of a phylogenetic tree with 1,000 replicates in the bootstrap method in MEGA-X software [12].

2.10 Mining of microarray data

Microarray data were obtained from Gene Expression Omnibus (GEO, http://ncbi.nlm.nih.gov/geo/) which is a publicly accessible gene expression profile database and analyzed with GEO2R. Microarray data set published by Monsieurs et al. (2011) was used to investigate differential gene expression in Cupriavidus metallidurans strain (data accessible at NCBI GEO database, accession number GSE23876) under various heavy metal exposure [20].

2.11 Statistical analysis

All experimental works were performed in triplicate. For statistical analysis of the data, standard error of the mean was calculated [21]. The graphs were plotted in GraphPad Prism 5.0 version and Origin Pro 8.5.0 software.

3 Results

3.1 Sample characteristics and isolation of chromate-tolerant bacterium

At the time of the sampling, physical characteristics such as pH, temperature, color, odor, and chromate concentration were recorded, i.e., 7.5, 38°C, gray, pungent smell, and 218 µg/mL, respectively. A total of 23 chromate-resistant bacterial strains were isolated at an initial concentration of 1,500 µg/mL K2CrO4. The selected strains were further purified and screened for high metal tolerance (data not given). Among the isolated strains, only one bacterium (Staphylococcus simulans UT8) was found to be able to resist 200 mg/mL chromate concentration on LB agar plates supplemented with the respective concentration of chromate. Whereas in AMM, it revealed resistivity up to 2,500 µg/mL K2CrO4. Morphological identification of K2CrO4-resistant strain was done. It was a gram-positive cocci with irregular bunches and nonmotile. The morphology and biochemical traits of UT8 are given in Table S2. The entire sequence of the 16S rRNA gene of bacterial strain UT8 was analyzed for similarities. The search engine of NCBI BLAST indicated 99% similarity to S. simulans with a bit score of 2,562 (Figure 1).

Figure 1 Phylogenetic tree of chromate-tolerant bacterium UT8 based on 16S rRNA gene sequencing and compared with other neighboring members of Staphylococcus genera.
Figure 1

Phylogenetic tree of chromate-tolerant bacterium UT8 based on 16S rRNA gene sequencing and compared with other neighboring members of Staphylococcus genera.

3.2 Multiple metal and antibiotic tolerance

Antibiotic- and heavy metal-resistance patterns for chromate-resistant strain were performed. The MIC for each heavy metal (NiCl2, CuCl2, ZnCl2, PbCl2, CoCl2, and HgCl2) was recorded (Table S3). Chromate-resistant bacterial strain UT8 revealed a wide range of MIC against various metal ions such as 250, 200, 100, 700, 1,000, and 20 μg/mL for Ni2+, Co2+, Zn2+, Pb2+, Cu2+, and Hg2+, respectively. For antibiotic resistivity, strain UT8 showed 20, 40, and 30 μg/mL MIC for ampicillin, streptomycin, and chloramphenicol, respectively.

3.3 Bacterial growth and chromate removal potential

The chromate-resistant bacterial strain UT8 was investigated for growth under chromate exposure. Under both chromate stress and nonstress conditions, maximum growth was observed after 24 h of incubation. It showed that the presence of chromate did not have damaging effect on the bacterial cells. Furthermore, the chromate removal ability of strain UT8 was 94.6% at this time period (Figure 2a). This strain was very effective in evacuating chromate ions with 32.08 µg/mL residual Cr(vi) and 97% chromate removal after 96 h of incubation (initial 1,500 µg/mL; Figure 2b). A relative study of chromate removal potential of this strain with other previously reported bacterial strains has been illustrated in Table S4.

Figure 2 Chromium(vi)-tolerant bacterium UT8 (a) growth kinetics and (b) chromate removal and residual investigation.
Figure 2

Chromium(vi)-tolerant bacterium UT8 (a) growth kinetics and (b) chromate removal and residual investigation.

3.4 Ultrastructural microscopic investigation through SEM-EDS

Cr(vi)-resistant bacterial strain UT8 was investigated for microscopic structural adaptation through SEM. Bacterial cells treated with Cr(vi) revealed rough, asymmetrical, bulged surface topography with depressions, and reduced cell size as compared to untreated cells that were more smooth and regular in shape (Figure 3a). The average size of cells was 883.65 nm whereas the size of bacterial cells exposed to chromate was 848.85 nm in diameter. The cells were more compact and very closely connected through EPS under chromate exposure (Figure 3b). These findings clearly suggest the effective binding of chromate ions by bacterial strain UT8 on its cell wall. The reason could be precipitation/adsorption of reduced Cr species, i.e., Cr(iii) on the cell surface of the bacterium. Additionally, the EDS analysis revealed Cr peak (with 0.19 wt% analysis) for bacterial cells under chromate exposure, due to the complexation of Cr(iii) with molecules present on the cell surface or presence of reduced precipitated Cr(iii) species on the outer surface of the cells (Table 1).

Figure 3 SEM micrographs of chromate-tolerant bacterium UT8 (a) no chromate treatment and (b) chromate treatment, red arrow indicates EPS, yellow arrow shows cell deformity, and blue arrow shows cell aggregation, (a1) EDS analysis of strain UT8 with no chromate exposure and (b1) EDS analysis of strain UT8 with chromate exposure.
Figure 3

SEM micrographs of chromate-tolerant bacterium UT8 (a) no chromate treatment and (b) chromate treatment, red arrow indicates EPS, yellow arrow shows cell deformity, and blue arrow shows cell aggregation, (a1) EDS analysis of strain UT8 with no chromate exposure and (b1) EDS analysis of strain UT8 with chromate exposure.

Table 1

Elemental content in chromate-tolerant bacterium UT8 grown in LB broth supplemented with 1,500 μg/mL chromium(vi)

Elements Apparent concentration wt%
C 47.33 67.04
O 21.97 26.86
Na 2.54 1.62
P 3.71 1.95
Cl 1.65 1.33
K 1.56 1.01
Cr 1.05 0.19

3.5 Optimization of parametric conditions and FTIR analysis

Chromate-resistant bacterial strain UT8 was optimized for maximum Cr(vi) removal, EPS, and biomass production. The experiment was conducted at various pH, temperature, initial chromate concentration, carbon, and nitrogen sources. The results indicated maximum chromate removal by strain UT8, i.e., 90.5% at pH 7 at 1,000 μg/mL Cr(vi) concentration, whereas 95% removal was observed at 37°C after 72 h of incubation. However, at the same Cr(vi) concentration, the maximum biomass of 1,864 mg/L was achieved when glucose was used as the sole carbon source. In case of nitrogen source, yeast extract was more favorable for the growth of strain UT8 with the biomass yield of 1,145 mg/L and 89% chromate removal (initial chromate concentration 1,000 μg/mL) (Figure 4a). EPS yield increased when the bacterial cells were exposed to Cr(VI). The variable pH and temperature greatly affected the EPS yield, and the maximum EPS extracted was at pH 7, 5.1 mg/L; whereas at temperature 42°C, 8 mg/L EPS at 1,000 μg/mL initial chromate concentration (wet weight) was obtained. When the AMM was supplemented with glucose as the sole carbon source, enhanced EPS was extracted from strain UT8 under chromate stress, i.e., 14.4 mg/L while under the same medium conditions EPS was 9.2 mg/L, with no Cr(VI) stress. It clearly showed that under various physiological stress conditions, this bacterium was able to produce high EPS content for its survival. Ammonium sulfate and yeast extract were better nitrogen source substitutes for enhanced EPS production, i.e., 5.2 and 4.8 mg/L, respectively, under Cr(VI) stress (Figure 4b).

Figure 4 Evaluation of various pH, temperature, initial chromate concentration, carbon, and nitrogen sources on (a) biomass production and Cr(vi) removal potential and (b) EPS yield under various parametric conditions by bacterial strain UT8.
Figure 4

Evaluation of various pH, temperature, initial chromate concentration, carbon, and nitrogen sources on (a) biomass production and Cr(vi) removal potential and (b) EPS yield under various parametric conditions by bacterial strain UT8.

Chromate-tolerant bacterial strain UT8 showed enhanced EPS yield in the LB-medium under Cr(VI) treatment. EPS content of Cr(VI)-treated cells was 0.8 g/L as compared to the EPS produced by the untreated cells, i.e., 0.33 g/L. EPS was further investigated for the presence of functional groups through FTIR technique. FTIR analysis of EPS showed variations in the functional groups exposed to chromate, which assisted in chelation of Cr(vi) ions. EPS produced by cells unexposed to Cr(vi) demonstrated a diverse absorption peak at 3,265 cm−1 due to –OH/–NH stretching vibrations; an absorption peak at 2,352 cm−1 indicated weak C–H stretching band and at 1,623 cm−1 a C–O stretch for amino sugars and proteins. The absorption peaks from 760 to 1,250 cm−1 revealed various polysaccharides. An asymmetrical C–O–C ester linkage causes a band formation at 1,055 cm−1 whereas 860 cm−1 was due to β-glycosidic associations present in sugar monomers. EPS extracted from bacterial cells treated with Cr(vi) showed major variations from 2,500 to 500 cm−1. The important changes in absorption band were observed in 4,000–3,500, 3,500–2,750, 2,500–2,000, 1,750–1,200, and 1,000–800 cm−1 (Figure S1). These variations in Cr(VI)-treated bacterial cells were predominantly due to the specific functional groups carboxyl, amino, sulfonate, and hydroxyl, which react with metal ions to get ionized and form a permanent bond with the metal ions.

3.6 Detection of chrR and intI1 genes and bioinformatics

Chromate-resistant strain UT8 possesses the property of chrR which is known to catalyze the reduction of Cr(vi) to Cr(iii). The PCR amplicons of chrR gene were produced by primers chrR and chrF and intI1 gene by primers intI1R and intI1F in chromate-resistant bacterium Staphylococcus aureus. The amplicons were of 268 and 280 bp when it was analyzed in gel electrophoresis (Figure 5a). Bioinformatics tool was applied to understand the homology between chrR and nitroreductase genes (nfsA). Already published FASTA sequences of chrR gene related to Pseudomonas species were analyzed in MEGA-X software which showed 94% homology with each other, whereas nfsA gene in Staphylococcus species indicated 99% similarity (Figure S2a and b). Approximately, 57% homology was observed between both the genes (Figure S2c), suggesting that nitroreductase gene is involved in Cr(vi) reduction.

Figure 5 (a) Detection of chromate reductase and integrase gene in this study. Lane 1: 1 kb DNA Ladder-Thermo Fisher, Lane 2: Chromate reductase gene chrR 268 bp, and Lane 3: integrase gene intI1 280 bp, (b) microarray investigation of cys cluster Rmet_2813, and (c) Rmet_2815 in Cupriavidus metallidurans CH34.
Figure 5

(a) Detection of chromate reductase and integrase gene in this study. Lane 1: 1 kb DNA Ladder-Thermo Fisher, Lane 2: Chromate reductase gene chrR 268 bp, and Lane 3: integrase gene intI1 280 bp, (b) microarray investigation of cys cluster Rmet_2813, and (c) Rmet_2815 in Cupriavidus metallidurans CH34.

3.7 Mining of microarray data

Monsieurs et al. (2011) published a microarray data set in GEO NCBI (data accessible at NCBI GEO database, accession number GSE23876) which were further analyzed by GEO2R. In this study, transcriptional gene expression was measured in C. metallidurans CH34 strain under various heavy metal exposure. Upon chromate exposure, a cys gene cluster was excessively expressed (Rmet_2811, 2813) (Figure 5b and c). This cluster is linked to sulfur ion metabolic pathway which is structurally similar to Cr(vi) ion. The transcriptional expression of cys cluster was significantly higher in chromate exposure with p values 0.0028 and 0.0043 for Rmet_2811 and Rmet_2813, respectively. Other than that, the expression of genes involved in carbohydrate metabolism was also overly expressed as metal removal requires a lot of energy and the cell needs ATPases for the removal of toxic ions.

4 Discussion

These days Cr(vi) pollution in the environment is an emerging issue. Rapid industrial development and deforestation accumulated toxic contaminants in the environment which are the leading cause of various health illnesses. Therefore, one of the possible solutions to these problems is the reclamation of Cr(vi)-contaminated areas by the application of chromate resistant bacteria. Hence, this study conducted the chromate removal potential and SEM-EDS analysis of Cr(vi)-resistant bacterial strain UT8. From a total of 23 chromate tolerant strains, only one bacterium was able to effectively resist high concentrations of Cr(vi) (200 mg/mL). This is one of the few reports describing the highest MIC of chromate revealed by a Cr(VI)-resistant bacterial strain. However, in AMM, it revealed tolerance up to 2,500 µg/mL K2CrO4. Previous reports described various Cr(vi)-tolerant microbes such as a gram-positive bacterial strains S. aureus and Pediococcus pentosaceus (2,000 mg/L) and Streptomyces sp. CG52 (500 mg/L) [22]. Bacterial strain UT8 (MN932132) resists higher chromate concentrations in the LB agar medium.

SEM analysis of chromate-resistant bacterial strain UT8 clearly illustrated variations in cell surface morphology and texture under chromate exposure. The bacterial cells were of normal size; however, few cells revealed reduction in size after metal exposure. Bacterial cells tend to change their shape upon chromate exposure by forming a concave shape. This might be due to the survival mechanisms under unfavorable environmental conditions. The presence of Cr(vi) on the cell surface was confirmed by EDS analysis which indicated the chromate adsorption on the bacterial cell surface. Extracellular aggregation and EPS were also clearly observed in between the cells after Cr(vi) treatment, which might be the sites for Cr biosorption [23]. Our research findings are in accordance with earlier study [24]. El-Naggar et al. (2020) also reported similar findings of SEM micrographs before and after adsorption of chromate ions on the cell surface of Pseudomonas alcaliphila NEWG-2 and also recorded structural variations [25]. It was further confirmed by EDS, which is an excellent tool for the investigation of elemental content and characterization of chemical compounds in various sorbents [25]. Bai et al. (2018) also presented the EDS analysis of the cell surface of the thermophilic bacterium Caldicellulosiruptor saccharolyticus, which consisted of Cr in the form of precipitated particles accumulated around the cell surface [26]. The peaks of other elements such as calcium, sodium, carbon, oxygen, phosphorus, and potassium are previously reported to be involved in the localization of Cr on bacterial cell surface [27]. Elsayed et al. also reported similar findings regarding the cell shape irregularity and precipitation of Cr species on the bacterial cell surface through EDS analysis [28]. In a study, EDS analysis of raw aerogel revealed metal peak after Cr adsorption (1.1 wt%) [29].

Bacterial cell wall acts as an initial defense against environmental stress. The production of EPS is reported to increase under stress conditions and to act more as a binding site for the chelation of metallic ions on the surface of bacterial cells [14,30]. The composition of EPS biomolecules was confirmed with IR spectral data using the FTIR technique. Biomolecules such as carbohydrates and proteins signify a peculiar C–H, N–H, and O–H absorption band shifts. Previously, some researchers described the characteristic peaks for 1,3 β glucan linkage and carbonyl group at 1202.90, 1401.15, and 1554.42 cm−1, respectively. A vibration range of 1026.32 and 1144.60 cm−1 is representative of the C–O–C, C═O, and C–C groups found in pyranose glucose and specific carbohydrates, respectively [15]. These shifts in EPS sample unexposed to Cr(VI) were compared to EPS loaded with chromate ions and revealed the partial bonding between oxyanions and carboxyl and carbonyl and hydroxyl groups present in the extracted EPS. The absorption peak between 1,695 and 1,655 cm−1 showed NH2 and –COO amide I and α-helix of protein. A previous study described the association of C–O–C, C═O, and C–C groups in the uptake of metal ions by JL2810 EPS through FTIR spectroscopy [31]. The variations in vibrational shifts may be due to the oxygen bond existing in EPS molecular structure with oxyanions during the adsorption which may result in the reduction of negative charge/electron cloud density of groups [15]. These results are in accordance with Shahnaz et al. [32] describing shift in some peaks after Cr(vi) adsorption. In general, the findings of the present study suggested that various functional groups, hydroxyl, carbonyl, carboxyl, and amines, present in the extracted EPS might help in metal ion uptake, especially proteins and carbohydrates.

The maximum chromate removal percentages achieved were 94.6% and 97% at 1,500 µg/mL chromate concentration, at 24 and 96 h, respectively. Bacterial strain UT8 was proficient in efficiently removing chromate from aqueous solution. Our experiment indicated that the rate of chromate removal and cell growth were parallel, and the growth rate was not reduced by the presence/absence of metal ions which indicated a constitutive pathway of chrR [33]. The growth curve of strain UT8 appears to be saturated after a certain period, indicating that the cellular mechanisms have been modified/altered to develop chromate tolerance and cell survival when chromate was applied. Initially, the low rate of chromate removal by strain UT8 after 24 h might be related to the lethal and mutagenetic effects of chromate ions on the cellular metabolism of the bacterium. Cr(vi)-tolerant strain UT8 also showed resistivity toward other heavy metals such as Pb2+, Zn2+, Cu2+, Hg2+, Ni2+, and Co2+, and antibiotics, viz. ampicillin, streptomycin, and chloramphenicol. The pattern of resistance was Cu2+ > Pb2+ > Ni2+ > Co2+ > Zn2+ > Hg2+. The tolerance for other heavy metals in bacteria perhaps reflects the level of toxic metal pollution in the environment and could be the direct association of these metal ions with bacterial cells. However, heavy metal-tolerant microorganisms can also be isolated from uncontaminated environments or they readily adapt to higher concentrations of lethal metal ions by developing resistance mechanisms [27]. Bharagava and Mishra (2018) also suggested the prevalence of higher metal tolerance in a population raised from increased environmental contamination [27]. Nevertheless, bacterial heavy metal tolerance is significant when applying bacteria into soils for remediation of metal polluted areas. The antibiotic resistance property might be generally linked with transmissible plasmids. These characters may have appeared because of the contact of bacterial cells with antibiotics that can cause a spontaneous co-selection of tolerance factors for metal ions and antibiotics [27].

The strain UT8 was further investigated for maximum chromate ion removal, EPS production, and biomass determination under optimized parametric conditions, viz. pH, temperature, initial chromate concentration, carbon, and nitrogen sources. Under neutral conditions with chromate stress of 1,000 µg/mL, maximum chromate removal was achieved, whereas Cr(VI) removal was lower in acidic and alkaline media. This may result from inadequate bacterial cell growth and lower reductase activity under these conditions. Temperature, pH, and initial concentration of Cr(VI) salt have a direct influence on chromate removal [34]. A previous study also describes similar results of Cr(vi) reduction by Bacillus sp. CRB-1 [35]. Wani et al. (2019) also described the similar effect of pH on chromate removal and suggested that this could be the result of insufficient cell biomass [36]. A correlation exists between the removal of chromate and temperature. The chromate removal was increased under increasing temperature and the optimum temperature noticed was 37°C. Under optimized temperature, the activity of chrR increases which aids in Cr(VI) removal while higher temperatures damage the enzymatic activity of reductases and cause changes in membrane structures, which could be the reason for lower chromate removal efficacy [37]. In a study, maximum chromate removal by strains MAI1 and MAI2 was examined at 25°C and 35°C; however, less chromate removal was attained at 45°C. Cell growth and Cr(VI) removal are badly affected by temperatures above 40°C due to the possibility of cell death and protein denaturation [36]. Bacterial strain UT8 showed a variation in chromate removal under different initial Cr concentrations. This strain was capable of removing 92 ± 0.35%, 90 ± 0.74%, and 84 ± 0.69% Cr(VI) with initial K2CrO4 concentration, i.e., 500, 1,000, and 1,500 µg/mL, respectively. McLean et al. (2000) reported that the decline in Cr(VI) removal with increasing chromate ion concentration appears to suggest the toxicity of chromate toward bacterial cells and reduce the active participants involved in Cr(VI) evacuation [38]. Shi et al. (2009) reported their findings and stated the significant chromate removal at low Cr(vi) concentrations which considerably increased with increasing chromate concentration[39]. For Cr(vi) elimination, various compounds act as electron donors which may be used by chromate-reducing microbes. Glucose and yeast extract significantly affected chromate removal in strain UT8 under optimized conditions as carbon and nitrogen sources. In a study, Pseudomonas fluorescens LB300, Agrobacterium radiobacter, Escherichia coli ATCC33456, and Bacillus cereus strains demonstrated enhanced Cr(vi) reduction when glucose was applied as a single source of carbon [40].

EPS production by strain UT8 was examined under a variable pH and temperature. Our observations indicated that EPS increased under neutral pH when exposed to chromate as compared to the unexposed cells. Our results are in accordance with a previous report [41]. Czaczyk and Myszka (2007) stated that bacterial growth and EPS yield are affected by extreme pH resulting in variations in surface morphology of cells and the composition of EPS [42]. In our study, the highest EPS yield was obtained at 42°C after 96 h of incubation supplied with 1,000 µg/mL Cr(VI). In the literature, it is reported that EPS acts as an initial barrier to bacterial cells, which have a direct association with metal ions in the aqueous medium. They not only protect the bacterial cells but also aid in metal remediation in the environment [43,44]. Extracted EPS yield was increased with increasing Cr(VI) concentration; however, at 1,500 µg/mL chromate concentration, a reduction in EPS content was observed. This might be due to the toxic effect of higher Cr(VI) concentration on the bacterial cells, which causes reduced cell growth, resulting in lower biomass [45]. A similar pattern of EPS content was described by Oves et al. (2013) in their study on Pseudomonas aeruginosa strain under various chromate concentrations [46]. EPS production of strain UT8 was investigated under various carbon and nitrogen sources. When glucose and ammonium sulfate were supplied in AMM amended with chromate stress (1,000 µg/mL), substantial EPS yield was observed. Cerning et al. (1994) reported similar findings of EPS production by Lactobacillus casei CG11 glucose, the most efficient source of carbon for maximum EPS yield [47].

Tolerance toward chromate can be ascribed to several mechanisms such as Cr(vi) genetic determinants on plasmids, efflux channels, direct reduction by specific enzymes or indirect through secondary metabolites, Cr(vi) biotransformation, DNA methylation, uptake, or adsorption of chromate ions [48]. A partially amplified chrR and intI1 genes were detected in Cr(vi)-resistant bacterium UT8. Similar results were also reported in gram-positive bacteria Arthrobacter aurescens, Bacillus atrophaeus, and Rhodococcus erythropolis by Patra et al. (2010) in their study [49]. Baldiris et al. (2018) described chrR gene as a genetic determinant highly like the phylogenetically distant microbes [10]. In a previous study, a 321-bp amplicon of chrR gene was obtained, which confirmed the occurrence of this gene in two bacteria, reaffirming their Cr(vi) reducing property [50]. Some researchers reported the presence of chrR gene in P. aeruginosa which is responsible for chromate resistance [51]. Various other types of genes have been reported in the literature, which are involved in Cr(vi) ion resistance/transport/reduction/efflux. These genes occur either in the bacterial chromosome or in the plasmid. Phylogenetic analysis of chrR and nfsA gene revealed a 57% homology with one another, describing the potential of both the genes in chromate reduction. The presence of any single gene may support the survival of bacteria in the chromate contaminated environment. Integrons are mobile genetic elements that are commonly part of bacterial genomes, allowing the effective gene transfer and expression of exogenous genes [52]. Integron has an essential component, i.e., intI gene that encodes integron integrase and specifically intI1 (encoding Class1 integrons), which is commonly applied as a biomarker for horizontal gene transfer [53].

The expression profiles of certain determinants of resistance to Cr(VI) and other heavy metals in C. metallidurans CH34 were then compared. The GEO NCBI gene expression profile database was used to extract expression data for Cr(vi)-resistant genes within C. metallidurans CH34 (accession no. GSE23876). It was further analyzed by GEO2R that revealed a cys cluster (Rmet_2811-15), which is a Cr-stimulative gene cluster. This gene cluster is part of a bigger cluster cysGNDHUIVB associated with sulfite and sulfate metabolism. A structural analogy exists between sulfur and Cr(VI) ions, which can facilitate the entry of Cr(VI) ions into the cell through sulfate absorption. The expression of this gene cluster was significantly high relative to its response in other heavy metal stress conditions. The expression of cys cluster was six times upregulated in chromate stress; whereas in cadmium, lead, and nickel, its expression was downregulated [20]. Cr(vi) detoxification results in sulfur deficiency, subsequently leading to upregulation of pathways related to sulfur. Juhnke et al. (2002) previously described the reduction in chromate uptake due to the suppression of sulfate uptake system which is the main system of chromate tolerance in C. metallidurans CH34 [54]. The close relationship between sulfur metabolism and Cr(vi) response is also proven by the overexpression of other heavy metal response regions that are affiliated with (thio) the transport of sulfate (Rmet_1376-79˗cysTWAB) and biosynthesis of cysteine and the formation of thio-ester bond in acetylcoenzyme A synthesis (Rmet_0607-11). The pathways related to sulfur supplies an adequate concentration of thiol groups, which form a permanent bond with metal ions, thus restraining them in a relatively nontoxic form [20]. The chromosomal chr cluster (Rmet_3864-66), comprising three genes that generally go undetected, still suggested contributing to Cr(vi) resistance previously. Two transcriptional regulators belong to this region, i.e., one putative activator chrB (Rmet_3866), one repressor chrF (Rmet_3864), and a chromate efflux pump chrA (Rmet_3865). The expression analysis of this region revealed a remarkable twofold upregulation of both chrB and chrA genes, combined with fivefold upregulation of the repressor chrF. The microarray literature survey provided important understanding of transcriptomic expression of various heavy metal stress responses in CH34 strain, making it a highly resistant bacterium able to survive in anthropogenic environments.

5 Conclusion

This study concludes that strain UT8 S. simulans is highly tolerant to chromate and has a maximum chromate removal potential of 94.6% after 24 h of incubation (K2CrO4 1,500 µg/mL). Ultrastructural visualization revealed variations in SEM micrographs when bacterial cells were exposed to chromate. It was additionally supported by EDS analysis. FTIR spectroscopy showed the vibrational shifts in the extracted EPS of strain UT8 exposed to Cr indicated the adsorption of Cr(vi). Due to this property, strain UT8 could be harnessed to reclaim Cr(vi) polluted areas. Hence, these investigations are highly significant to those industries discharging high concentrations of Cr(vi) for bioremediation.

tel: +92-42-35952811, fax: +92-42-99230481

Acknowledgment

We appreciate the University of the Punjab for supporting the present study. This research work is part of Ph.D. Thesis of the first author Ms. Asma Kalsoom.

  1. Funding information: Authors state no funding involved.

  2. Author contributions: Asma Kalsoom was involved in data curation, formal analysis, investigation, methodology, software, visualization, and writing the original draft; Rida Batool was in charge of conceptualization, data curation, formal analysis, methodology, project administration, resources, software, supervision, validation, visualization, and writing  – review and editing; Nazia Jamil contributed to conceptualization, data curation, formal analysis, methodology, project administration, resources, software, supervision, validation, visualization, and writing – review and editing.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: All data generated or analysed during this study are included in this published article.

References

[1] Liu H, Wang Y, Zhang H, Huang G, Yang Q, Wang YJ. Synchronous detoxification and reduction treatment of tannery sludge using Cr(vi) resistant bacterial strains. Sci Total Environ. 2019;687:34–40.10.1016/j.scitotenv.2019.06.093Search in Google Scholar PubMed

[2] Raman NM, Asokan S, Sundari NS, Ramasamy S. Bioremediation of chromium(vi) by Stenotrophomonas maltophilia isolated from tannery effluent. J Environ Sci Technol. 2018;15(1):207–16.10.1007/s13762-017-1378-zSearch in Google Scholar

[3] He C, Gu L, Xu Z, He H, Fu G, Han F, et al. Cleaning chromium pollution in aquatic environments by bioremediation, photocatalytic remediation, electrochemical remediation and coupled remediation systems. Environ Chem Lett. 2020;18(3):561–76.10.1007/s10311-019-00960-3Search in Google Scholar

[4] Pereira EJ, Ramaiah N. Chromate detoxification potential of Staphylococcus sp. isolates from an estuary. Ecotoxicol. 2019;28(4):457–66.10.1007/s10646-019-02038-wSearch in Google Scholar PubMed

[5] Kalsoom A, Batool R, Jamil N. An integrated approach for safe removal of chromium(vi) by Brevibacterium sp. Pakistan J Sci. 2020;72(1):18.Search in Google Scholar

[6] Mohamed MS, El-Arabi NI, El-Hussein A, El-Maaty SA, Abdelhadi AA. Reduction of chromium-VI by chromium-resistant Escherichia coli FACU: a prospective bacterium for bioremediation. Folia Microbiol. 2020;65(4):687–96.10.1007/s12223-020-00771-ySearch in Google Scholar PubMed

[7] Tamindžija D, Chromikova Z, Spaić A, Barak I, Bernier-Latmani R, Radnović D, Chromate tolerance and removal of bacterial strains isolated from uncontaminated and chromium-polluted environments. World J Microbiol Biotechnol. 2019;35(4):1–17.10.1007/s11274-019-2638-5Search in Google Scholar PubMed

[8] Seleiman MF, Ali S, Refay Y, Rizwan M, Alhammad BA, El-Hendawy SE. Chromium resistant microbes and melatonin reduced Cr uptake and toxicity, improved physio-biochemical traits and yield of wheat in contaminated soil. Chemosphere. 2020;250:126239.10.1016/j.chemosphere.2020.126239Search in Google Scholar PubMed

[9] Rath BP, Das S, Thatoi H. Bioremediation efficacy of extracellular chromate reductase from Bacillus amyloliquefaciens (CSB 9) for detoxification of hexavalent chromium. Environmental biotechnology for soil and wastewater implications on ecosystems. Singapore: Springer; 2019. p. 109–15.10.1007/978-981-13-6846-2_14Search in Google Scholar

[10] Baldiris R, Acosta-Tapia N, Montes A, Hernández J, Vivas-Reyes R. Reduction of hexavalent chromium and detection of chromate reductase (ChrR) in Stenotrophomonas maltophilia. Molecules. 2018;23(2):406.10.3390/molecules23020406Search in Google Scholar PubMed PubMed Central

[11] Li L, Zhao X. Characterization of the resistance class 1 integrons in Staphylococcus aureus isolates from milk of lactating dairy cattle in Northwestern China. BMC Vet Res. 2018;14(1):1–7.10.1186/s12917-018-1376-5Search in Google Scholar PubMed PubMed Central

[12] Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30(12):2725–9.10.1093/molbev/mst197Search in Google Scholar PubMed PubMed Central

[13] Akinbowale OL, Peng H, Grant P, Barton MD. Antibiotic and heavy metal resistance in motile aeromonads and pseudomonads from rainbow trout (Oncorhynchus mykiss) farms in Australia. Int J Antimicrob Agents. 2007;30(2):177–82.10.1016/j.ijantimicag.2007.03.012Search in Google Scholar PubMed

[14] Batool R, Yrjala K, Hasnain S. Hexavalent chromium reduction by bacteria from tannery effluent. J Microbiol Biotechnol. 2012;22(4):547–54.10.4014/jmb.1108.08029Search in Google Scholar PubMed

[15] Tyagi B, Gupta B, Thakur IS. Biosorption of Cr(vi) from aqueous solution by extracellular polymeric substances (EPS) produced by Parapedobacter sp. ISTM3 strain isolated from Mawsmai cave, Meghalaya, India. Environ Res. 2020;191:110064.10.1016/j.envres.2020.110064Search in Google Scholar PubMed

[16] Chug R, Gour VS, Mathur S, Kothari SL. Optimization of extracellular polymeric substances production using Azotobacter beijreinckii and Bacillus subtilis and its application in chromium(vi) removal. Bioresour Techno. 2016;214:604–8.10.1016/j.biortech.2016.05.010Search in Google Scholar PubMed

[17] Batool R, Yrjälä K, Shaukat K, Jamil N, Hasnain S. Production of EPS under Cr(vi) challenge in two indigenous bacteria isolated from a tannery effluent. J Basic Microbiol. 2015;55(9):1064–74.10.1002/jobm.201400885Search in Google Scholar PubMed

[18] Zeng W, Li F, Wu C, Yu R, Wu X, Shen L, et al. Role of extracellular polymeric substance (EPS) in toxicity response of soil bacteria Bacillus sp. S3 to multiple heavy metals. Biopro Biosys Eng. 2020;43(1):153–67.10.1007/s00449-019-02213-7Search in Google Scholar PubMed

[19] Ashayeri-Panah M, Feizabadi MM, Eftekhar F. Correlation of multi-drug resistance, integron and blaESBL gene carriage with genetic fingerprints of extended-spectrum β-lactamase producing Klebsiella pneumoniae. Jundishapur J Microbiol. 2014;7:2.10.5812/jjm.8747Search in Google Scholar PubMed PubMed Central

[20] Monsieurs P, Moors H, Van Houdt R, Janssen PJ, Janssen A, Coninx I, et al. Heavy metal resistance in Cupriavidus metallidurans CH34 is governed by an intricate transcriptional network. Biometals. 2011;24(6):1133–51.10.1007/s10534-011-9473-ySearch in Google Scholar PubMed

[21] Steel RGD, Torrie JH. Principles and procedures of statistics: a biometrical approach. New York: McGraw-Hill; 1986.Search in Google Scholar

[22] Ramírez V, Baez A, López P, Bustillos R, Villalobos M-A, Carreño R, et al. Chromium hyper-tolerant Bacillus sp. MH778713 assists phytoremediation of heavy metals by mesquite trees (Prosopis laevigata). Front Microbiol. 2019;10:1833.10.3389/fmicb.2019.01833Search in Google Scholar PubMed PubMed Central

[23] Lotlikar NP, Damare SR, Meena RM, Linsy P, Mascarenhas B. Potential of marine-derived fungi to remove hexavalent chromium pollutant from culture broth. Indian J Microbiol. 2018;58(2):182–92.10.1007/s12088-018-0719-zSearch in Google Scholar PubMed PubMed Central

[24] He J, Chen X, Zhang Q, Achal V. More effective immobilization of divalent lead than hexavalent chromium through carbonate mineralization by Staphylococcus epidermidis HJ2. Inter Biodeter Biodegrad. 2019;140:67–71.10.1016/j.ibiod.2019.03.012Search in Google Scholar

[25] El-Naggar NE-A, El-Khateeb AY, Ghoniem AA, El-Hersh MS, Saber WI. Innovative low-cost biosorption process of Cr 6+ by Pseudomonas alcaliphila NEWG-2. Sci Rep. 2020;10(1):1–18.10.1038/s41598-020-70473-5Search in Google Scholar

[26] Bai Y-N, Lu Y-Z, Shen N, Lau T-C, Zeng RJ. Investigation of Cr(vi) reduction potential and mechanism by Caldicellulosiruptor saccharolyticus under glucose fermentation condition. J Hazard Mater. 2018;344:585–92.10.1016/j.jhazmat.2017.10.059Search in Google Scholar PubMed

[27] Bharagava RN, Mishra S. Hexavalent chromium reduction potential of Cellulosimicrobium sp. isolated from common effluent treatment plant of tannery industries. Ecotoxicol Environ Saf. 2018;147:102–9.10.1016/j.ecoenv.2017.08.040Search in Google Scholar PubMed

[28] Elsayed AF, El Shatoury E, Tolba S. Hexavalent chromate reduction in soil microcosm using bacterial consortium. Egyptian J Exper Biol (Botany). 2019;15:2.10.5455/egyjebb.20190818073117Search in Google Scholar

[29] Shahnaz T, Sharma V, Subbiah S, Narayanasamy S. Multivariate optimisation of Cr(vi), Co(iii) and Cu(ii) adsorption onto nanobentonite incorporated nanocellulose/chitosan aerogel using response surface methodology. J Water Process Eng. 2020;36:101283.10.1016/j.jwpe.2020.101283Search in Google Scholar

[30] Jobby R, Jha P, Gupta A, Gupte A, Desai N. Biotransformation of chromium by root nodule bacteria Sinorhizobium sp. SAR1. PloS one. 2019;14(7):e0219387.10.1371/journal.pone.0219387Search in Google Scholar PubMed PubMed Central

[31] Zhang Z, Cai R, Zhang W, Fu Y, Jiao N. A novel exopolysaccharide with metal adsorption capacity produced by a marine bacterium Alteromonas sp. JL2810. Marine Drugs. 2017;15(6):175.10.3390/md15060175Search in Google Scholar PubMed PubMed Central

[32] Shahnaz T, Patra C, Sharma V, Selvaraju N. A comparative study of raw, acid-modified and EDTA-complexed Acacia auriculiformis biomass for the removal of hexavalent chromium. Chem Ecol. 2020;36(4):360–81.10.1080/02757540.2020.1723560Search in Google Scholar

[33] Mala JGS, Sujatha D, Rose C. Inducible chromate reductase exhibiting extracellular activity in Bacillus methylotrophicus for chromium bioremediation. Microbiol Res. 2015;170:235–41.10.1016/j.micres.2014.06.001Search in Google Scholar PubMed

[34] Wani PA, Wahid S, Singh R, Kehinde AM. Antioxidant and chromium reductase assisted chromium(vi) reduction and Cr(iii) immobilization by the rhizospheric Bacillus helps in the remediation of Cr(vi) and growth promotion of soybean crop. Rhizosphere. 2018;6:23–30.10.1016/j.rhisph.2018.01.004Search in Google Scholar

[35] Zhu Y, Yan J, Xia L, Zhang X, Luo L. Mechanisms of Cr(vi) reduction by Bacillus sp. CRB-1, a novel Cr(vi)-reducing bacterium isolated from tannery activated sludge. Ecotoxicol Environ Saf. 2019;186:109792.10.1016/j.ecoenv.2019.109792Search in Google Scholar PubMed

[36] Wani PA, Garba SH, Wahid S, Hussaini NA, Mashood KA. Prevention of oxidative damage and phytoremediation of Cr(vi) by chromium(vi) reducing Bacillus subtilus PAW3 in Cowpea plants. Bulle Environ Contam Toxicol. 2019;103(3):476–83.10.1007/s00128-019-02683-1Search in Google Scholar PubMed

[37] Kathiravan MN, Karthick R, Muthukumar K. Ex situ bioremediation of Cr(vi) contaminated soil by Bacillus sp.: batch and continuous studies. Chem Eng J. 2011;169(1–3):107–15.10.1016/j.cej.2011.02.060Search in Google Scholar

[38] McLean JS, Beveridge TJ, Phipps D. Isolation and characterization of a chromium‐reducing bacterium from a chromated copper arsenate‐contaminated site. Environ Microbiol. 2000;2(6):611–9.10.1046/j.1462-2920.2000.00143.xSearch in Google Scholar PubMed

[39] Shi T, Wang Z, Liu Y, Jia S, Changming D. Removal of hexavalent chromium from aqueous solutions by D301, D314 and D354 anion-exchange resins. J Hazard Mater. 2009;161(2–3):900–6.10.1016/j.jhazmat.2008.04.041Search in Google Scholar PubMed

[40] Tripathi M, Garg SK. Co-remediation of pentachlorophenol and Cr6+ by free and immobilized cells of native Bacillus cereus isolate: spectrometric characterization of PCP dechlorination products, bioreactor trial and chromate reductase activity. Process Biochem. 2013;48(3):496–509.10.1016/j.procbio.2013.02.009Search in Google Scholar

[41] Quintelas C, da Silva VB, Silva B, Figueiredo H, Tavares T. Optimization of production of extracellular polymeric substances by Arthrobacter viscosus and their interaction with a 13X zeolite for the biosorption of Cr(vi). Environ Technol. 2011;32(14):1541–9.10.1080/09593330.2010.543930Search in Google Scholar PubMed

[42] Czaczyk K, Myszka K. Biosynthesis of extracellular polymeric substances (EPS) and its role in microbial biofilm formation. Polish J Environ Stud. 2007;16:6.Search in Google Scholar

[43] Wu Y, Xia L, Yu Z, Shabbir S, Kerr PG. In situ bioremediation of surface waters by periphytons. Bioresou Technol. 2014;151:367–72.10.1016/j.biortech.2013.10.088Search in Google Scholar PubMed

[44] Ozturk S, Aslim B, Suludere Z. Cadmium(ii) sequestration characteristics by two isolates of Synechocystis sp. in terms of exopolysaccharide (EPS) production and monomer composition. Bioresou Technol. 2010;101(24):9742–8.10.1016/j.biortech.2010.07.105Search in Google Scholar PubMed

[45] Karthik C, Elangovan N, Kumar TS, Govindharaju S, Barathi S, Oves M, et al. Characterization of multifarious plant growth promoting traits of rhizobacterial strain AR6 under chromium(vi) stress. Microbiol Res. 2017;204:65–71.10.1016/j.micres.2017.07.008Search in Google Scholar PubMed

[46] Oves M, Khan MS, Zaidi A. Biosorption of heavy metals by Bacillus thuringiensis strain OSM29 originating from industrial effluent contaminated north Indian soil. Saudi J Biolog Sci. 2013;20(2):121–9.10.1016/j.sjbs.2012.11.006Search in Google Scholar PubMed PubMed Central

[47] Cerning J, Renard CMGC, Thibault JF, Bouillanne C, Landon M, Desmazeaud M, et al. Carbon source requirements for exopolysaccharide production by Lactobacillus casei CG11 and partial structure analysis of the polymer. Appl Environ Microbiol. 1994;60(11):3914–9.10.1128/aem.60.11.3914-3919.1994Search in Google Scholar PubMed PubMed Central

[48] Singh A, Vyas D, Malaviya P. Two-stage phyto-microremediation of tannery effluent by Spirodela polyrrhiza (L.) Schleid. and chromium resistant bacteria. Bioresou Technol. 2016;216:883–93.10.1016/j.biortech.2016.06.025Search in Google Scholar PubMed

[49] Patra RC, Malik S, Beer M, Megharaj M, Naidu R. Molecular characterization of chromium(vi) reducing potential in Gram positive bacteria isolated from contaminated sites. Soil Biol Biochem. 2010;42(10):1857–63.10.1016/j.soilbio.2010.07.005Search in Google Scholar

[50] Deng P, Tan X, Wu Y, Bai Q, Jia Y, Xiao H. Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp. Exp Ther Med. 2015;9(3):795–800.10.3892/etm.2014.2148Search in Google Scholar PubMed PubMed Central

[51] Aguilar-Barajas E, Paluscio E, Cervantes C, Rensing C. Expression of chromate resistance genes from Shewanella sp. strain ANA-3 in Escherichia coli. FEMS Microbiol Lett. 2008;285(1):97–100.10.1111/j.1574-6968.2008.01220.xSearch in Google Scholar PubMed

[52] Gillings MR. Integrons: past, present, and future. Microbiol Molecul Biol Rev. 2014;78(2):257–77.10.1128/MMBR.00056-13Search in Google Scholar PubMed PubMed Central

[53] Jang HM, Lee J, Choi S, Shin J, Kan E, Kim YM. Response of antibiotic and heavy metal resistance genes to two different temperature sequences in anaerobic digestion of waste activated sludge. Bioresour Technol. 2018;267:303–10.10.1016/j.biortech.2018.07.051Search in Google Scholar PubMed

[54] Juhnke S, Peitzsch N, Hübener N, Große C, Nies DH. New genes involved in chromate resistance in Ralstonia metallidurans strain CH34. Arch Microbiol. 2002;179(1):15–25.10.1007/s00203-004-0665-5Search in Google Scholar
Received: 2021-01-15
Revised: 2021-03-04
Accepted: 2021-03-14
Published Online: 2021-05-05

© 2021 Asma Kalsoom et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. MW irradiation and ionic liquids as green tools in hydrolyses and alcoholyses
  3. Effect of CaO on catalytic combustion of semi-coke
  4. Studies of Penicillium species associated with blue mold disease of grapes and management through plant essential oils as non-hazardous botanical fungicides
  5. Development of leftover rice/gelatin interpenetrating polymer network films for food packaging
  6. Potent antibacterial action of phycosynthesized selenium nanoparticles using Spirulina platensis extract
  7. Green synthesized silver and copper nanoparticles induced changes in biomass parameters, secondary metabolites production, and antioxidant activity in callus cultures of Artemisia absinthium L.
  8. Gold nanoparticles from Celastrus hindsii and HAuCl4: Green synthesis, characteristics, and their cytotoxic effects on HeLa cells
  9. Green synthesis of silver nanoparticles using Tropaeolum majus: Phytochemical screening and antibacterial studies
  10. One-step preparation of metal-free phthalocyanine with controllable crystal form
  11. In vitro and in vivo applications of Euphorbia wallichii shoot extract-mediated gold nanospheres
  12. Fabrication of green ZnO nanoparticles using walnut leaf extract to develop an antibacterial film based on polyethylene–starch–ZnO NPs
  13. Preparation of Zn-MOFs by microwave-assisted ball milling for removal of tetracycline hydrochloride and Congo red from wastewater
  14. Feasibility of fly ash as fluxing agent in mid- and low-grade phosphate rock carbothermal reduction and its reaction kinetics
  15. Three combined pretreatments for reactive gasification feedstock from wet coffee grounds waste
  16. Biosynthesis and antioxidation of nano-selenium using lemon juice as a reducing agent
  17. Combustion and gasification characteristics of low-temperature pyrolytic semi-coke prepared through atmosphere rich in CH4 and H2
  18. Microwave-assisted reactions: Efficient and versatile one-step synthesis of 8-substituted xanthines and substituted pyrimidopteridine-2,4,6,8-tetraones under controlled microwave heating
  19. New approach in process intensification based on subcritical water, as green solvent, in propolis oil in water nanoemulsion preparation
  20. Continuous sulfonation of hexadecylbenzene in a microreactor
  21. Synthesis, characterization, biological activities, and catalytic applications of alcoholic extract of saffron (Crocus sativus) flower stigma-based gold nanoparticles
  22. Foliar applications of plant-based titanium dioxide nanoparticles to improve agronomic and physiological attributes of wheat (Triticum aestivum L.) plants under salinity stress
  23. Simultaneous leaching of rare earth elements and phosphorus from a Chinese phosphate ore using H3PO4
  24. Silica extraction from bauxite reaction residue and synthesis water glass
  25. Metal–organic framework-derived nanoporous titanium dioxide–heteropoly acid composites and its application in esterification
  26. Highly Cr(vi)-tolerant Staphylococcus simulans assisting chromate evacuation from tannery effluent
  27. A green method for the preparation of phoxim based on high-boiling nitrite
  28. Silver nanoparticles elicited physiological, biochemical, and antioxidant modifications in rice plants to control Aspergillus flavus
  29. Mixed gel electrolytes: Synthesis, characterization, and gas release on PbSb electrode
  30. Supported on mesoporous silica nanospheres, molecularly imprinted polymer for selective adsorption of dichlorophen
  31. Synthesis of zeolite from fly ash and its adsorption of phosphorus in wastewater
  32. Development of a continuous PET depolymerization process as a basis for a back-to-monomer recycling method
  33. Green synthesis of ZnS nanoparticles and fabrication of ZnS–chitosan nanocomposites for the removal of Cr(vi) ion from wastewater
  34. Synthesis, surface modification, and characterization of Fe3O4@SiO2 core@shell nanostructure
  35. Antioxidant potential of bulk and nanoparticles of naringenin against cadmium-induced oxidative stress in Nile tilapia, Oreochromis niloticus
  36. Variability and improvement of optical and antimicrobial performances for CQDs/mesoporous SiO2/Ag NPs composites via in situ synthesis
  37. Green synthesis of silver nanoparticles: Characterization and its potential biomedical applications
  38. Green synthesis, characterization, and antimicrobial activity of silver nanoparticles prepared using Trigonella foenum-graecum L. leaves grown in Saudi Arabia
  39. Intensification process in thyme essential oil nanoemulsion preparation based on subcritical water as green solvent and six different emulsifiers
  40. Synthesis and biological activities of alcohol extract of black cumin seeds (Bunium persicum)-based gold nanoparticles and their catalytic applications
  41. Digera muricata (L.) Mart. mediated synthesis of antimicrobial and enzymatic inhibitory zinc oxide bionanoparticles
  42. Aqueous synthesis of Nb-modified SnO2 quantum dots for efficient photocatalytic degradation of polyethylene for in situ agricultural waste treatment
  43. Study on the effect of microwave roasting pretreatment on nickel extraction from nickel-containing residue using sulfuric acid
  44. Green nanotechnology synthesized silver nanoparticles: Characterization and testing its antibacterial activity
  45. Phyto-fabrication of selenium nanorods using extract of pomegranate rind wastes and their potentialities for inhibiting fish-borne pathogens
  46. Hydrophilic modification of PVDF membranes by in situ synthesis of nano-Ag with nano-ZrO2
  47. Paracrine study of adipose tissue-derived mesenchymal stem cells (ADMSCs) in a self-assembling nano-polypeptide hydrogel environment
  48. Study of the corrosion-inhibiting activity of the green materials of the Posidonia oceanica leaves’ ethanolic extract based on PVP in corrosive media (1 M of HCl)
  49. Callus-mediated biosynthesis of Ag and ZnO nanoparticles using aqueous callus extract of Cannabis sativa: Their cytotoxic potential and clinical potential against human pathogenic bacteria and fungi
  50. Ionic liquids as capping agents of silver nanoparticles. Part II: Antimicrobial and cytotoxic study
  51. CO2 hydrogenation to dimethyl ether over In2O3 catalysts supported on aluminosilicate halloysite nanotubes
  52. Corylus avellana leaf extract-mediated green synthesis of antifungal silver nanoparticles using microwave irradiation and assessment of their properties
  53. Novel design and combination strategy of minocycline and OECs-loaded CeO2 nanoparticles with SF for the treatment of spinal cord injury: In vitro and in vivo evaluations
  54. Fe3+ and Ce3+ modified nano-TiO2 for degradation of exhaust gas in tunnels
  55. Analysis of enzyme activity and microbial community structure changes in the anaerobic digestion process of cattle manure at sub-mesophilic temperatures
  56. Synthesis of greener silver nanoparticle-based chitosan nanocomposites and their potential antimicrobial activity against oral pathogens
  57. Baeyer–Villiger co-oxidation of cyclohexanone with Fe–Sn–O catalysts in an O2/benzaldehyde system
  58. Increased flexibility to improve the catalytic performance of carbon-based solid acid catalysts
  59. Study on titanium dioxide nanoparticles as MALDI MS matrix for the determination of lipids in the brain
  60. Green-synthesized silver nanoparticles with aqueous extract of green algae Chaetomorpha ligustica and its anticancer potential
  61. Curcumin-removed turmeric oleoresin nano-emulsion as a novel botanical fungicide to control anthracnose (Colletotrichum gloeosporioides) in litchi
  62. Antibacterial greener silver nanoparticles synthesized using Marsilea quadrifolia extract and their eco-friendly evaluation against Zika virus vector, Aedes aegypti
  63. Optimization for simultaneous removal of NH3-N and COD from coking wastewater via a three-dimensional electrode system with coal-based electrode materials by RSM method
  64. Effect of Cu doping on the optical property of green synthesised l-cystein-capped CdSe quantum dots
  65. Anticandidal potentiality of biosynthesized and decorated nanometals with fucoidan
  66. Biosynthesis of silver nanoparticles using leaves of Mentha pulegium, their characterization, and antifungal properties
  67. A study on the coordination of cyclohexanocucurbit[6]uril with copper, zinc, and magnesium ions
  68. Ultrasound-assisted l-cysteine whole-cell bioconversion by recombinant Escherichia coli with tryptophan synthase
  69. Green synthesis of silver nanoparticles using aqueous extract of Citrus sinensis peels and evaluation of their antibacterial efficacy
  70. Preparation and characterization of sodium alginate/acrylic acid composite hydrogels conjugated to silver nanoparticles as an antibiotic delivery system
  71. Synthesis of tert-amylbenzene for side-chain alkylation of cumene catalyzed by a solid superbase
  72. Punica granatum peel extracts mediated the green synthesis of gold nanoparticles and their detailed in vivo biological activities
  73. Simulation and improvement of the separation process of synthesizing vinyl acetate by acetylene gas-phase method
  74. Review Articles
  75. Carbon dots: Discovery, structure, fluorescent properties, and applications
  76. Potential applications of biogenic selenium nanoparticles in alleviating biotic and abiotic stresses in plants: A comprehensive insight on the mechanistic approach and future perspectives
  77. Review on functionalized magnetic nanoparticles for the pretreatment of organophosphorus pesticides
  78. Extraction and modification of hemicellulose from lignocellulosic biomass: A review
  79. Topical Issue: Recent advances in deep eutectic solvents: Fundamentals and applications (Guest Editors: Santiago Aparicio and Mert Atilhan)
  80. Delignification of unbleached pulp by ternary deep eutectic solvents
  81. Removal of thiophene from model oil by polyethylene glycol via forming deep eutectic solvents
  82. Valorization of birch bark using a low transition temperature mixture composed of choline chloride and lactic acid
  83. Topical Issue: Flow chemistry and microreaction technologies for circular processes (Guest Editor: Gianvito Vilé)
  84. Stille, Heck, and Sonogashira coupling and hydrogenation catalyzed by porous-silica-gel-supported palladium in batch and flow
  85. In-flow enantioselective homogeneous organic synthesis
https://doi.org/10.1515/gps-2021-0027
Keywords for this article
chromium resistance; tannery effluent; scanning electron microscopy; heavy metals; environmental contamination
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. MW irradiation and ionic liquids as green tools in hydrolyses and alcoholyses
  3. Effect of CaO on catalytic combustion of semi-coke
  4. Studies of Penicillium species associated with blue mold disease of grapes and management through plant essential oils as non-hazardous botanical fungicides
  5. Development of leftover rice/gelatin interpenetrating polymer network films for food packaging
  6. Potent antibacterial action of phycosynthesized selenium nanoparticles using Spirulina platensis extract
  7. Green synthesized silver and copper nanoparticles induced changes in biomass parameters, secondary metabolites production, and antioxidant activity in callus cultures of Artemisia absinthium L.
  8. Gold nanoparticles from Celastrus hindsii and HAuCl4: Green synthesis, characteristics, and their cytotoxic effects on HeLa cells
  9. Green synthesis of silver nanoparticles using Tropaeolum majus: Phytochemical screening and antibacterial studies
  10. One-step preparation of metal-free phthalocyanine with controllable crystal form
  11. In vitro and in vivo applications of Euphorbia wallichii shoot extract-mediated gold nanospheres
  12. Fabrication of green ZnO nanoparticles using walnut leaf extract to develop an antibacterial film based on polyethylene–starch–ZnO NPs
  13. Preparation of Zn-MOFs by microwave-assisted ball milling for removal of tetracycline hydrochloride and Congo red from wastewater
  14. Feasibility of fly ash as fluxing agent in mid- and low-grade phosphate rock carbothermal reduction and its reaction kinetics
  15. Three combined pretreatments for reactive gasification feedstock from wet coffee grounds waste
  16. Biosynthesis and antioxidation of nano-selenium using lemon juice as a reducing agent
  17. Combustion and gasification characteristics of low-temperature pyrolytic semi-coke prepared through atmosphere rich in CH4 and H2
  18. Microwave-assisted reactions: Efficient and versatile one-step synthesis of 8-substituted xanthines and substituted pyrimidopteridine-2,4,6,8-tetraones under controlled microwave heating
  19. New approach in process intensification based on subcritical water, as green solvent, in propolis oil in water nanoemulsion preparation
  20. Continuous sulfonation of hexadecylbenzene in a microreactor
  21. Synthesis, characterization, biological activities, and catalytic applications of alcoholic extract of saffron (Crocus sativus) flower stigma-based gold nanoparticles
  22. Foliar applications of plant-based titanium dioxide nanoparticles to improve agronomic and physiological attributes of wheat (Triticum aestivum L.) plants under salinity stress
  23. Simultaneous leaching of rare earth elements and phosphorus from a Chinese phosphate ore using H3PO4
  24. Silica extraction from bauxite reaction residue and synthesis water glass
  25. Metal–organic framework-derived nanoporous titanium dioxide–heteropoly acid composites and its application in esterification
  26. Highly Cr(vi)-tolerant Staphylococcus simulans assisting chromate evacuation from tannery effluent
  27. A green method for the preparation of phoxim based on high-boiling nitrite
  28. Silver nanoparticles elicited physiological, biochemical, and antioxidant modifications in rice plants to control Aspergillus flavus
  29. Mixed gel electrolytes: Synthesis, characterization, and gas release on PbSb electrode
  30. Supported on mesoporous silica nanospheres, molecularly imprinted polymer for selective adsorption of dichlorophen
  31. Synthesis of zeolite from fly ash and its adsorption of phosphorus in wastewater
  32. Development of a continuous PET depolymerization process as a basis for a back-to-monomer recycling method
  33. Green synthesis of ZnS nanoparticles and fabrication of ZnS–chitosan nanocomposites for the removal of Cr(vi) ion from wastewater
  34. Synthesis, surface modification, and characterization of Fe3O4@SiO2 core@shell nanostructure
  35. Antioxidant potential of bulk and nanoparticles of naringenin against cadmium-induced oxidative stress in Nile tilapia, Oreochromis niloticus
  36. Variability and improvement of optical and antimicrobial performances for CQDs/mesoporous SiO2/Ag NPs composites via in situ synthesis
  37. Green synthesis of silver nanoparticles: Characterization and its potential biomedical applications
  38. Green synthesis, characterization, and antimicrobial activity of silver nanoparticles prepared using Trigonella foenum-graecum L. leaves grown in Saudi Arabia
  39. Intensification process in thyme essential oil nanoemulsion preparation based on subcritical water as green solvent and six different emulsifiers
  40. Synthesis and biological activities of alcohol extract of black cumin seeds (Bunium persicum)-based gold nanoparticles and their catalytic applications
  41. Digera muricata (L.) Mart. mediated synthesis of antimicrobial and enzymatic inhibitory zinc oxide bionanoparticles
  42. Aqueous synthesis of Nb-modified SnO2 quantum dots for efficient photocatalytic degradation of polyethylene for in situ agricultural waste treatment
  43. Study on the effect of microwave roasting pretreatment on nickel extraction from nickel-containing residue using sulfuric acid
  44. Green nanotechnology synthesized silver nanoparticles: Characterization and testing its antibacterial activity
  45. Phyto-fabrication of selenium nanorods using extract of pomegranate rind wastes and their potentialities for inhibiting fish-borne pathogens
  46. Hydrophilic modification of PVDF membranes by in situ synthesis of nano-Ag with nano-ZrO2
  47. Paracrine study of adipose tissue-derived mesenchymal stem cells (ADMSCs) in a self-assembling nano-polypeptide hydrogel environment
  48. Study of the corrosion-inhibiting activity of the green materials of the Posidonia oceanica leaves’ ethanolic extract based on PVP in corrosive media (1 M of HCl)
  49. Callus-mediated biosynthesis of Ag and ZnO nanoparticles using aqueous callus extract of Cannabis sativa: Their cytotoxic potential and clinical potential against human pathogenic bacteria and fungi
  50. Ionic liquids as capping agents of silver nanoparticles. Part II: Antimicrobial and cytotoxic study
  51. CO2 hydrogenation to dimethyl ether over In2O3 catalysts supported on aluminosilicate halloysite nanotubes
  52. Corylus avellana leaf extract-mediated green synthesis of antifungal silver nanoparticles using microwave irradiation and assessment of their properties
  53. Novel design and combination strategy of minocycline and OECs-loaded CeO2 nanoparticles with SF for the treatment of spinal cord injury: In vitro and in vivo evaluations
  54. Fe3+ and Ce3+ modified nano-TiO2 for degradation of exhaust gas in tunnels
  55. Analysis of enzyme activity and microbial community structure changes in the anaerobic digestion process of cattle manure at sub-mesophilic temperatures
  56. Synthesis of greener silver nanoparticle-based chitosan nanocomposites and their potential antimicrobial activity against oral pathogens
  57. Baeyer–Villiger co-oxidation of cyclohexanone with Fe–Sn–O catalysts in an O2/benzaldehyde system
  58. Increased flexibility to improve the catalytic performance of carbon-based solid acid catalysts
  59. Study on titanium dioxide nanoparticles as MALDI MS matrix for the determination of lipids in the brain
  60. Green-synthesized silver nanoparticles with aqueous extract of green algae Chaetomorpha ligustica and its anticancer potential
  61. Curcumin-removed turmeric oleoresin nano-emulsion as a novel botanical fungicide to control anthracnose (Colletotrichum gloeosporioides) in litchi
  62. Antibacterial greener silver nanoparticles synthesized using Marsilea quadrifolia extract and their eco-friendly evaluation against Zika virus vector, Aedes aegypti
  63. Optimization for simultaneous removal of NH3-N and COD from coking wastewater via a three-dimensional electrode system with coal-based electrode materials by RSM method
  64. Effect of Cu doping on the optical property of green synthesised l-cystein-capped CdSe quantum dots
  65. Anticandidal potentiality of biosynthesized and decorated nanometals with fucoidan
  66. Biosynthesis of silver nanoparticles using leaves of Mentha pulegium, their characterization, and antifungal properties
  67. A study on the coordination of cyclohexanocucurbit[6]uril with copper, zinc, and magnesium ions
  68. Ultrasound-assisted l-cysteine whole-cell bioconversion by recombinant Escherichia coli with tryptophan synthase
  69. Green synthesis of silver nanoparticles using aqueous extract of Citrus sinensis peels and evaluation of their antibacterial efficacy
  70. Preparation and characterization of sodium alginate/acrylic acid composite hydrogels conjugated to silver nanoparticles as an antibiotic delivery system
  71. Synthesis of tert-amylbenzene for side-chain alkylation of cumene catalyzed by a solid superbase
  72. Punica granatum peel extracts mediated the green synthesis of gold nanoparticles and their detailed in vivo biological activities
  73. Simulation and improvement of the separation process of synthesizing vinyl acetate by acetylene gas-phase method
  74. Review Articles
  75. Carbon dots: Discovery, structure, fluorescent properties, and applications
  76. Potential applications of biogenic selenium nanoparticles in alleviating biotic and abiotic stresses in plants: A comprehensive insight on the mechanistic approach and future perspectives
  77. Review on functionalized magnetic nanoparticles for the pretreatment of organophosphorus pesticides
  78. Extraction and modification of hemicellulose from lignocellulosic biomass: A review
  79. Topical Issue: Recent advances in deep eutectic solvents: Fundamentals and applications (Guest Editors: Santiago Aparicio and Mert Atilhan)
  80. Delignification of unbleached pulp by ternary deep eutectic solvents
  81. Removal of thiophene from model oil by polyethylene glycol via forming deep eutectic solvents
  82. Valorization of birch bark using a low transition temperature mixture composed of choline chloride and lactic acid
  83. Topical Issue: Flow chemistry and microreaction technologies for circular processes (Guest Editor: Gianvito Vilé)
  84. Stille, Heck, and Sonogashira coupling and hydrogenation catalyzed by porous-silica-gel-supported palladium in batch and flow
  85. In-flow enantioselective homogeneous organic synthesis
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 2.10.2025 from https://www.degruyterbrill.com/document/doi/10.1515/gps-2021-0027/html
Scroll to top button