Home Inhibition of vitamin D analog eldecalcitol on hepatoma in vitro and in vivo
Article Open Access

Inhibition of vitamin D analog eldecalcitol on hepatoma in vitro and in vivo

  • Limin Ye EMAIL logo , Liyi Zhu , Jinglin Wang and Fei Li
Published/Copyright: July 13, 2020

Abstract

Hepatoma is a serious liver cancer with high morbidity and mortality. Eldecalcitol (ED-71), a vitamin D analog, is extensively used as anti-cancer agent in vitro. Hepatocellular carcinoma cell, SMMC-7721 cell lines were used in this study. Transwell assay, cell apoptosis and cell cycle detection assays were investigated after treatment with ED-71 and phosphate buffered saline (PBS) as control. Sizes of tumors were measured after ED-71 treatment in a mouse model. E-cadherin and Akt gene expressions were detected by real-time PCR (RT-PCR). The results showed that cell invasion and migration were decreased markedly after ED-71 treatment compared to control group. Cell cycle detection showed that the G2 stage was 13.18% and total S-stage was 41.16% in the ED-71 group and G2 stage: 22.88%, total S-stage: 27.34% in the control group. Cell apoptosis rate was promoted in the ED-71 group. Size of the tumors reduced more after the ED-71 treatment than the PBS treatment in mice. ED-71 markedly inhibited the expression of Akt and E-cadherin, either detected by immunohistochemistry or RT-PCR. ED-71 treatment can inhibit the hepatoma agent proliferation by increasing the E-cadherin expression and decreasing Akt expression. Therefore, these findings provide novel evidence that ED-71 can be used as an anti-hepatoma agent.

1 Introduction

Hepatocellular carcinoma (HCC) is one of the most common liver cancers globally causing high risk of death in spite of advanced medical diagnosis by liver transplantation or ablation treatment, new molecular technologies [1,2]. The key technical challenge is how to identify the higher risk stage of malignant transformation patients [3]. Although histopathology diagnostics combined with advances in different forms of surgical or chemotherapy therapy have improved the results for tumor patients to a large extent [4,5], there are still no effective drugs used to inhibit tumor cell growth clinically [6]. The only systemic therapy drug for HCC is sorafenib, which is an oral multikinase inhibitor only for patients with inoperable or advanced HCC [7]. Therefore, there should be many challenges for finding the drugs curing the HCC.

Eldecalcitol, (1α, 25-dihydroxy-2β-[3-hydroxypropyloxy] vitamin D3), also called ED-71, which is a novel analog of vitamin D, has been widely used for the treatment of osteoporosis [8]. Eldecalcitol plays an important role in regulating the metabolism of bone as well as calcium, it was particularly used for patients who were suffering from vitamin D deficiency. Clinical trials suggested that eldecalcitol possessed a strong inhibitory influence on the resorption of bone [9,10]. However, recent reports have showed that eldecalcitol can also be used for anti-cancer function of oral squamous cell carcinomas (OSCCs) in vitro by inhibiting the cancer cell line growth [11]. Eldecalcitol can affect the substance of Cyp24A1 expression in the cancer cells [12]. Due to the Cyp24A1 mRNA expression up-regulation and interaction with the calcitriol anti-proliferative functions [13], the calcitriol level may decrease to prevent the application of vitamin D3 for the therapy of different cancers. Therefore, eldecalcitol was used for substituting the vitamin D3 avoiding the hypercalcemia.

Meanwhile, whether eldecalcitol has an inhibiting effect on the hepatoma agents is still unknown. Herein, we explored the function of eldecalcitol on the hepatoma cell including E-cadherin and Akt gene expression change for the first time; further, the features of transwell assays, such as cell invasion and migration, cell apoptosis as well as cell cycles, were measured post ED-71 treatment. In addition, with a mouse model, the tumor cell growth was compared post eldecalcitol treatment and the tumor tissues were analyzed by immunohistochemistry experiments. Taken together, this work may offer a novel view for hepatoma therapy.

2 Materials and methods

2.1 Cell culture

HCC cell, SMMC-7721 cell line purchased from the Chinese Academy of Sciences (Beijing, China) was used in the study. All cells were cultured in the RPMI medium mixed with 10% fetal bovine serum (FBS), penicillin–streptomycin (100 IU/mL), and trypsin (100 µg/mL) in a cabinet (Thermo Scientific, USA) containing 5% CO2 and saturated humidity at 37°C. One milliliter of trypsin was added for digestion for 1 min, followed by adding 2 mL of complete medium to terminate the digestion. After centrifugation (1,000 rpm) for 3 min, the precipitated cells were collected, and the new cell suspension was re-suspended with complete medium to be transferred or inoculated in the required proportion.

2.2 Flow cytometry analysis

Flow cytometry analysis was conducted, as described previously [14,15]. Cells (8 × 103) were seeded into 6-well plates and cultured for 24 h in a cabinet. After treatment with ED-71 for another 48 h, cells (1 × 105/mL) were digested, and centrifuged to collect the cell pellet, and then suspended in 1 mL binding buffer containing 10 µL Annexin V-FITC (Haoxin Biotech, China) and 10 µL propidium iodide (PI) (Abcam Biotech, UK). After incubation for 10 min at room temperature in the dark, apoptosis was counted through flow cytometry. The apoptotic rate was scored by quantifying apoptosis (Annexin V-FITC + PI).

2.3 Cell intervention experiment

The cells were digested and counted when cell density reached 80% confluence. The cells were then transferred to 6-well plates according to the density of 8 × 105/mL and cultured overnight in the incubator. On the following day, the drug was added to the 6-well plate by ED-71 (0.5 nM) treatment and PBS as control. After ED-71 was added, the cells were cultured for 48 h. Cell apoptosis and cycles were performed by the flow cytometry with the Annexin-V and PI kit.

2.4 Transwell assay

Transwell assay was conducted, as described previously [16]. Briefly, serum-free cell suspensions (2.5 × 104 cells/mL) were made and 0.1 mL of the cell suspension was seeded to the top chamber of the transwell plates. Culture medium containing 10% FBS was added into the lower chamber. Cells were cultivated for 24 h at 37°C 5% CO2. Membranes were cleaned using a cotton swab, followed by fixing with 4% polyformaldehyde (10 min). After washing twice, the top chamber was stained with 0.5% crystal violet (Sigma-Aldrich; St. Louis, USA) for 15 min at room temperature. The experiments were performed in triplicate. Cells were observed and counted under Olympus CX43 light microscope (×40 magnification). Then invasive cells in three fields were counted, and the average number was calculated.

2.5 Wound healing assay

Cells (2 × 103) were seeded in a 6-well plate and cultured at 37°C 5% CO2. When cell density reached 80% confluence, a strict line was conducted using a sterile 1 mL pipette tip. After 48 h incubation, migrated distance of cells was calculated, and pictures were captured. The migrated distance after 48 h in three fields was counted, and the average number was calculated.

2.6 Immunohistochemistry experiment

The tumor tissues were fixed in 10% formalin overnight. The tissues were embedded in optimal cutting temperature (OCT, tissue freezing medium) compound (Bai’ao Biotech, China). The embedded tissues were cross-sectioned in 12 µm thickness. After antigen repair, tissues were washed three times (3 min/time). Three percent H2O2 was used to culture tissues for 10 min at room temperature. After washing three times (3 min/time), 10% goat serum was used for blocking. The primary antibodies of Akt (Rabbit anti-Akt, ab179463, Abcam, UK) and E-cadherin (Rabbit anti-E-cadherin, ab40772, Abcam, UK) were used to culture tissues at 4°C overnight. After washing, the tissues were incubated with goat anti-rabbit IgG (ab205718, Abcam, UK) for 1 h. Color development reagent, DAB reagent, was used to incubate with tissues, and photographed, and analyzed using an Olympus BX41 microscope (Tokyo, Japan).

2.7 RNA isolation and real-time PCR (RT-PCR)

RNA isolation and real-time PCR were performed, as described previously [17]. RNA isolation: Cells were subjected to extract total RNA using TRIzol Reagent (Invitrogen, Life Technologies, USA), according to the manufacturer’s protocol. To remove any residual DNA, RNase-free DNase I was included to treat the aqueous phase at 37°C for 20 min.

RT-PCR: 1 µg of RNA was added to the reverse transcription system of oligo primer (1 µL), reverse transcriptase mix (10 µL), and RNase-free water with the PrimeScriptTM RT Reagent Kit, according to manufacturer’s instruction. The RT-PCR system includes cDNA, the primers, 2× plus SYBR real-time mixture, ddH2O, ROXI of the ChamQTM SYBR® qPCR Master Mix (Vazyme Biotech Co., Ltd, China), and DEPC-treated water (Mellon Biological Services, USA). The GAPDH forward primer: ATGGGGAAGGTGAAGGTCG, reverse primer: TCGGGGTCATTGATGGCAACAATA; the E-cadherin forward primer: GGCTGGACCGAGAGAGTTTC, reverse primer: TCAAAATCCAAGCCCGTGGT; the Akt forward primer: GGCGGCAGGACCGAG, reverse primer: CGCCTGCTCCCGTCTTC, were synthesized by Shengya Biosynthesis Company, Fuzhou, China. The PCR steps were initial denaturation 95°C for 2 min, 40 cycles of 95°C for 15 s, and 60°C for 60 s. Data were analyzed by relative quantification expression normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Target gene mRNA expression levels between the treatment group and the control group were calculated using the 2−ΔΔCt method.

2.8 Establishment of HCC transplantation model in mice

Nude mice (C57BL/6, 6 weeks old) were purchased from Beijing Vital River Laboratory Animal Technology (Beijing, China). Information of animal experiment is shown in Table 1. The animal experiments were approved by the People’s Hospital of Guizhou Province, and animal experiments described in this study were performed in accordance with established procedures, as defined by the Guideline on the Humane Treatment of Laboratory Animals stipulated by the Ministry of Science and Technology of the People’s Republic of China [18]. SMMC-7721 cells (5 × 106, 0.1 mL) were subcutaneously given into the stomach of mice. When the tumor grew to around 7 mm, mice were randomly divided into two groups, ED-71 treatment (0.2 µg/kg) group and PBS treatment as control, each group included six mice. After 21 days, mice were sacrificed and tumors were harvested. The size and weight of the tumor were measured.

Table 1

Information of animal experiment

GroupControlED-71
Animal number66
GenderMaleMale
Baseline weight (g)17.9 ± 1.317.5 ± 1.0

2.9 Statistical analysis

The data were showed as mean values with standard deviation (SDs). Statistical significance was determined by the Student’s t-test, and a P value < 0.05 was considered statistically significant. All the results were obtained in at least three independent repeated experiments.

3 Results

3.1 ED-71 inhibited the migration and invasion of hepatoma cells

Cell migration and invasion have been believed to be closely related to tumor metastasis. We investigated the influence of ED-71 (0.5 nM) on the migration and invasion of SMMC-7721 using wound healing and transwell assays, respectively. We found that after treatment with ED-71, the migration rate was decreased significantly (Figure 1a and b). Meanwhile, the invasion of cells was also suppressed significantly by ED-71 (Figure 1c and d).

Figure 1 ED-71 (0.5 nM) markedly inhibited the migration and invasion of liver cancer cells. (a) Representative pictures of cell migration after treatment with ED-71 (scale bar: 150 µm); (b) quantification analysis of cell migration after treatment with ED-71; (c) representative pictures of cell invasion after treatment with ED-71 (scale bar: 30 µm); (d) quantification analysis of cell invasion after treatment with ED-71. *P < 0.05 compared with the control group.
Figure 1

ED-71 (0.5 nM) markedly inhibited the migration and invasion of liver cancer cells. (a) Representative pictures of cell migration after treatment with ED-71 (scale bar: 150 µm); (b) quantification analysis of cell migration after treatment with ED-71; (c) representative pictures of cell invasion after treatment with ED-71 (scale bar: 30 µm); (d) quantification analysis of cell invasion after treatment with ED-71. *P < 0.05 compared with the control group.

3.2 ED-71 markedly increased the ratio of hepatoma cells of S stage and decreased G2 of the cell cycle

To explore how ED-17 affects the cell cycle and apoptosis of the hepatoma cells, we detected the cell cycle post the drug treatments with flow cytometer. The results demonstrated that G2 phase was 13.18% and total S-phase was 41.16% in the ED-71 group and G2 phase: 22.88%, total S-phase: 27.34% in the control group (Figure 2). Meanwhile, the percentage of the cells in S stage increased post ED-71 (0.5 nM) treatment but the G2 phase opposite. The results indicated that ED-17 plays a vital role in the cell division, proliferation, and survival.

Figure 2 ED-71 (0.5 nM) markedly increased the percentage of liver cancer cells in S stage and decreased the percentage in G2 stage of the cell cycle. (a) Representative picture of cell cycle was measured without ED-71 treatment; (b) representative picture of cell cycle was measured after treatment with ED-71; (c) quantification analysis of cells in S stage after treatment with ED-71; (d) quantification analysis of cells in G2 stage after treatment with ED-71. *P < 0.05 compared with the control group.
Figure 2

ED-71 (0.5 nM) markedly increased the percentage of liver cancer cells in S stage and decreased the percentage in G2 stage of the cell cycle. (a) Representative picture of cell cycle was measured without ED-71 treatment; (b) representative picture of cell cycle was measured after treatment with ED-71; (c) quantification analysis of cells in S stage after treatment with ED-71; (d) quantification analysis of cells in G2 stage after treatment with ED-71. *P < 0.05 compared with the control group.

3.3 ED-71 notably induced cell apoptosis rate and inhibited tumor growth in vivo

To investigate the function of the ED-71 on HCC, the transplanted tumor model was established. Each group has six mice, which were given a gavage of distilled ED-71 in the treatment group and the same volume of PBS in the control group. The mice were dissected for collecting the tumor tissues 21 days after treatment. The tumor size of the ED-71 treatment group obviously narrowed compared with the tumors in PBS control group (Figure 3b and d). Through the figures of the tumors, we can come to the conclusion that the ED-71 indeed did suppress the growth of the tumor cells in vivo. And in addition, study in vitro showed that ED-71 increased cell apoptosis rate which is 90% in the treatment group more than that of 14.5% in the control group (Figure 3a and c).

Figure 3 ED-71 induced cell apoptosis of human liver cancer cells using flow cytometry analysis and markedly inhibited the growth of tumor in mice. (a) Cell apoptosis was measured after treatment with ED-71 (0.5 nM); (b) quantification analysis of cell apoptosis after treatment with ED-71; (c) representative pictures of tumor after treatment with ED-71 (0.2 µg/kg); (d) measurement of tumor weight. *P < 0.05 compared with the control group.
Figure 3

ED-71 induced cell apoptosis of human liver cancer cells using flow cytometry analysis and markedly inhibited the growth of tumor in mice. (a) Cell apoptosis was measured after treatment with ED-71 (0.5 nM); (b) quantification analysis of cell apoptosis after treatment with ED-71; (c) representative pictures of tumor after treatment with ED-71 (0.2 µg/kg); (d) measurement of tumor weight. *P < 0.05 compared with the control group.

3.4 ED-71 increased the E-cadherin expression and decreased the Akt expression

E-cadherin was related to the absorption of calcium for the cells, so we detected the mRNA expression post ED-71 treatment. The RT-PCR results demonstrated that E-cadherin expression increased more than 2-fold in the treatment group than in the blank group (Figure 4a). Consequently, the ED-71 increased the E-cadherin mRNA expression for inhibiting the tumor cell growth. However, some anti-cancer drugs can activate the Akt/mTOR signaling pathways. Hence, we also explored the Akt expression after the ED-71 treatment. Results demonstrated that the mRNA expression decreased in the treatment group than in the blank group. Results of immunohistochemistry of tumors indicated that ED-71 induced the E-cadherin expression but suppressed the Akt expression of the tumor cells for growth (Figure 4b).

Figure 4 ED-71 (0.2 µg/kg) markedly inhibited the expression of Akt and E-cadherin. (a) ED-71 increased the E-cadherin mRNA expression and decreased the Akt expression; (b) expression of Akt (Rabbit anti-Akt) and E-cadherin (Rabbit anti-E-cadherin) was measured by immunohistochemistry staining after treatment with ED-71 (scale bar: 50 µm). *P < 0.05 compared with the control group.
Figure 4

ED-71 (0.2 µg/kg) markedly inhibited the expression of Akt and E-cadherin. (a) ED-71 increased the E-cadherin mRNA expression and decreased the Akt expression; (b) expression of Akt (Rabbit anti-Akt) and E-cadherin (Rabbit anti-E-cadherin) was measured by immunohistochemistry staining after treatment with ED-71 (scale bar: 50 µm). *P < 0.05 compared with the control group.

4 Discussion

  • 1. Many previous preclinical researches indicated that analogs of the vitamin D such as calcitriol have the potential as anti-cancer agents for human health [19,20,21]. However, these agents may cause the secondary side effect including hyperparathyroidism [22]. There is still a long way to find a relatively perfect drug for the cancer therapy. As a matter of fact, the analog vitamin D [1, 25(OH)2D3] is found to be a key player in the treatment of hyperparathyroidism [23]. Reports showed that the vitamin D analog 1α,25(OH)2D3 may be effective for the treatment of oral squamous cell carcinoma by inhibiting the activity of the NF-κB [24]. While ED-71 is quite a new drug of the vitamin D analog used majorly for anti-osteoporosis [25,26], instead of anti-cancer. Recent research showed the anti-cancer function of the drug on the OSCC [27], giving a new sight that ED-71 is a potential anti-cancer agent for OSCC [28,29]. Actually, HCC also requires the effective anti-cancer drugs. Therefore, this is a novel study to first investigate the ED-71 effect on the HCC. We found that ED-71 could decrease proliferation of HCC cells obviously in vitro as well as inhibiting the growth in vivo of the mouse model.

  • 2. The anti-cancer drug used in clinic may be verified for the influence on the cell division in vitro of the cancers [30]. Danusertib induces cell cycle arrest in G2/M phase in HCC HepG2 cells [31]. Curine induces cell cycle arrest and cell death in HCC cells in a p53-independent way [32]. α-Pinene could inhibit miR221 expression leading to G2/M-phase arrest, so as to suppress hepatoma tumor progression [33]. Here we found that the percentage of the cells in S stage increased post ED-71 treatment but the G2 phase decreased, which is consistent with the above drugs causing the G2 phase. And in other cancers such as lung cancer, the percentage of lung cancer cells in S and G2 stages was increased markedly by Chinese herbal formulas Miao–Yi–Ai–Tang [34]. These results indicated the potential function of the ED-71 anti-cancer agent. More importantly, we discovered that ED-71 increased the cell apoptosis ratio than the control group, which affirmed the inhibition effect of the ED-71, although the detailed pathways and mechanism still need to be explored.

  • 3. Results of the in vivo experiment of the mouse tumor model also proved the anti-cancer function that post gavage the mice with ED-71, the tumor growth was markedly reduced. Combined with the immunohistochemistry staining of the tumor tissues, less expression of the tumor was found after the ED-71 treatment. These results revealed the anti-cancer effect of the drug. As the prior research observed, the reduction in tumor size and an increase in the calcium level in the blood of mice treated with ED-71 in the OSCC [11], measuring the calcium level, also need to be strengthened in the later research to analyze the inhibition mechanism [26,35].

  • 4. The migration and invasion of tumor cells have been proved to be closely linked with the tumor metastasis. In this study, we demonstrated that ED-71 markedly inhibited the invasion and migration of hepatoma cells, indicating that ED-71 might be a potential anti-tumor agent. The migration and invasion of tumor cells are regulated by many signaling pathways including Akt/JNK [36]. Meanwhile, the epithelial–mesenchymal transition (EMT) is a key step in the metastasis of tumor, and it is closely related to the migration and invasion of tumor cells. Therefore, the major target molecule, E-cadherin, was investigated in the present study.

E-cadherin, also known as epithelial cadherin, is applied for the diagnosis as well as prognosis of the epithelial cancers [37]. It plays an important role in suppression versus initiation or progression of various human cancers [37,38]. Furthermore, the Akt/PKB kinases can be frequently activated in human cancers including oral squamous cell carcinoma [39]. Akt is activated in many human carcinomas. Akt can induce the EMT by down-regulation of the E-cadherin expression. The Akt can simultaneously induce EMT, so as to promote enhanced motility and invasiveness of squamous cell carcinoma lines [40]. In this study, we have measured the mRNA expression of the E-cadherin and Akt post the ED-71 treatment by RT-PCR. E-cadherin expression increased more than 2-fold and Akt expression decreased about 1-fold in the treatment group than in the control group, which proved that ED-71 can inhibit the hepatoma growth by inducing the expression of E-cadherin but suppression of the Akt expression. More protein pathways should be explored with the western blotting and structure analysis afterwards.

Apart from Akt and E-cadherin, many other potential factors have been proved to be regulated by ED-71 affecting tumor cells. Previous study indicated that ED-71 could suppress oral squamous cell carcinoma by inhibiting HBp17/FGFBP-1, FGF-2, CD31, Ki-67, and Cyp24A1 [27,28]. However, if ED-71 could suppress the hepatoma cells through affecting these factors described above remains unknown. It should be an interesting study to investigate the influence of ED-71 on the expression of these factors in hepatoma cells.

Taken together with the findings above, we can draw a conclusion that the vitamin D analog eldecalcitol, ED-71, is a potential therapeutic agent for anti-hepatoma in vitro and in vivo, which will provide a novel sight for inhibiting the hepatoma cancer.


tel: +86-851-85937515, fax: +86-851-85937515

Acknowledgment

The study was supported by Guizhou Province Science and Technology Foundation Project ([2016]7176).

  1. Conflict of interest: The authors declare that they have no conflicts of interest.

  2. Author contributions: LY designed the studies; LY, FL, and LZ conducted the experiments and analyzed the data; LY and JW wrote this manuscript. All authors read and approved the final manuscript.

References

[1] Hartke J, Johnson M, Ghabril M. The diagnosis and treatment of hepatocellular carcinoma. Semin Diagn Pathol. 2017;34(2):153–9.10.1053/j.semdp.2016.12.011Search in Google Scholar PubMed

[2] Bioulac-Sage P, Sempoux C, Balabaud C. Hepatocellular adenoma: classification, variants and clinical relevance. Semin Diagn Pathol. 2017;34(2):112–25.10.1053/j.semdp.2016.12.007Search in Google Scholar PubMed

[3] Agni RM. Diagnostic histopathology of hepatocellular carcinoma: a case-based review. Semin Diagn Pathol. 2017;34(2):126–37.10.1053/j.semdp.2016.12.008Search in Google Scholar PubMed

[4] Hytiroglou P. Well-differentiated hepatocellular nodule: making a diagnosis on biopsy and resection specimens of patients with advanced stage chronic liver disease. Semin Diagn Pathol. 2017;34(2):138–45.10.1053/j.semdp.2016.12.009Search in Google Scholar PubMed

[5] Bruix J, Sherman M. Management of hepatocellular carcinoma. Hepatology. 2005;42(5):1208–36.10.1002/hep.20933Search in Google Scholar PubMed

[6] Graham RP, Torbenson MS. Fibrolamellar carcinoma: a histologically unique tumor with unique molecular findings. Semin Diagn Pathol. 2017;34(2):146–52.10.1053/j.semdp.2016.12.010Search in Google Scholar PubMed

[7] Covey AM, Hussain SM. Liver-directed therapy for hepatocellular carcinoma: an overview of techniques, outcomes, and posttreatment imaging findings. AJR Am J Roentgenol. 2017;209(1):67–76.10.2214/AJR.17.17799Search in Google Scholar PubMed

[8] Noguchi Y, Kawate H, Nomura M, Takayanagi R. Eldecalcitol for the treatment of osteoporosis. Clin Interv Aging. 2013;8:1313–21.10.2147/CIA.S49825Search in Google Scholar PubMed PubMed Central

[9] Jiang Y, Tang H, Ma X, Cheng Q, Lin H, Jin X, et al. Eldecalcitol increases bone mineral density in Chinese osteoporotic patients without vitamin D or calcium supplementation. J Bone Miner Metab. 2019;37(6):1036–47.10.1007/s00774-019-01009-9Search in Google Scholar PubMed

[10] Tsuburai T, Nakamura T, Yoshikata H, Miyagi E, Sakakibara H. Eldecalcitol increases bone mass in patients with Turner syndrome who have insufficient bone mass acquisition after estrogen replacement therapy. Endocr J. 2018;65(6):629–38.10.1507/endocrj.EJ17-0498Search in Google Scholar PubMed

[11] Shintani T, Rosli SNZ, Takatsu F, Choon YF, Hayashido Y, Toratani S, et al. Eldecalcitol (ED-71), an analog of 1α,25-dihydroxyvitamin D3 as a potential anti-cancer agent for oral squamous cell carcinomas. J Steroid Biochem Mol Biol. 2016;164:79–84.10.1016/j.jsbmb.2015.09.043Search in Google Scholar PubMed

[12] Saito H, Harada S. Eldecalcitol replaces endogenous calcitriol but does not fully compensate for its action in vivo. J Steroid Biochem Mol Biol. 2014;144:189–96.10.1016/j.jsbmb.2013.11.013Search in Google Scholar PubMed

[13] Friedrich M, Rafi L, Mitschele T, Tilgen W, Schmidt W, Reichrath J, editors. Analysis of the Vitamin D System in Cervical Carcinomas, Breast Cancer and Ovarian Cancer. Vitamin D Analogs in Cancer Prevention and Therapy. Berlin, Heidelberg: Springer Berlin Heidelberg; 2003.10.1007/978-3-642-55580-0_17Search in Google Scholar PubMed

[14] Duensing TD, Watson SR. Assessment of apoptosis (programmed cell death) by flow cytometry. Cold Spring Harbor Protoc. 2018;2018(1):38–40.10.1101/pdb.prot093807Search in Google Scholar PubMed

[15] Lopez Perez R, Munz F, Kroschke J, Brauer J, Nicolay NH, Huber PE. Cell cycle-specific measurement of gammaH2AX and apoptosis after genotoxic stress by flow cytometry. J Visual Exp JoVE. 2019;151:1–10.10.3791/59968Search in Google Scholar

[16] Kong Y, Nie Z, Guo H, Ma C. LINK-A lncRNA is upregulated in osteosarcoma and regulates migration, invasion and stemness of osteosarcoma cells. Oncol Lett. 2020;19(4):2832–8.10.3892/ol.2020.11367Search in Google Scholar PubMed PubMed Central

[17] Parthasarathy D, Madhuravasal JK, Jayavel P, Kulandai LT, Narahari Rao MH, Jambulingam M. Expression analysis of toll-like receptors of Dengue-infected cornea by real-time polymerase chain reaction. Inflamm Res. 2018;67(7):555–8.10.1007/s00011-018-1148-5Search in Google Scholar PubMed

[18] The ministry of science and technology of the people’s republic of china. http://www.most.gov.cn/fggw/zfwj/zfwj2006/zf06wj/zf06bfw/200609/t20060930_54196.htm (30 Sep 2006).Search in Google Scholar

[19] Deeb KK, Trump DL, Johnson CS. Vitamin D signalling pathways in cancer: potential for anticancer therapeutics. Nat Rev Cancer. 2007;7(9):684–700.10.1038/nrc2196Search in Google Scholar PubMed

[20] Luo W, Hershberger PA, Trump DL, Johnson CS. 24-Hydroxylase in cancer: impact on vitamin D-based anticancer therapeutics. J Steroid Biochem Mol Biol. 2013;136:252–7.10.1016/j.jsbmb.2012.09.031Search in Google Scholar PubMed PubMed Central

[21] Masuda S, Jones G. Promise of vitamin D analogues in the treatment of hyperproliferative conditions. Mol Cancer Ther. 2006;5(4):797–808.10.1158/1535-7163.MCT-05-0539Search in Google Scholar PubMed

[22] Buchwald PC, Westin G, Akerstrom G. Vitamin D in normal and pathological parathyroid glands: new prospects for treating hyperparathyroidism (review). Int J Mol Med. 2005;15(4):701–6.Search in Google Scholar

[23] Brown AJ, Zhong M, Finch J, Ritter C, Slatopolsky E. The roles of calcium and 1,25-dihydroxyvitamin D3 in the regulation of vitamin D receptor expression by rat parathyroid glands. Endocrinology. 1995;136(4):1419–25.10.1210/endo.136.4.7895652Search in Google Scholar PubMed

[24] Rosli SNZ, Shintani T, Hayashido Y, Toratani S, Usui E, Okamoto T. 1α,25(OH)2D3 down-regulates HBp17/FGFBP-1 expression via NF-κB pathway. J Steroid Biochem Mol Biol. 2013;136:98–101.10.1016/j.jsbmb.2012.10.011Search in Google Scholar PubMed

[25] Bu J, Du J, Shi L, Feng W, Wang W, Guo J, et al. Eldecalcitol effects on osteoblastic differentiation and function in the presence or absence of osteoclastic bone resorption. Exp Ther Med. 2019;18(3):2111–21.10.3892/etm.2019.7784Search in Google Scholar PubMed PubMed Central

[26] Wang W, Gao Y, Liu H, Feng W, Li X, Guo J, et al. Eldecalcitol, an active vitamin D analog, effectively prevents cyclophosphamide-induced osteoporosis in rats. Exp Ther Med. 2019;18(3):1571–80.10.3892/etm.2019.7759Search in Google Scholar PubMed PubMed Central

[27] Shintani T, Rosli SNZ, Takatsu F, Choon YF, Hayashido Y, Toratani S, et al. Eldecalcitol (ED-71), an analog of 1alpha,25-dihydroxyvitamin D3 as a potential anti-cancer agent for oral squamous cell carcinomas. J Steroid Biochem Mol Biol. 2016;164:79–84.10.1016/j.jsbmb.2015.09.043Search in Google Scholar PubMed

[28] Shintani T, Takatsu F, Rosli SNZ, Usui E, Hamada A, Sumi K, et al. Eldecalcitol (ED-71), an analog of 1alpha,25(OH)2D3, inhibits the growth of squamous cell carcinoma (SCC) cells in vitro and in vivo by down-regulating expression of heparin-binding protein 17/fibroblast growth factor-binding protein-1 (HBp17/FGFBP-1) and FGF-2. In Vitro Cell Dev Biol Anim. 2017;53(9):810–7.10.1007/s11626-017-0183-9Search in Google Scholar PubMed

[29] Higaki M, Shintani T, Hamada A, Rosli SNZ, Okamoto T. Eldecalcitol (ED-71)-induced exosomal miR-6887-5p sup- presses squamous cell carcinoma cell growth by targeting heparin-binding protein 17/fibroblast growth factor-binding protein-1 (HBp17/FGFBP-1). In Vitro Cell Dev Biol Anim. 2020;56(3):222–33. 10.1007/s11626-020-00440-x.Search in Google Scholar PubMed

[30] Ibrahim B, Stange J, Dominik A, Sauer M, Doss S, Eggert M. Albumin promotes proliferation of G1 arrested serum starved hepatocellular carcinoma cells. PeerJ. 2020;8:e8568.10.7717/peerj.8568Search in Google Scholar PubMed PubMed Central

[31] Zhu Q, Luo M, Zhou C, Chen Z, Huang W, Huang J, et al. Effect of danusertib on cell cycle, apoptosis and autophagy of hepatocellular carcinoma HepG2 cells in vitro. Nan Fang Yi Ke Da Xue Xue Bao. 2018;38(12):1476–84.Search in Google Scholar

[32] Gong S, Xu D, Zou F, Peng R. (−)-Curine induces cell cycle arrest and cell death in hepatocellular carcinoma cells in a p53-independent way. Biomed Pharmacother. 2017;89:894–901.10.1016/j.biopha.2017.01.148Search in Google Scholar PubMed

[33] Xu Q, Li M, Yang M, Yang J, Xie J, Lu X, et al. alpha-pinene regulates miR-221 and induces G2/M phase cell cycle arrest in human hepatocellular carcinoma cells. Biosci Rep. 2018;38(6):1–11.10.1042/BSR20180980Search in Google Scholar PubMed PubMed Central

[34] Li B, Zhang W, Tan T, Liu W, Luo X, Zhang J, et al. Chinese herbal formulas Miao-Yi-Ai-Tang inhibits the proliferation and migration of lung cancer cells through targeting beta-Catenin/AXIN and presents synergistic effect with cisplatin suppressing lung cancer. BioMed Res Int. 2020;2020:2761850.10.1155/2020/2761850Search in Google Scholar

[35] Takahashi F, Tsuji N, Uchiyama Y. [ED-71]. Nihon Rinsho. 2004;62(Suppl 2):540–7.Search in Google Scholar

[36] Yu Y, Lv F, Liang D, Yang Q, Zhang B, Lin H, et al. HOTAIR may regulate proliferation, apoptosis, migration and invasion of MCF-7 cells through regulating the P53/Akt/JNK signaling pathway. Biomed Pharmacother. 2017;90:555–61.10.1016/j.biopha.2017.03.054Search in Google Scholar PubMed

[37] van Roy F. Beyond E-cadherin: roles of other cadherin superfamily members in cancer. Nat Rev Cancer. 2014;14(2):121–34.10.1038/nrc3647Search in Google Scholar PubMed

[38] Berx G, van Roy F. Involvement of members of the cadherin superfamily in cancer. Cold Spring Harb Perspect Biol. 2009;1(6):a003129.10.1101/cshperspect.a003129Search in Google Scholar PubMed PubMed Central

[39] Hong KO, Kim JH, Hong JS, Yoon HJ, Lee JI, Hong SP, et al. Inhibition of Akt activity induces the mesenchymal-to-epithelial reverting transition with restoring E-cadherin expression in KB and KOSCC-25B oral squamous cell carcinoma cells. J Exp Clin Cancer Res. 2009;28(1):28.10.1186/1756-9966-28-28Search in Google Scholar PubMed PubMed Central

[40] Grille SJ, Bellacosa A, Upson J, Klein-Szanto AJ, van Roy F, Lee-Kwon W, et al. The protein kinase Akt induces epithelial mesenchymal transition and promotes enhanced motility and invasiveness of squamous cell carcinoma lines. Cancer Res. 2003;63(9):2172–8.Search in Google Scholar

Received: 2020-04-02
Revised: 2020-05-14
Accepted: 2020-06-09
Published Online: 2020-07-13

© 2020 Limin Ye et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Article
  2. MicroRNA-451b participates in coronary heart disease by targeting VEGFA
  3. Case Report
  4. A combination therapy for Kawasaki disease with severe complications: a case report
  5. Vitamin E for prevention of biofilm-caused Healthcare-associated infections
  6. Research Article
  7. Differential diagnosis: retroperitoneal fibrosis and oncological diseases
  8. Optimization of the Convolutional Neural Networks for Automatic Detection of Skin Cancer
  9. NEAT1 promotes LPS-induced inflammatory injury in macrophages by regulating miR-17-5p/TLR4
  10. Plasma matrix metalloproteinase-9 and tissue inhibitor of matrix metalloproteinase-1 as prognostic biomarkers in critically ill patients
  11. Effects of extracorporeal magnetic stimulation in fecal incontinence
  12. Case Report
  13. Mixed germ cell tumor of the endometrium: a case report and literature review
  14. Bowel perforation after ventriculoperitoneal-shunt placement: case report and review of the literature
  15. Research Article
  16. Prognostic value of lncRNA HOTAIR in colorectal cancer : a meta-analysis
  17. Case Report
  18. Treatment of insulinomas by laparoscopic radiofrequency ablation: case reports and literature review
  19. Research Article
  20. The characteristics and nomogram for primary lung papillary adenocarcinoma
  21. Undiagnosed pheochromocytoma presenting as a pancreatic tumor: A case report
  22. Bioinformatics Analysis of the Expression of ATP binding cassette subfamily C member 3 (ABCC3) in Human Glioma
  23. Diagnostic value of recombinant heparin-binding hemagglutinin adhesin protein in spinal tuberculosis
  24. Primary cutaneous DLBCL non-GCB type: challenges of a rare case
  25. LINC00152 knock-down suppresses esophageal cancer by EGFR signaling pathway
  26. Case Report
  27. Life-threatening anaemia in patient with hereditary haemorrhagic telangiectasia (Rendu-Osler-Weber syndrome)
  28. Research Article
  29. QTc interval predicts disturbed circadian blood pressure variation
  30. Shoulder ultrasound in the diagnosis of the suprascapular neuropathy in athletes
  31. The number of negative lymph nodes is positively associated with survival in esophageal squamous cell carcinoma patients in China
  32. Differentiation of pontine infarction by size
  33. RAF1 expression is correlated with HAF, a parameter of liver computed tomographic perfusion, and may predict the early therapeutic response to sorafenib in advanced hepatocellular carcinoma patients
  34. LncRNA ZEB1-AS1 regulates colorectal cancer cells by miR-205/YAP1 axis
  35. Tissue coagulation in laser hemorrhoidoplasty – an experimental study
  36. Classification of pathological types of lung cancer from CT images by deep residual neural networks with transfer learning strategy
  37. Enhanced Recovery after Surgery for Lung Cancer Patients
  38. Case Report
  39. Streptococcus pneumoniae-associated thrombotic microangiopathy in an immunosuppressed adult
  40. Research Article
  41. The characterization of Enterococcus genus: resistance mechanisms and inflammatory bowel disease
  42. Case Report
  43. Inflammatory fibroid polyp: an unusual cause of abdominal pain in the upper gastrointestinal tract A case report
  44. Research Article
  45. microRNA-204-5p participates in atherosclerosis via targeting MMP-9
  46. LncRNA LINC00152 promotes laryngeal cancer progression by sponging miR-613
  47. Can keratin scaffolds be used for creating three-dimensional cell cultures?
  48. miRNA-186 improves sepsis induced renal injury via PTEN/PI3K/AKT/P53 pathway
  49. Case Report
  50. Delayed bowel perforation after routine distal loopogram prior to ileostomy closure
  51. Research Article
  52. Diagnostic accuracy of MALDI-TOF mass spectrometry for the direct identification of clinical pathogens from urine
  53. The R219K polymorphism of the ATP binding cassette subfamily A member 1 gene and susceptibility to ischemic stroke in Chinese population
  54. miR-92 regulates the proliferation, migration, invasion and apoptosis of glioma cells by targeting neogenin
  55. Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma
  56. NF2 inhibits proliferation and cancer stemness in breast cancer
  57. Body composition indices and cardiovascular risk in type 2 diabetes. CV biomarkers are not related to body composition
  58. S100A6 promotes proliferation and migration of HepG2 cells via increased ubiquitin-dependent degradation of p53
  59. Review Article
  60. Focus on localized laryngeal amyloidosis: management of five cases
  61. Research Article
  62. NEAT1 aggravates sepsis-induced acute kidney injury by sponging miR-22-3p
  63. Pericentric inversion in chromosome 1 and male infertility
  64. Increased atherogenic index in the general hearing loss population
  65. Prognostic role of SIRT6 in gastrointestinal cancers: a meta-analysis
  66. The complexity of molecular processes in osteoarthritis of the knee joint
  67. Interleukin-6 gene −572 G > C polymorphism and myocardial infarction risk
  68. Case Report
  69. Severe anaphylactic reaction to cisatracurium during anesthesia with cross-reactivity to atracurium
  70. Research Article
  71. Rehabilitation training improves nerve injuries by affecting Notch1 and SYN
  72. Case Report
  73. Myocardial amyloidosis following multiple myeloma in a 38-year-old female patient: A case report
  74. Research Article
  75. Identification of the hub genes RUNX2 and FN1 in gastric cancer
  76. miR-101-3p sensitizes non-small cell lung cancer cells to irradiation
  77. Distinct functions and prognostic values of RORs in gastric cancer
  78. Clinical impact of post-mortem genetic testing in cardiac death and cardiomyopathy
  79. Efficacy of pembrolizumab for advanced/metastatic melanoma: a meta-analysis
  80. Review Article
  81. The role of osteoprotegerin in the development, progression and management of abdominal aortic aneurysms
  82. Research Article
  83. Identification of key microRNAs of plasma extracellular vesicles and their diagnostic and prognostic significance in melanoma
  84. miR-30a-3p participates in the development of asthma by targeting CCR3
  85. microRNA-491-5p protects against atherosclerosis by targeting matrix metallopeptidase-9
  86. Bladder-embedded ectopic intrauterine device with calculus
  87. Case Report
  88. Mycobacterial identification on homogenised biopsy facilitates the early diagnosis and treatment of laryngeal tuberculosis
  89. Research Article
  90. The will of young minors in the terminal stage of sickness: A case report
  91. Extended perfusion protocol for MS lesion quantification
  92. Identification of four genes associated with cutaneous metastatic melanoma
  93. Case Report
  94. Thalidomide-induced serious RR interval prolongation (longest interval >5.0 s) in multiple myeloma patient with rectal cancer: A case report
  95. Research Article
  96. Voluntary exercise and cardiac remodeling in a myocardial infarction model
  97. Electromyography as an intraoperative test to assess the quality of nerve anastomosis – experimental study on rats
  98. Case Report
  99. CT findings of severe novel coronavirus disease (COVID-19): A case report of Heilongjiang Province, China
  100. Commentary
  101. Directed differentiation into insulin-producing cells using microRNA manipulation
  102. Research Article
  103. Culture-negative infective endocarditis (CNIE): impact on postoperative mortality
  104. Extracorporeal shock wave therapy for the treatment of chronic pelvic pain syndrome
  105. Plasma microRNAs in human left ventricular reverse remodelling
  106. Bevacizumab for non-small cell lung cancer patients with brain metastasis: A meta-analysis
  107. Risk factors for cerebral vasospasm in patients with aneurysmal subarachnoid hemorrhage
  108. Problems and solutions of personal protective equipment doffing in COVID-19
  109. Evaluation of COVID-19 based on ACE2 expression in normal and cancer patients
  110. Review Article
  111. Gastroenterological complications in kidney transplant patients
  112. Research Article
  113. CXCL13 concentration in latent syphilis patients with treatment failure
  114. A novel age-biomarker-clinical history prognostic index for heart failure with reduced left ventricular ejection fraction
  115. Case Report
  116. Clinicopathological analysis of composite lymphoma: A two-case report and literature review
  117. Trastuzumab-induced thrombocytopenia after eight cycles of trastuzumab treatment
  118. Research Article
  119. Inhibition of vitamin D analog eldecalcitol on hepatoma in vitro and in vivo
  120. CCTs as new biomarkers for the prognosis of head and neck squamous cancer
  121. Effect of glucagon-like peptide-1 receptor agonists on adipokine level of nonalcoholic fatty liver disease in rats fed high-fat diet
  122. 72 hour Holter monitoring, 7 day Holter monitoring, and 30 day intermittent patient-activated heart rhythm recording in detecting arrhythmias in cryptogenic stroke patients free from arrhythmia in a screening 24 h Holter
  123. FOXK2 downregulation suppresses EMT in hepatocellular carcinoma
  124. Case Report
  125. Total parenteral nutrition-induced Wernicke’s encephalopathy after oncologic gastrointestinal surgery
  126. Research Article
  127. Clinical prediction for outcomes of patients with acute-on-chronic liver failure associated with HBV infection: A new model establishment
  128. Case Report
  129. Combination of chest CT and clinical features for diagnosis of 2019 novel coronavirus pneumonia
  130. Research Article
  131. Clinical significance and potential mechanisms of miR-223-3p and miR-204-5p in squamous cell carcinoma of head and neck: a study based on TCGA and GEO
  132. Review Article
  133. Hemoperitoneum caused by spontaneous rupture of hepatocellular carcinoma in noncirrhotic liver. A case report and systematic review
  134. Research Article
  135. Voltage-dependent anion channels mediated apoptosis in refractory epilepsy
  136. Prognostic factors in stage I gastric cancer: A retrospective analysis
  137. Circulating irisin is linked to bone mineral density in geriatric Chinese men
  138. Case Report
  139. A family study of congenital dysfibrinogenemia caused by a novel mutation in the FGA gene: A case report
  140. Research Article
  141. CBCT for estimation of the cemento-enamel junction and crestal bone of anterior teeth
  142. Case Report
  143. Successful de-escalation antibiotic therapy using cephamycins for sepsis caused by extended-spectrum beta-lactamase-producing Enterobacteriaceae bacteremia: A sequential 25-case series
  144. Research Article
  145. Influence factors of extra-articular manifestations in rheumatoid arthritis
  146. Assessment of knowledge of use of electronic cigarette and its harmful effects among young adults
  147. Predictive factors of progression to severe COVID-19
  148. Procedural sedation and analgesia for percutaneous trans-hepatic biliary drainage: Randomized clinical trial for comparison of two different concepts
  149. Acute chemoradiotherapy toxicity in cervical cancer patients
  150. IGF-1 regulates the growth of fibroblasts and extracellular matrix deposition in pelvic organ prolapse
  151. NANOG regulates the proliferation of PCSCs via the TGF-β1/SMAD pathway
  152. An immune-relevant signature of nine genes as a prognostic biomarker in patients with gastric carcinoma
  153. Computer-aided diagnosis of skin cancer based on soft computing techniques
  154. MiR-1225-5p acts as tumor suppressor in glioblastoma via targeting FNDC3B
  155. miR-300/FA2H affects gastric cancer cell proliferation and apoptosis
  156. Hybrid treatment of fibroadipose vascular anomaly: A case report
  157. Surgical treatment for common hepatic aneurysm. Original one-step technique
  158. Neuropsychiatric symptoms, quality of life and caregivers’ burden in dementia
  159. Predictor of postoperative dyspnea for Pierre Robin Sequence infants
  160. Long non-coding RNA FOXD2-AS1 promotes cell proliferation, metastasis and EMT in glioma by sponging miR-506-5p
  161. Analysis of expression and prognosis of KLK7 in ovarian cancer
  162. Circular RNA circ_SETD2 represses breast cancer progression via modulating the miR-155-5p/SCUBE2 axis
  163. Glial cell induced neural differentiation of bone marrow stromal cells
  164. Case Report
  165. Moraxella lacunata infection accompanied by acute glomerulonephritis
  166. Research Article
  167. Diagnosis of complication in lung transplantation by TBLB + ROSE + mNGS
  168. Case Report
  169. Endometrial cancer in a renal transplant recipient: A case report
  170. Research Article
  171. Downregulation of lncRNA FGF12-AS2 suppresses the tumorigenesis of NSCLC via sponging miR-188-3p
  172. Case Report
  173. Splenic abscess caused by Streptococcus anginosus bacteremia secondary to urinary tract infection: a case report and literature review
  174. Research Article
  175. Advances in the role of miRNAs in the occurrence and development of osteosarcoma
  176. Rheumatoid arthritis increases the risk of pleural empyema
  177. Effect of miRNA-200b on the proliferation and apoptosis of cervical cancer cells by targeting RhoA
  178. LncRNA NEAT1 promotes gastric cancer progression via miR-1294/AKT1 axis
  179. Key pathways in prostate cancer with SPOP mutation identified by bioinformatic analysis
  180. Comparison of low-molecular-weight heparins in thromboprophylaxis of major orthopaedic surgery – randomized, prospective pilot study
  181. Case Report
  182. A case of SLE with COVID-19 and multiple infections
  183. Research Article
  184. Circular RNA hsa_circ_0007121 regulates proliferation, migration, invasion, and epithelial–mesenchymal transition of trophoblast cells by miR-182-5p/PGF axis in preeclampsia
  185. SRPX2 boosts pancreatic cancer chemoresistance by activating PI3K/AKT axis
  186. Case Report
  187. A case report of cervical pregnancy after in vitro fertilization complicated by tuberculosis and a literature review
  188. Review Article
  189. Serrated lesions of the colon and rectum: Emergent epidemiological data and molecular pathways
  190. Research Article
  191. Biological properties and therapeutic effects of plant-derived nanovesicles
  192. Case Report
  193. Clinical characterization of chromosome 5q21.1–21.3 microduplication: A case report
  194. Research Article
  195. Serum calcium levels correlates with coronary artery disease outcomes
  196. Rapunzel syndrome with cholangitis and pancreatitis – A rare case report
  197. Review Article
  198. A review of current progress in triple-negative breast cancer therapy
  199. Case Report
  200. Peritoneal-cutaneous fistula successfully treated at home: A case report and literature review
  201. Research Article
  202. Trim24 prompts tumor progression via inducing EMT in renal cell carcinoma
  203. Degradation of connexin 50 protein causes waterclefts in human lens
  204. GABRD promotes progression and predicts poor prognosis in colorectal cancer
  205. The lncRNA UBE2R2-AS1 suppresses cervical cancer cell growth in vitro
  206. LncRNA FOXD3-AS1/miR-135a-5p function in nasopharyngeal carcinoma cells
  207. MicroRNA-182-5p relieves murine allergic rhinitis via TLR4/NF-κB pathway
Downloaded on 8.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2020-0137/html
Scroll to top button