Home Physical Sciences Cytotoxicity of green-synthesized silver nanoparticles by Adansonia digitata fruit extract against HTC116 and SW480 human colon cancer cell lines
Article Open Access

Cytotoxicity of green-synthesized silver nanoparticles by Adansonia digitata fruit extract against HTC116 and SW480 human colon cancer cell lines

  • Fatimah Basil Almukaynizi , Maha H. Daghestani , Manal A. Awad , Arwa Althomali , Nada M. Merghani , Wadha I. Bukhari , Norah M. Algahtani , Shatha S. Al-Zuhairy , Ahlam M. ALOthman , Eman A. Alsenani , Badrih O. Alojayan , Khulud S. Al-Saif and Ramesa Shafi Bhat EMAIL logo
Published/Copyright: April 19, 2022
Download Article (PDF)
Become an author with De Gruyter Brill
Submit Manuscript Author Information
Green Processing and Synthesis
From the journal Green Processing and Synthesis Volume 11 Issue 1

Abstract

Nanoparticles synthesized from plants are being explored for cancer treatment therapies all over the world. This study reported the eco-friendly and low-cost method for the green synthesis of silver nanoparticles (AgNPs) from Adansonia digitata fruit as a reducing and capping agent. The anti-cancer potential of synthesized particles was explored against HTC116 and SW480 colon cancer cell lines. Prepared AgNPs were characterized by ultraviolet-visible spectroscopy, zeta potential, transmission electronic microscopy, scanning electronic microscopy, Fourier transform infrared, and energy-dispersive spectrum. The cytotoxicity was determined with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and expression levels of four genes (CTNNB1, APC, LRP5, and LRP6) were checked by reverse transcription polymerase chain reaction. The sharp peak of surface plasmon resonance at 400 nm confirms the formation of AgNPs. Dynamic light scattering showed average sizes of 16.34 nm with a polydispersity index of 0.193. A. digitata AgNPs were spherical with slight aggregated. AgNPs were more cytotoxic than A. digitata extract and decrease the expression of CTNNB1 and LRP6 genes while LRP5 gene expression was increased in both cell lines. APC gene expression was decreased in SW480 but increased in HTC116 with treatment. Overall, this study suggested that AgNPs synthesized by A. digitata fruit extract can be an attractive candidate for anticancer applications.

Keywords: Adansonia digitata ; silver nanoparticles; gene expression; human colon cancer cell line

1 Introduction

Silver nanoparticles (AgNPs) possess many attractive properties due to which many scientific communities are showing interest in their therapeutic applications [1]. AgNPs are being used in many commercial items, such as soap catheters and bandages to curb infection against pathogenic agents [2,3,4,5]. They show promising results in nanomedicine as drug delivery vectors, theranostics agents, and anti-cancer agents [1,6,7,8]. AgNPs can be synthesized by many chemical and physical methods, which may have some shortcomings as some of these methods need high energy or may produce toxic by-products [9,10]. Particularly, chemically produced nanoparticles give out many harmful chemicals, which are not encouraging for biomedical uses. These issues or disadvantages were solved by preparing AgNPs by green methods by using biological assets, such as plants [11,12], microbes [13], algae [14], and yeasts [15]. However, plants are mostly used due to their low cost and the presence of rich bio-reducing agents [11,12]. The oxidation process of various biomolecules present in plants is mainly responsible for the reduction of silver ions to AgNPs [11]. The synthesized AgNP stability mostly depends on the nature of biomolecules present in the extract. AgNPs’ size and shape depend on the concentration of plant extract as increases in plant extract lead to the formation of a large number of nanoparticles [16]. All plant parts, such as flowers, bark, leaves, fruits, and seed, have the capacity to synthesize nanoparticles in an eco-friendly manner [17]. Some of the most recent studies showing cytotoxicity of green-synthesized nanoparticles using various parts of plants against various cancer cell lines are listed in Table 1.

Table 1

Most recent reported AgNPs synthesized by various plant parts

No. The plant used as reducing agent Part of plant used AgNPs’ characteristic Cell type used for cytotoxic assay [Ref] year
1 Acanthospermum australe Whole plant Spherical in shape Peripheral blood mononuclear cells [18] 2021
Average size 14 nm
2 Chaetomorpha ligustica Whole algae Spherical in shape Human colon cancer cell lines HT29 and HCT116 [19] 2021
Average size 8.8 nm
3 Camellia sinensis Leaf Spherical, polygonal, capsule Human cervical epithelioid carcinoma – HeLa cells [20] 2021
4 Rosmarinus officinalis Leaf Round-shaped Human breast cancer cell lines – MB 231 [11] 2020
Average size 10 nm
5 Jasminum officinale L. Leaf Spherical in shape Human bladder cell line – 5637 [21] 2020
Average size 9.22 nm Human breast cancer cell line – MCF-7
6 Achillea millefolium Flower Spherical in shape Lymphoblastic leukemia cell line – MOLT-4 [22] 2021
Average size 22.4 nm
7 Abelmoschus esculentus Flower Spherical in shape Human lung carcinoma epithelial cell lines – A-549 [23] 2021
Average size 31.9 nm
8 Diospyros malabarica Fruit Spherical in shape Human primary glioblastoma cell line – U87-MG [24] 2021
Average size 17.4 nm
9 Aloe vera Gel Spherical in shape Mouse melanoma cell line – F10B16 [25] 2020
Average size 50 nm
10 Ferula foetida Gum Spherical in shape Human breast cancer cell line – MCF-7 [26] 2020
Average size 8.6 nm
11 Juglans regia Green husk Spherical in shape Human breast cancer cell line – MCF-7 [27] 2018
Average size 31.4 nm
12 Zea mays Corn silk Spherical in shape Rat cardio myoblasts – H9c2 [28] 2020
Average size 20 nm
13 Mangifera indica Seeds Round shape Normal fibroblast [29] 2021
Average size 26.85 nm Human cervical epithelioid carcinoma – HeLa cells
Human breast cancer cell line – MCF-7
14 Rhodiola imbricata Roots Spherical in shape Human liver hepatocellular carcinoma – HepG2 [30] 2022
Average size 37 nm Normal human hepatoma cell line – Huh7

Due to promising cytotoxicity activity, AgNPs are attaining interest worldwide to achieve an effective cancer treatment. The unique optical properties, size, and conductivity of these particles play an essential role in cytotoxic capacity and drug delivery for treating cancer in addition to cancer diagnosis [3,8]. Nanoparticles synthesized by medicinal plants are being explored for cancer treatment therapies because these particles have shown a controlled effect on many cancer cell lines [11,31].

International Agency for Research on Cancer placed colorectal cancer (CRC) as the third most commonly diagnosed malignancy in men and the second place in women [32]. The advanced stage of CRC is treated by only one approved drug, that is 5-fluorouracil, and its treatment is still a major challenge for researchers [33]. It has been found that AgNPs can induce DNA damage and chromosomal aberrations in many cancer cell lines [34].

In the present study, we explored the anticancer potential of green-synthesized AgNPs from Adansonia digitata fruit extract on HTC116 and SW480 colon cancer cell lines. A. digitata is full of nutrients and is used to treat many diseases, such as diarrhea, malaria, and microbial infections [35,36]. Its excellent antioxidant content reveals its high antimicrobial, antiviral antioxidant, and anti-inflammatory properties. Its fruit is rich in flavonoids, phytosterols, amino acids, fatty acids, vitamins, and minerals [35,36]. A. digitata fruit pulp is very rich in vitamin C and antioxidants. A. digitata fruit is approved as a nutritional product by statutory bodies for use in certain nutritional products [37]. The European Commission authorized it, and the United States has recognized it as a food supplement [38,39]. Demand for A. digitata fruit has increased in the cosmetic industry due to its fatty acid content.

Although green synthesis of AgNPs from A. digitata has been reported in the literature, the anticancer potential of the green-synthesized A. digitata AgNPs is not reported. This novel study describes the green synthesis of AgNPs by a simple and eco-friendly process by using A. digitata fruit extract and unveiled its anticancer activities against different colon cancer cell lines by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay followed by gene-expression profiling methods of four genes (CTNNB1, APC, LRP5, and LRP6).

2 Materials and methods

2.1 Fruit extract

Fresh A. digitata cultivated in the Kordofan region of Sudan was included in this study. Twenty grams of fruit pulp were soaked in 200 mL of distilled water and boiled for 30 min. The extract was filtered after cooling and centrifuged at 10,000 rpm for 10 min. The collected supernatant was stored at 4°C.

2.2 Biosynthesis of AgNPs

Silver nitrate (Fisher) solution was mixed with the above-mentioned fruit extract with a final concentration of 5 mM. The mixture was heated at 60°C for 10 min. The reduction of silver ions to AgNPs was observed by a color change from light yellow to brown and was confirmed by measuring absorbance from 300 to 600 nm with the help of a ultraviolet (UV)-visible spectrophotometer (Perkin Elmer, Lambda 25).

2.3 Characterization of green-synthesized A. digitata AgNPs

The first step to examine the green synthesis of A. digitata AgNPs was by monitoring the color change followed by recording absorbance from 300 to 600 nm to get the absorbance peak. Then, the average size of A. digitata AgNPs was recorded by analyzing zeta potential (ZEN3600, Malvern) by electrophoretic light scattering (ELS) in a disposable folded capillary cell (DTS1060). The A. digitata AgNPs were loaded on a carbon-coated copper grid and analyzed on transmission electron microscopy (TEM) JEM-1400 plus JEOL and field emission scanning electron microscopy (SEM) JSM-7610F (Joel). Samples of A. digitata fruit extract and AgNPs were placed directly in potassium bromide cells and analyzed for bio-reducing functional groups recorded by infrared spectroscopy (Nicolet 6700; Thermo Scientific) the range from 4,000 to 400 cm−1. Energy-dispersive X-ray spectroscopy was used to validate the presence of specific elements present in the sample.

2.4 Cell culture

Human colon cancer cell lines HTC116 and SW480 provided by Central Research Laboratory King Saud University were cultured in Eagle’s minimum essential medium (Stem Cell Technologies) under humidified incubator having with 5% CO2. Trypsin (Sigma) was used to harvest the cells followed by washing in phosphate buffered saline (PBS) (Sigma) and then used for further experiments.

2.5 Cytotoxic activity of green-synthesized A. digitata AgNPs

Cancer cells were seeded in a 96-well plate at a density of 2 × 105 cells/well in 100 µL of optimized medium grown to a density of 2 × 104 cells/well for 24 h and then exposed to different test concentrations of A. digitata extract and green-synthesized A. digitata AgNPs separately for 48 h. Finally, 100 µL of MTT (Sigma Aldrich, UK) was added at 37°C at a final concentration of 5 mg·mL−1. The 96-well plate was kept in the dark for 2 h before the medium containing MTT was removed. One hundred microliters of dimethyl sulfoxide (Ajax Finechem Pty Ltd, Australia) were added to dissolve formazan crystals. The 96-well-plate was also shaken for 15 min in the dark to help dissolve the formazan crystals. The optical density (OD) of each treatment was measured at absorbance 490 nm using a 96-well plate reader (Molecular Devices; SPECTRA max-PLUS384). Each experiment was performed in four replicates. Values of optical densities were normalized according to the control (untreated cells).

2.6 Gene expression analysis

Gene expression analysis was done after treating cells with IC50 of green-synthesized A. digitata AgNPs and A. digitata fruit extract separately. Cells were incubated for 24 h and then were harvested for RNA extraction.

2.7 RNA isolation and RT-PCR

Reverse transcription polymerase chain reaction (RT-PCR) was performed using the high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA). The cDNA was stored at −20°C until the RT-PCR experiment was carried out. The GAPDH gene was used as an internal control. The oligonucleotide sequences are listed in Table 2. The RT-PCR was done on a LightCycler ViiA™ 7 Instrument (ViiA™ 7; Thermo Fisher Scientific). The data were obtained using LightCycler ViiA™ 7 software 1.0 (ViiA™ 7; Thermo Fisher Scientific). Relative mRNA expression levels were then normalized by using the mRNA level of the reference gene (GAPDH) as an endogenous control in each sample. mRNA data were analyzed using the comparative Ct method.

Table 2

Primer sequence used for relative mRNA expression levels

Primer Sequence
GAPDH F: AATGGGCAGCCGTTAGGAAA
R: GCCCAATACGACCAAATCAGAG
CTNNB1 F: GTAAAACGACGGCCAGTGGACTTCACCTGACAGATCCA
R: CAGGAAACAGCTATGACCAGCTCATCATCCAGCTCCAG
APC F: GACTCGGAAATGGGGTCCAA
R: TCTTCAGTGCCTCAACTTGCT
LRP5 F: TTTTTGGGTTCACGCTGCTG
R: AACTCTGTCACCGACGACCT
LRP6 F: AACGCGAGAAGGGAAGATGG
R: CAAAGGGGCCGCTCTCAG

3 Results and discussion

3.1 Characterizations of green-synthesized A. digitata AgNPs

The formation of A. digitata AgNPs was detected by a color change from light yellow to brown, which happened due to the reduction of AgNO3 to form AgNPs. We synthesize spherical AgNPs in 10 min by mixing silver nitrate solution at 60°C with fruit extract, which was prepared by incubation fruit pulp in boiling water and left overnight, thus accompanying the green chemistry policy. High temperature decreases the diameter of AgNP due to the increasing intensity of the surface plasmon resonance (SPR) band as a result of the bathochromic shift [40]. The sharp peak of SPR at 400 nm in the UV region confirms the formation of AgNPs (Figure 1). This technique is considered one of the basic and quick methods to explore AgNPs [41]. The peak of absorbance is due to the vibration of electrons in synthesized AgNPs [42]. Normally, AgNPs show absorption peaks in the range of 380–470 nm [43].

Figure 1 UV-Vis spectra showing absorbance peak of green-synthesized A. digitata AgNPs.
Figure 1

UV-Vis spectra showing absorbance peak of green-synthesized A. digitata AgNPs.

Green synthesis of A. digitata-mediated AgNPs was confirmed by dynamic light scattering (DLS), which showed average sizes of 16.34 nm, as shown in Figure 2. The polydispersity index was 0.193, indicating small size distribution and homogeneous population of prepared AgNPs [41]. Polydispersity index less than 0.3 specifies monodispersed and can be used for pharmaceutical purposes [44]. Zeta potential was −0.39 as shown in Figure 3. Nanoparticles’ interface in deionized water is negatively charged. Generally, the surface charge appears after nanoparticle preparation, due to the ionizing groups present in the medium [45]. The charge gained by dispersed nanoparticles plays a major role in the stability preventing aggregation [46]. The surface morphology, size, and 3D structure of green-synthesized A. digitata AgNPs were observed by TEM and SEM (Figure 4). TEM results clearly show that AgNPs were spherical and with a size range from 9 to 20 nm, which agrees with the results shown by DLS. The most recent studies listed in Table 1 show almost the same size and shape of AgNPs. TEM is an ultrathin image displaying a 2D structure while SEM demonstrates the 3D structure of a material [47]. Although the spherical structure of A. digitata AgNPs was confirmed by SEM micrograph, the recorded size was in the range of 32.8–37.8 nm, indicating the cluster or aggregation of A. digitata AgNPs [41]. The energy-dispersive spectrum (EDX) of the A. digitata AgNPs exhibited strong signals for the sodium, potassium, and chlorine regions. The presence of other elements sulfur and magnesium was also observed in the spectrum (Figure 5).

Figure 2 DLS result for the green-synthesized A. digitata AgNPs.
Figure 2

DLS result for the green-synthesized A. digitata AgNPs.

Figure 3 Zeta potential distribution of green-synthesized A. digitata AgNPs.
Figure 3

Zeta potential distribution of green-synthesized A. digitata AgNPs.

Figure 4 (a) TEM micrograph and (b) SEM micrograph of the green-synthesized A. digitata AgNPs.
Figure 4

(a) TEM micrograph and (b) SEM micrograph of the green-synthesized A. digitata AgNPs.

Figure 5 EDX elemental analysis of green-synthesized A. digitata AgNPs.
Figure 5

EDX elemental analysis of green-synthesized A. digitata AgNPs.

3.2 Fourier transform infrared spectroscopy (FT-IR)

Fruit extract of A. digitata is very rich in flavonoid, tannin, saponin, alkaloid, and phenols [35,36]. These secondary metabolites help in the reduction process and also act as a capping agent due to which nanoparticles do not aggregate once formed [48]. FT-IR measurements were carried out on A. digitata extract and its reduced form to recognize the changes in the bonds followed by reduction of the metal precursors and capping of A. digitata AgNPs using an FT-IR spectrophotometer. As displayed in Figure 6a and b, the absorption peaks are 3,439 cm−1 assigned for the OH bond of alcohols/phenols, 2,916 cm−1 assigned for the C–H stretch of alkanes, 2,394 cm−1 assigned for the N–H bond of ammonium ions, 1,629 cm−1 assigned for the N–H bend of amines, 1,413 cm−1 assigned for the O–H bend of carboxylic acids, 1,349 cm−1 assigned for the C–H bend of alkenes, 1,068 cm−1 assigned for the C–N bond of aliphatic amines, and 466 cm−1 assigned for the C–H deformation of alkynes, reflecting its complex nature. The FT-IR spectrum of synthesized NPs shows 3,430 cm−1 assigned for the O–H bond of alcohols/phenols, 2,344 cm−1 assigned for the C–C bond of terminal alkynes, and 1,638 cm−1 assigned for the N–H bond of primary amines proteins.

Figure 6 IR spectra of (a) A. digitata extract and (b) green-synthesized A. digitata AgNPs.
Figure 6

IR spectra of (a) A. digitata extract and (b) green-synthesized A. digitata AgNPs.

Most of the peaks that appeared in the A. digitata extract disappeared after the synthesis of A. digitata AgNPs. Based on the FT-IR analysis, it is confirmed that the broad peaks of phenols and proteins act as reducing stabilizing and capping agents and for AgNPs. Our results are in agreement with previous studies showing that the presence of biomolecules in plant extract mediates the process of biosynthesis of nanoparticles [47].

3.3 Cancer-cell cytotoxicity

We use the MTT assay to examine the impact of A. digitata AgNPs and A. digitata fruit extract on the cell viability of cancer cell lines. Both extracts decrease the cell viability in a dose-dependent manner in the range from 3.12 to 100 μg·mL−1 against human colon cancer cell lines HTC116 and SW480. IC50 values of test samples show higher cytotoxicity of A. digitata AgNPs against SW480 followed by HTC116. Remarkable differences in cell cytotoxicity were shown between A. digitata AgNPs and A. digitata fruit extract (Figure 7a and b). At all fixed concentrations, the cytotoxicity effect of the A. digitata AgNPs was higher than the A. digitata extract as shown in Figure 7a and b. The overall results showed that green-synthesized nanoparticles were more active than pure fruit extract on colon cell lines’ death and showed strong cytotoxicity. Many studies have highlighted the effective role of AgNPs against any kind of cancer in vitro and in vivo [49]. Generally, the zeta potential, which depends on the surface charge, is important for the stability of the nanoparticle suspension and is also a major factor in the initial adsorption of nanoparticle on the cell membrane, and the zeta potential and size thus affect the nanoparticle toxicity. The size, shape, and charge of synthesized AgNPs in the current study were acceptable to reveal anticancer properties as small size particles are more active in showing the anticancer activity [49]. The size of an AgNP is the main factor to determine its toxicity toward biological systems as particles that are small in size can pass through cells or subcellular organelles of a cell line [50]. Gliga et al. [51] reported the size-dependent cytotoxicity against human cancer cell lines showing small AgNPs as more cytotoxic as compared to larger particles. AgNPs are proven safe for healthy cells while toxic against cancerous cells.

Figure 7 Cytotoxicity of A. digitata extract and green-synthesized A. digitata AgNPs on human colon cancer cell lines SW480 and HTC116 following 24 h exposure.
Figure 7

Cytotoxicity of A. digitata extract and green-synthesized A. digitata AgNPs on human colon cancer cell lines SW480 and HTC116 following 24 h exposure.

Several experiments in vitro and in vivo have shown that AgNPs can up- or downregulate the expression of many key genes and regulate important signaling pathways to control the cell proliferation and viability of cancer cells [52,53,54].

Abnormal stimulation of the WNT/β-catenin signaling pathway is observed in CRCs with activating mutations in the catenin beta 1 (CTNNB1) gene encoding β-catenin, inactivating adenomatous polyposis coli (APC) gene mutations [55]. Also, the low-density lipoprotein receptor-related protein 6 (LRP6), an indispensable co-receptor for WNT, is overexpressed in colorectal adenocarcinomas [56]. Currently, many clinical trials are being done to see the responses of therapies inhibiting Wnt/β-catenin signaling pathways in patients with CRC. However, chemoresistance is one of the major challenges in these trials. In this study, the expression level of these four genes CTNNB1, APC, LRP5, and LRP6 was measured after treating the cells with A. digitata AgNPs and A. digitata fruit extract to explore its possible role in anticancer mechanisms. Figure 8 presents the results as a chart showing gene expression fold change in the control (without treated) cancerous colorectal cell line and treated cell line. Normally SW480 expresses only mutant APC and whereas HCT116 expresses wild-type APC but mutant CTNNB1 [57]. Mutation in APC and CTNNB1 occurs in more than 80% of colon tumors and is one of the initial events that contribute to colon cancer origin [58]. APC acts as a negative regulator of the canonical WNT signaling pathway through proteasomal degradation of β-catenin, which is expressed by the CTNNB1 gene [59]. A. digitata AgNPs and its aqueous extract show low expression of the APC gene in SW480 as compared to untreated cells, but it was slightly more expressed in HCT116 cells on treatment. Expression of the CTNNB1 gene was decreased in both types of cell lines on treatment. These observations clearly show the inhibitory effect of A. digitata AgNPs and its aqueous extract against chosen cell lines. Alteration in low-density lipoprotein-related receptors 5 and 6 (LRP5/6) genes are linked to the development of cancer in humans [60]. The expression of LRP5 can regulate the expression of serotonin by inhibiting the expression of tryptophan hydroxylase 1 (Tph1), which is the rate-limiting biosynthetic enzyme for serotonin [61]. Serotonin has been found to promote CRC by the modulation of DNA repair mechanisms and immune response [62]. LRP5 was highly expressed in both cell lines after treatment with A. digitata AgNPs and A. digitata extract. Anti-cancer potential of both extracts in our results can be revealed by an elevated level of low-density lipoprotein-related receptors 5 since LRP5 can downregulate tyrosine hydroxylase and decrease serotonin levels [63]. We find a remarkable decrease in expression of the LRP6 gene in both cell lines with treatment. Reducing LRP6 expression has been reported to inhibit the cell proliferation and delay tumor growth [64]. Also, LRP6 is a co-receptor for WNT and is overexpressed in colorectal adenocarcinomas in association with increased WNT/β-catenin signaling [65].

Figure 8 Gene expression fold change in SW480 and HTC116 cell lines treated with A. digitata extract and green-synthesized A. digitata AgNPs.
Figure 8

Gene expression fold change in SW480 and HTC116 cell lines treated with A. digitata extract and green-synthesized A. digitata AgNPs.

4 Conclusions

Studies showing molecular mechanisms behind the anti-cancer potential of green-synthesized AgNPs are limited. AgNPs were successfully synthesized from A. digitata fruit extract, which acts as reducing, capping, and stabilizing agents in the process. The synthesis procedure was simple, low cost, and eco-friendly. SPR at 400 nm confirms the formation of AgNPs. Analytical characterization, such as TEM, SEM, and ELS, supports the overall morphology of synthesized AgNPs. A. digitata AgNPs and A. digitata fruit extract showed potent anti-cancer potential.

  1. Funding information: This research project was supported by Researchers Supporting Project number (RSP2022R495) King Saud University, Riyadh, Saudi Arabia.

  2. Author contributions: Fatimah Basil Almukaynizi: methodology; Maha H. Daghestani: project administration, resources; Manal A. Awad: methodology; Arwa Althomali: methodology; Nada M. Merghani: methodology; Wadha I. Bukhari: methodology; Norah M. Algahtani: methodology; Shatha S. Al-Zuhairy: methodology; Ahlam M. ALOthman: methodology; Eman A. Alsenani: methodology; Badrih O. Alojayan: methodology; Khulud S. Al-Saif: methodology; Ramesa Shafi Bhat: writing – original draft.

  3. Conflict of interest: The authors state no conflict of interest.

References

[1] Lee SH, Jun BH. Silver nanoparticles: synthesis and application for nanomedicine. Int J Mol Sci. 2019;20(4):865.10.3390/ijms20040865Search in Google Scholar PubMed PubMed Central

[2] Pascu B, Negrea A, Ciopec M, Davidescu CM, Negrea P, Gherman V, et al. New generation of antibacterial products based on colloidal silver. Materials (Basel). 2020;13(7):1578.10.3390/ma13071578Search in Google Scholar PubMed PubMed Central

[3] Ioan-Avram N, Anton F, Maria S, Denisa F, Ovidiu O, Ecaterina A. Silver-based materials for biomedical applications. Curr Org Chem. 2014;18:173–84.10.2174/13852728113176660141Search in Google Scholar

[4] Nakamura S, Sato M, Sato Y, Ando N, Takayama T, Fujita M, et al. Synthesis and application of silver nanoparticles (Ag NPs) for the prevention of infection in healthcare workers. Int J Mol Sci. 2019;20(15):3620.10.3390/ijms20153620Search in Google Scholar PubMed PubMed Central

[5] Paladini F, Pollini M. Antimicrobial silver nanoparticles for wound healing application: progress and future trends. Materials (Basel). 2019;12(16):2540.10.3390/ma12162540Search in Google Scholar PubMed PubMed Central

[6] Burdușel AC, Gherasim O, Grumezescu AM, Mogoantă L, Ficai A, Andronescu E. Biomedical applications of silver nanoparticles: an up-to-date overview. Nanomaterials (Basel). 2018;8(9):681.10.3390/nano8090681Search in Google Scholar PubMed PubMed Central

[7] Patra JK, Das G, Fraceto LF, Campos EVR, Rodriguez-Torres MDP, Acosta-Torres LS, et al. Nano based drug delivery systems: recent developments and future prospects. J Nanobiotechnol. 2018;16(1):71.10.1186/s12951-018-0392-8Search in Google Scholar PubMed PubMed Central

[8] De Matteis V, Cascione M, Toma CC, Leporatti S. Silver nanoparticles: synthetic routes, in vitro toxicity and theranostic applications for cancer disease. Nanomaterials (Basel). 2018;8(5):319.10.3390/nano8050319Search in Google Scholar PubMed PubMed Central

[9] Zhang XF, Liu ZG, Shen W, Gurunathan S. Silver nanoparticles: synthesis, characterization, properties, applications, and therapeutic approaches. Int J Mol Sci. 2016;17(9):1534.10.3390/ijms17091534Search in Google Scholar PubMed PubMed Central

[10] Iravani S, Korbekandi H, Mirmohammadi SV, Zolfaghari B. Synthesis of silver nanoparticles: chemical, physical and biological methods. Res Pharm Sci. 2014;9(6):385–406.Search in Google Scholar

[11] Daghestani M, Al Rashed SA, Bukhari W, Al-Ojayan B, Ibrahim EM, Al-Qahtani AM, et al. Bactericidal and cytotoxic properties of green synthesized nanosilver using Rosmarinus officinalis leaves. Green Process Synth. 2020;9(1):230–6.10.1515/gps-2020-0025Search in Google Scholar

[12] Makarov V, Love A, Sinitsyna O, Makarova S, Yaminsky I, Taliansky M, et al. “Green” nanotechnologies: synthesis of metal nanoparticles using plants. Acta Nat. 2014;6:35–44.10.32607/20758251-2014-6-1-35-44Search in Google Scholar

[13] Fayaz AM, Balaji K, Kalaichelvan P, Venkatesan R. Fungal based synthesis of silver nanoparticles – an effect of temperature on the size of particles. Colloids Surf B Biointerfaces. 2009;74:123–6.10.1016/j.colsurfb.2009.07.002Search in Google Scholar PubMed

[14] Shiny P, Mukherjee A, Chandrasekaran N. Marine algae mediated synthesis of the silver nanoparticles and its antibacterial efficiency. Int J Pharm Pharm Sci. 2013;5:239–41.10.1166/asem.2013.1301Search in Google Scholar

[15] Niknejad F, Nabili M, Daie Ghazvini R, Moazeni M. Green synthesis of silver nanoparticles: advantages of the yeast Saccharomyces cerevisiae model. Curr Med Mycol. 2015;1(3):17–24.10.18869/acadpub.cmm.1.3.17Search in Google Scholar PubMed PubMed Central

[16] Skandalis N, Dimopoulou A, Georgopoulou A, Gallios N, Papadopoulos D, Tsipas D, et al. The effect of silver nanoparticles size, produced using plant extract from arbutus unedo, on their antibacterial efficacy. Nanomaterials (Basel). 2017;7(7):178.10.3390/nano7070178Search in Google Scholar PubMed PubMed Central

[17] Hano C, Abbasi BH. Plant-based green synthesis of nanoparticles: production, characterization and applications. Biomolecules. 2022;12:31.10.3390/biom12010031Search in Google Scholar PubMed PubMed Central

[18] Mussin J, Robles-Botero V, Casañas-Pimentel R, Rojas F, Angiolella L, Martín-Martínez ES, et al. Antimicrobial and cytotoxic activity of green synthesis silver nanoparticles targeting skin and soft tissue infectious agents. Sci Rep. 2021;11:14566.10.1038/s41598-021-94012-ySearch in Google Scholar PubMed PubMed Central

[19] Al-Zahrani SA, Bhat RS, Al Rashed SA, Mahmood A, Al Fahad A, Alamro G, et al. Green-synthesized silver nanoparticles with aqueous extract of green algae Chaetomorpha ligustica and its anticancer potential. Green Process Synth. 2021;10:711–21.10.1515/gps-2021-0067Search in Google Scholar

[20] Riaz M, Mutreja V, Sareen S, Ahmad B, Faheem M, Zahid N, et al. Exceptional antibacterial and cytotoxic potency of monodisperse greener AgNPs prepared under optimized pH and temperature. Sci Rep. 2021;11:2866.10.1038/s41598-021-82555-zSearch in Google Scholar PubMed PubMed Central

[21] Elhawary S, EL-Hefnawy H, Alzahraa FA, Sobeh M, Mostafa E, Osman S, et al. Green synthesis of silver nanoparticles using extract of jasminum officinal L. leaves and evaluation of cytotoxic activity towards bladder (5637) and breast cancer (MCF-7) cell lines. Int J Nanomed. 2020;15:9771–978.10.2147/IJN.S269880Search in Google Scholar PubMed PubMed Central

[22] Karimi S, Mahdavi, Shahri M. Medical and cytotoxicity effects of green synthesized silver nanoparticles using Achillea millefolium extract on MOLT-4 lymphoblastic leukemia cell line. J Med Virol. 2021;93(6):3899–906.10.1002/jmv.26694Search in Google Scholar PubMed

[23] Devanesan S, AlSalhi MS. Green synthesis of silver nanoparticles using the flower extract of abelmoschus esculentus for cytotoxicity and antimicrobial studies. Int J Nanomed. 2021;14(16):3343–56.10.2147/IJN.S307676Search in Google Scholar PubMed PubMed Central

[24] Bharadwaj KK, Rabha B, Pati S, Choudhury BK, Sarkar T, Gogoi SK, et al. Green synthesis of silver nanoparticles using diospyros malabarica fruit extract and assessments of their antimicrobial, anticancer and catalytic reduction of 4-nitrophenol (4-NP). Nanomaterials (Basel). 2021;11(8):1999.10.3390/nano11081999Search in Google Scholar PubMed PubMed Central

[25] Alwhibi MS, Soliman DA, Awad MA, Alangery AB, Al Dehaish H, Alwasel YA. Green synthesis of silver nanoparticles: characterization and its potential biomedical applications. Green Process Synth. 2021;10(1):412–20.10.1515/gps-2021-0039Search in Google Scholar

[26] Devanesan S, Ponmurugan K, AlSalhi MS, Al-Dhabi NA. Cytotoxic and antimicrobial efficacy of silver nanoparticles synthesized using a traditional phytoproduct, asafoetida gum. Int J Nanomed. 2020;15:4351–62.10.2147/IJN.S258319Search in Google Scholar PubMed PubMed Central

[27] Khorrami S, Zarrabi A, Khaleghi M, Danaei M, Mozafari MR. Selective cytotoxicity of green synthesized silver nanoparticles against the MCF-7 tumor cell line and their enhanced antioxidant and antimicrobial properties. Int J Nanomed. 2018;27(13):8013–24.10.2147/IJN.S189295Search in Google Scholar PubMed PubMed Central

[28] Li R, Pan Y, Li N, Wang Q, Chen Y, Phisalaphong M, et al. Antibacterial and cytotoxic activities of a green synthesized silver nanoparticles using corn silk aqueous extract. Colloids Surf A: Physicochem Eng Asp. 2020;598:124827.10.1016/j.colsurfa.2020.124827Search in Google Scholar

[29] Donga S, Chanda S. Facile green synthesis of silver nanoparticles using Mangifera indica seed aqueous extract and its antimicrobial, antioxidant and cytotoxic potential (3-in-1 system). Artif Cell Nanomed Biotechnol. 2021;49(1):292–302.10.1080/21691401.2021.1899193Search in Google Scholar PubMed

[30] Kapoor S, Sood H, Saxena S, Chaurasia OP. Green synthesis of silver nanoparticles using Rhodiola imbricata and Withania somnifera root extract and their potential catalytic, antioxidant, cytotoxic and growth-promoting activities. Bioprocess Biosyst Eng. 2022;45:365–80.10.1007/s00449-021-02666-9Search in Google Scholar PubMed

[31] White BD, Duan C, Townley HE. Nanoparticle activation methods in cancer treatment. Biomolecules. 2019;9(5):202.10.3390/biom9050202Search in Google Scholar PubMed PubMed Central

[32] Rawla P, Sunkara T, Barsouk A. Epidemiology of colorectal cancer: incidence, mortality, survival, and risk factors. Prz Gastroenterol. 2019;14(2):89–103.10.5114/pg.2018.81072Search in Google Scholar PubMed PubMed Central

[33] Kelly C, Bhuva N, Harrison M, Buckley A, Saunders M. Use of raltitrexed as an alternative to 5-fluorouracil and capecitabine in cancer patients with cardiac history. Eur J Cancer. 2013;49:2303–10.10.1016/j.ejca.2013.03.004Search in Google Scholar PubMed

[34] Nallanthighal S, Chan C, Murray TM, Mosier AP, Cady NC, Reliene R. Differential effects of silver nanoparticles on DNA damage and DNA repair gene expression in Ogg1-deficient and wild type mice. Nanotoxicology. 2017 Oct;11(8):996–1011.10.1080/17435390.2017.1388863Search in Google Scholar PubMed PubMed Central

[35] Muthai KU, Karori MS, Muchugi A, Indieka AS, Dembele C, Mng’omba S, et al. Nutritional variation in baobab (Adansonia digitata L.) fruit pulp and seeds based on Africa geographical regions. Food Sci Nutr. 2017;5(6):1116–29.10.1002/fsn3.502Search in Google Scholar PubMed PubMed Central

[36] De Caluwé E, Halamová K, Van Damme P. Adansonia digitata L.: a review of traditional uses, phytochemistry and pharmacology. Afr Focus. 2010;23(1):11–51.10.1163/2031356X-02301005Search in Google Scholar

[37] Buchmann C, Prehsler S, Hartl A, Vogl CR. The importance of baobab (Adansonia digitata L.) in rural west African subsistence-suggestion of a cautionary approach to international market export of baobab fruits. Ecol Food Nutr. 2010;49:145–72.10.1080/03670241003766014Search in Google Scholar PubMed

[38] FDA (U.S. Food and Drug Administration) agency response letter GRAS notice no GRN 000273.2009. http://www.fda.gov/food/ingredientspackaginglabeling/gras/noticeinventory/ucm174945.htm).Search in Google Scholar

[39] Li XN, Sun J, Shi H, Yu LL, Ridge CD, Mazzola EP, et al. Profiling hydroxycinnamic acid glycosides, iridoid glycosides, and phenylethanoid glycosides in baobab fruit pulp (Adansonia digitata). Food Res Int. 2017;99(Pt 1):755–61.10.1016/j.foodres.2017.06.025Search in Google Scholar PubMed PubMed Central

[40] Bindhu MR, Umadevi M. Silver and gold nanoparticles for sensor and antibacterial applications. Spectrochim Acta Part A: Mol Biomol Spectrosc. 2014;128:37–45.10.1016/j.saa.2014.02.119Search in Google Scholar PubMed

[41] Bhat RS, Almusallam J, Al Daihan S, Al-Dbass A. Biosynthesis of silver nanoparticles using Azadirachta indica leaves: characterisation and impact on Staphylococcus aureus growth and glutathione-S-transferase activity. IET Nanobiotechnol. 2019;13:498–502.10.1049/iet-nbt.2018.5133Search in Google Scholar

[42] Anandalakshmi K, Venugobal J, Ramasamy V. Characterization of silver nanoparticles by green synthesis method using Pedalium murex leaf extract and their antibacterial activity. Appl Nanosci. 2016;6:399–408.10.1007/s13204-015-0449-zSearch in Google Scholar

[43] Rahman A, Kumar S, Bafana A, Lin J, Dahoumane SA, Jeffryes CA. Mechanistic view of the light-induced synthesis of silver nanoparticles using extracellular polymeric substances of Chlamydomonas reinhardtii. Molecules. 2019;24(19):3506.10.3390/molecules24193506Search in Google Scholar PubMed PubMed Central

[44] Danaei M, Dehghankhold M, Ataei S, Hasanzadeh Davarani F, Javanmard R, Dokhani A, et al. Impact of particle size and polydispersity index on the clinical applications of lipidic nanocarrier systems. Pharmaceutics. 2018;10(2):57.10.3390/pharmaceutics10020057Search in Google Scholar PubMed PubMed Central

[45] Wang T, Jin X, Chen Z, Megharaj M, Naidu R. Green synthesis of Fe nanoparticles using eucalyptus leaf extracts for treatment of eutrophic wastewater. Sci Total Env. 2014;466:210–3.10.1016/j.scitotenv.2013.07.022Search in Google Scholar PubMed

[46] Rauwel P, Küünal S, Ferdov S, Rauwel E. A review on the green synthesis of silver nanoparticles and their morphologies studied via TEM. Adv Mater Sci Eng. 2015;2015:682749.10.1155/2015/682749Search in Google Scholar

[47] El-Ansary A, Warsy A, Daghestani M, Merghani NM, Al-Dbass A, Bukhari W, et al. Characterization, antibacterial, and neurotoxic effect of green synthesized nanosilver using Ziziphus spina Christi aqueous leaf extract collected from Riyadh, Saudi Arabia’. Mater Res Express. 2018;5:025033.10.1088/2053-1591/aaaf5fSearch in Google Scholar

[48] Marslin G, Siram K, Maqbool Q, Selvakesavan RK, Kruszka D, Kachlicki P, et al. Secondary metabolites in the green synthesis of metallic nanoparticles. Mater (Basel). 2018;11(6):940.10.3390/ma11060940Search in Google Scholar PubMed PubMed Central

[49] Wang ZX, Chen CY, Wang Y, Li FXZ, Huang J, Luo ZW, et al. Ångstrom scale silver particles as a promising agent for low toxicity broad-spectrum potent anticancer therapy. Adv Funct Mater. 2019;29:1808556.10.1002/adfm.201808556Search in Google Scholar

[50] Rohde MM, Snyder CM, Sloop J, Solst SR, Donati GL, Spitz DR, et al. The mechanism of cell death induced by silver nanoparticles is distinct from silver cations. Part Fibre Toxicol. 2021;18:37.10.1186/s12989-021-00430-1Search in Google Scholar PubMed PubMed Central

[51] Gliga AR, Skoglund S, Wallinder IO, Fadeel B, Karlsson HL. Size-dependent cytotoxicity of silver nanoparticles in human lung cells: the role of cellular uptake, agglomeration and Ag release. Part Fibre Toxicol. 2014;11:11.10.1186/1743-8977-11-11Search in Google Scholar PubMed PubMed Central

[52] Farah MA, Ali MA, Chen SM, Li Y, Al-Hemaid FM, Abou-Tarboush FM, et al. Silver nanoparticles synthesized from Adenium obesum leaf extract induced DNA damage, apoptosis and autophagy via generation of reactive oxygen species. Colloids Surf B Biointerfaces. 2016;141:158–69.10.1016/j.colsurfb.2016.01.027Search in Google Scholar PubMed

[53] Mytych J, Zebrowski J, Lewinska A, Wnuk M. Prolonged effects of silver nanoparticles on p53/p21 pathway-mediated proliferation, DNA damage response, and methylation parameters in HT22 hippocampal neuronal cells. Mol Neurobiol. 2017;54:1285–300.10.1007/s12035-016-9688-6Search in Google Scholar PubMed PubMed Central

[54] Yang T, Yao Q, Cao F, Liu Q, Liu B, Wang XH. Silver nanoparticles inhibit the function of hypoxia-inducible factor-1 and target genes: insight into the cytotoxicity and antiangiogenesis. Int J Nanomed. 2016;11:6679–92.10.2147/IJN.S109695Search in Google Scholar PubMed PubMed Central

[55] Schatoff EM, Leach BI, Dow LE. Wnt signaling and colorectal cancer. Curr Colorectal Cancer Rep. 2017 Apr;13(2):101–10.10.1007/s11888-017-0354-9Search in Google Scholar PubMed PubMed Central

[56] Raisch J, Côté-Biron A, Rivard N. A role for the WNT co-receptor LRP6 in pathogenesis and therapy of epithelial cancers. Cancers (Basel). 2019;11(8):1162.10.3390/cancers11081162Search in Google Scholar PubMed PubMed Central

[57] El-Bahrawy M, Poulsom R, Rowan AJ, Tomlinson IT, Alison MR. Characterization of the E-cadherin/catenin complex in colorectal carcinoma cell lines. Int J Exp Pathol. 2004;85(3):175.10.1111/j.0959-9673.2004.0371.xSearch in Google Scholar PubMed PubMed Central

[58] Kwong LN, Dove WF. APC and its modifiers in colon cancer. Adv Exp Med Biol. 2009;656:85–106.10.1007/978-1-4419-1145-2_8Search in Google Scholar PubMed PubMed Central

[59] Parker TW, Neufeld KL. APC controls Wnt-induced β-catenin destruction complex recruitment in human colonocytes. Sci Rep. 2020;10:2957.10.1038/s41598-020-59899-zSearch in Google Scholar PubMed PubMed Central

[60] Joiner DM, Ke J, Zhong Z, Xu HE, Williams BO. LRP5 and LRP6 in development and disease. Trends Endocrinol Metab. 2013;24(1):31–9.10.1016/j.tem.2012.10.003Search in Google Scholar PubMed PubMed Central

[61] Yadav VK, Ryu JH, Suda N, Tanaka KF, Gingrich JA, Schütz G, et al. Karsenty GLrp5 controls bone formation by inhibiting serotonin synthesis in the duodenum. Cell. 2008;135(5):825–37.10.1016/j.cell.2008.09.059Search in Google Scholar PubMed PubMed Central

[62] Kannen V, Bader M, Sakita JY, Uyemura SA, Squire JA. The dual role of serotonin in colorectal cancer. Trends Endocrinol Metab. 2020;8:611–25.10.1016/j.tem.2020.04.008Search in Google Scholar PubMed

[63] Walther DJ, Peter JU, Bader M. 7-Hydroxytryptophan, a novel, specific, cytotoxic agent for carcinoids and other serotonin-producing tumors. Cancer. 2002;94(12):3135–40.10.1002/cncr.10592Search in Google Scholar PubMed

[64] Raisch J, Côté-Biron A, Rivard N. A role for the WNT Co-receptor LRP6 in pathogenesis and therapy of epithelial cancers. Cancers (Basel). 2002;11(8):1162.10.3390/cancers11081162Search in Google Scholar PubMed PubMed Central

[65] Li Y, Lu W, He X, Schwartz AL, Bu G. LRP6 expression promotes cancer cell proliferation and tumorigenesis by altering β-catenin subcellular distribution. Oncogene. 2004;23:9129–213.10.1038/sj.onc.1208123Search in Google Scholar PubMed

Received: 2021-12-23
Revised: 2022-02-15
Accepted: 2022-02-20
Published Online: 2022-04-19

© 2022 Fatimah Basil Almukaynizi et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Kinetic study on the reaction between Incoloy 825 alloy and low-fluoride slag for electroslag remelting
  3. Black pepper (Piper nigrum) fruit-based gold nanoparticles (BP-AuNPs): Synthesis, characterization, biological activities, and catalytic applications – A green approach
  4. Protective role of foliar application of green-synthesized silver nanoparticles against wheat stripe rust disease caused by Puccinia striiformis
  5. Effects of nitrogen and phosphorus on Microcystis aeruginosa growth and microcystin production
  6. Efficient degradation of methyl orange and methylene blue in aqueous solution using a novel Fenton-like catalyst of CuCo-ZIFs
  7. Synthesis of biological base oils by a green process
  8. Efficient pilot-scale synthesis of the key cefonicid intermediate at room temperature
  9. Synthesis and characterization of noble metal/metal oxide nanoparticles and their potential antidiabetic effect on biochemical parameters and wound healing
  10. Regioselectivity in the reaction of 5-amino-3-anilino-1H-pyrazole-4-carbonitrile with cinnamonitriles and enaminones: Synthesis of functionally substituted pyrazolo[1,5-a]pyrimidine derivatives
  11. A numerical study on the in-nozzle cavitating flow and near-field atomization of cylindrical, V-type, and Y-type intersecting hole nozzles using the LES-VOF method
  12. Synthesis and characterization of Ce-doped TiO2 nanoparticles and their enhanced anticancer activity in Y79 retinoblastoma cancer cells
  13. Aspects of the physiochemical properties of SARS-CoV-2 to prevent S-protein receptor binding using Arabic gum
  14. Sonochemical synthesis of protein microcapsules loaded with traditional Chinese herb extracts
  15. MW-assisted hydrolysis of phosphinates in the presence of PTSA as the catalyst, and as a MW absorber
  16. Fabrication of silicotungstic acid immobilized on Ce-based MOF and embedded in Zr-based MOF matrix for green fatty acid esterification
  17. Superior photocatalytic degradation performance for gaseous toluene by 3D g-C3N4-reduced graphene oxide gels
  18. Catalytic performance of Na/Ca-based fluxes for coal char gasification
  19. Slow pyrolysis of waste navel orange peels with metal oxide catalysts to produce high-grade bio-oil
  20. Development and butyrylcholinesterase/monoamine oxidase inhibition potential of PVA-Berberis lycium nanofibers
  21. Influence of biosynthesized silver nanoparticles using red alga Corallina elongata on broiler chicks’ performance
  22. Green synthesis, characterization, cytotoxicity, and antimicrobial activity of iron oxide nanoparticles using Nigella sativa seed extract
  23. Vitamin supplements enhance Spirulina platensis biomass and phytochemical contents
  24. Malachite green dye removal using ceramsite-supported nanoscale zero-valent iron in a fixed-bed reactor
  25. Green synthesis of manganese-doped superparamagnetic iron oxide nanoparticles for the effective removal of Pb(ii) from aqueous solutions
  26. Desalination technology for energy-efficient and low-cost water production: A bibliometric analysis
  27. Biological fabrication of zinc oxide nanoparticles from Nepeta cataria potentially produces apoptosis through inhibition of proliferative markers in ovarian cancer
  28. Effect of stabilizers on Mn ZnSe quantum dots synthesized by using green method
  29. Calcium oxide addition and ultrasonic pretreatment-assisted hydrothermal carbonization of granatum for adsorption of lead
  30. Fe3O4@SiO2 nanoflakes synthesized using biogenic silica from Salacca zalacca leaf ash and the mechanistic insight into adsorption and photocatalytic wet peroxidation of dye
  31. Facile route of synthesis of silver nanoparticles templated bacterial cellulose, characterization, and its antibacterial application
  32. Synergistic in vitro anticancer actions of decorated selenium nanoparticles with fucoidan/Reishi extract against colorectal adenocarcinoma cells
  33. Preparation of the micro-size flake silver powders by using a micro-jet reactor
  34. Effect of direct coal liquefaction residue on the properties of fine blue-coke-based activated coke
  35. Integration of microwave co-torrefaction with helical lift for pellet fuel production
  36. Cytotoxicity of green-synthesized silver nanoparticles by Adansonia digitata fruit extract against HTC116 and SW480 human colon cancer cell lines
  37. Optimization of biochar preparation process and carbon sequestration effect of pruned wolfberry branches
  38. Anticancer potential of biogenic silver nanoparticles using the stem extract of Commiphora gileadensis against human colon cancer cells
  39. Fabrication and characterization of lysine hydrochloride Cu(ii) complexes and their potential for bombing bacterial resistance
  40. First report of biocellulose production by an indigenous yeast, Pichia kudriavzevii USM-YBP2
  41. Biosynthesis and characterization of silver nanoparticles prepared using seeds of Sisymbrium irio and evaluation of their antifungal and cytotoxic activities
  42. Synthesis, characterization, and photocatalysis of a rare-earth cerium/silver/zinc oxide inorganic nanocomposite
  43. Developing a plastic cycle toward circular economy practice
  44. Fabrication of CsPb1−xMnxBr3−2xCl2x (x = 0–0.5) quantum dots for near UV photodetector application
  45. Anti-colon cancer activities of green-synthesized Moringa oleifera–AgNPs against human colon cancer cells
  46. Phosphorus removal from aqueous solution by adsorption using wetland-based biochar: Batch experiment
  47. A low-cost and eco-friendly fabrication of an MCDI-utilized PVA/SSA/GA cation exchange membrane
  48. Synthesis, microstructure, and phase transition characteristics of Gd/Nd-doped nano VO2 powders
  49. Biomediated synthesis of ZnO quantum dots decorated attapulgite nanocomposites for improved antibacterial properties
  50. Preparation of metal–organic frameworks by microwave-assisted ball milling for the removal of CR from wastewater
  51. A green approach in the biological base oil process
  52. A cost-effective and eco-friendly biosorption technology for complete removal of nickel ions from an aqueous solution: Optimization of process variables
  53. Protective role of Spirulina platensis liquid extract against salinity stress effects on Triticum aestivum L.
  54. Comprehensive physical and chemical characterization highlights the uniqueness of enzymatic gelatin in terms of surface properties
  55. Effectiveness of different accelerated green synthesis methods in zinc oxide nanoparticles using red pepper extract: Synthesis and characterization
  56. Blueprinting morpho-anatomical episodes via green silver nanoparticles foliation
  57. A numerical study on the effects of bowl and nozzle geometry on performances of an engine fueled with diesel or bio-diesel fuels
  58. Liquid-phase hydrogenation of carbon tetrachloride catalyzed by three-dimensional graphene-supported palladium catalyst
  59. The catalytic performance of acid-modified Hβ molecular sieves for environmentally friendly acylation of 2-methylnaphthalene
  60. A study of the precipitation of cerium oxide synthesized from rare earth sources used as the catalyst for biodiesel production
  61. Larvicidal potential of Cipadessa baccifera leaf extract-synthesized zinc nanoparticles against three major mosquito vectors
  62. Fabrication of green nanoinsecticides from agri-waste of corn silk and its larvicidal and antibiofilm properties
  63. Palladium-mediated base-free and solvent-free synthesis of aromatic azo compounds from anilines catalyzed by copper acetate
  64. Study on the functionalization of activated carbon and the effect of binder toward capacitive deionization application
  65. Co-chlorination of low-density polyethylene in paraffin: An intensified green process alternative to conventional solvent-based chlorination
  66. Antioxidant and photocatalytic properties of zinc oxide nanoparticles phyto-fabricated using the aqueous leaf extract of Sida acuta
  67. Recovery of cobalt from spent lithium-ion battery cathode materials by using choline chloride-based deep eutectic solvent
  68. Synthesis of insoluble sulfur and development of green technology based on Aspen Plus simulation
  69. Photodegradation of methyl orange under solar irradiation on Fe-doped ZnO nanoparticles synthesized using wild olive leaf extract
  70. A facile and universal method to purify silica from natural sand
  71. Green synthesis of silver nanoparticles using Atalantia monophylla: A potential eco-friendly agent for controlling blood-sucking vectors
  72. Endophytic bacterial strain, Brevibacillus brevis-mediated green synthesis of copper oxide nanoparticles, characterization, antifungal, in vitro cytotoxicity, and larvicidal activity
  73. Off-gas detection and treatment for green air-plasma process
  74. Ultrasonic-assisted food grade nanoemulsion preparation from clove bud essential oil and evaluation of its antioxidant and antibacterial activity
  75. Construction of mercury ion fluorescence system in water samples and art materials and fluorescence detection method for rhodamine B derivatives
  76. Hydroxyapatite/TPU/PLA nanocomposites: Morphological, dynamic-mechanical, and thermal study
  77. Potential of anaerobic co-digestion of acidic fruit processing waste and waste-activated sludge for biogas production
  78. Synthesis and characterization of ZnO–TiO2–chitosan–escin metallic nanocomposites: Evaluation of their antimicrobial and anticancer activities
  79. Nitrogen removal characteristics of wet–dry alternative constructed wetlands
  80. Structural properties and reactivity variations of wheat straw char catalysts in volatile reforming
  81. Microfluidic plasma: Novel process intensification strategy
  82. Antibacterial and photocatalytic activity of visible-light-induced synthesized gold nanoparticles by using Lantana camara flower extract
  83. Antimicrobial edible materials via nano-modifications for food safety applications
  84. Biosynthesis of nano-curcumin/nano-selenium composite and their potentialities as bactericides against fish-borne pathogens
  85. Exploring the effect of silver nanoparticles on gene expression in colon cancer cell line HCT116
  86. Chemical synthesis, characterization, and dose optimization of chitosan-based nanoparticles of clodinofop propargyl and fenoxaprop-p-ethyl for management of Phalaris minor (little seed canary grass): First report
  87. Double [3 + 2] cycloadditions for diastereoselective synthesis of spirooxindole pyrrolizidines
  88. Green synthesis of silver nanoparticles and their antibacterial activities
  89. Review Articles
  90. A comprehensive review on green synthesis of titanium dioxide nanoparticles and their diverse biomedical applications
  91. Applications of polyaniline-impregnated silica gel-based nanocomposites in wastewater treatment as an efficient adsorbent of some important organic dyes
  92. Green synthesis of nano-propolis and nanoparticles (Se and Ag) from ethanolic extract of propolis, their biochemical characterization: A review
  93. Advances in novel activation methods to perform green organic synthesis using recyclable heteropolyacid catalysis
  94. Limitations of nanomaterials insights in green chemistry sustainable route: Review on novel applications
  95. Special Issue: Use of magnetic resonance in profiling bioactive metabolites and its applications (Guest Editors: Plalanoivel Velmurugan et al.)
  96. Stomach-affecting intestinal parasites as a precursor model of Pheretima posthuma treated with anthelmintic drug from Dodonaea viscosa Linn.
  97. Anti-asthmatic activity of Saudi herbal composites from plants Bacopa monnieri and Euphorbia hirta on Guinea pigs
  98. Embedding green synthesized zinc oxide nanoparticles in cotton fabrics and assessment of their antibacterial wound healing and cytotoxic properties: An eco-friendly approach
  99. Synthetic pathway of 2-fluoro-N,N-diphenylbenzamide with opto-electrical properties: NMR, FT-IR, UV-Vis spectroscopic, and DFT computational studies of the first-order nonlinear optical organic single crystal
https://doi.org/10.1515/gps-2022-0031
Keywords for this article
Adansonia digitata; silver nanoparticles; gene expression; human colon cancer cell line
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Kinetic study on the reaction between Incoloy 825 alloy and low-fluoride slag for electroslag remelting
  3. Black pepper (Piper nigrum) fruit-based gold nanoparticles (BP-AuNPs): Synthesis, characterization, biological activities, and catalytic applications – A green approach
  4. Protective role of foliar application of green-synthesized silver nanoparticles against wheat stripe rust disease caused by Puccinia striiformis
  5. Effects of nitrogen and phosphorus on Microcystis aeruginosa growth and microcystin production
  6. Efficient degradation of methyl orange and methylene blue in aqueous solution using a novel Fenton-like catalyst of CuCo-ZIFs
  7. Synthesis of biological base oils by a green process
  8. Efficient pilot-scale synthesis of the key cefonicid intermediate at room temperature
  9. Synthesis and characterization of noble metal/metal oxide nanoparticles and their potential antidiabetic effect on biochemical parameters and wound healing
  10. Regioselectivity in the reaction of 5-amino-3-anilino-1H-pyrazole-4-carbonitrile with cinnamonitriles and enaminones: Synthesis of functionally substituted pyrazolo[1,5-a]pyrimidine derivatives
  11. A numerical study on the in-nozzle cavitating flow and near-field atomization of cylindrical, V-type, and Y-type intersecting hole nozzles using the LES-VOF method
  12. Synthesis and characterization of Ce-doped TiO2 nanoparticles and their enhanced anticancer activity in Y79 retinoblastoma cancer cells
  13. Aspects of the physiochemical properties of SARS-CoV-2 to prevent S-protein receptor binding using Arabic gum
  14. Sonochemical synthesis of protein microcapsules loaded with traditional Chinese herb extracts
  15. MW-assisted hydrolysis of phosphinates in the presence of PTSA as the catalyst, and as a MW absorber
  16. Fabrication of silicotungstic acid immobilized on Ce-based MOF and embedded in Zr-based MOF matrix for green fatty acid esterification
  17. Superior photocatalytic degradation performance for gaseous toluene by 3D g-C3N4-reduced graphene oxide gels
  18. Catalytic performance of Na/Ca-based fluxes for coal char gasification
  19. Slow pyrolysis of waste navel orange peels with metal oxide catalysts to produce high-grade bio-oil
  20. Development and butyrylcholinesterase/monoamine oxidase inhibition potential of PVA-Berberis lycium nanofibers
  21. Influence of biosynthesized silver nanoparticles using red alga Corallina elongata on broiler chicks’ performance
  22. Green synthesis, characterization, cytotoxicity, and antimicrobial activity of iron oxide nanoparticles using Nigella sativa seed extract
  23. Vitamin supplements enhance Spirulina platensis biomass and phytochemical contents
  24. Malachite green dye removal using ceramsite-supported nanoscale zero-valent iron in a fixed-bed reactor
  25. Green synthesis of manganese-doped superparamagnetic iron oxide nanoparticles for the effective removal of Pb(ii) from aqueous solutions
  26. Desalination technology for energy-efficient and low-cost water production: A bibliometric analysis
  27. Biological fabrication of zinc oxide nanoparticles from Nepeta cataria potentially produces apoptosis through inhibition of proliferative markers in ovarian cancer
  28. Effect of stabilizers on Mn ZnSe quantum dots synthesized by using green method
  29. Calcium oxide addition and ultrasonic pretreatment-assisted hydrothermal carbonization of granatum for adsorption of lead
  30. Fe3O4@SiO2 nanoflakes synthesized using biogenic silica from Salacca zalacca leaf ash and the mechanistic insight into adsorption and photocatalytic wet peroxidation of dye
  31. Facile route of synthesis of silver nanoparticles templated bacterial cellulose, characterization, and its antibacterial application
  32. Synergistic in vitro anticancer actions of decorated selenium nanoparticles with fucoidan/Reishi extract against colorectal adenocarcinoma cells
  33. Preparation of the micro-size flake silver powders by using a micro-jet reactor
  34. Effect of direct coal liquefaction residue on the properties of fine blue-coke-based activated coke
  35. Integration of microwave co-torrefaction with helical lift for pellet fuel production
  36. Cytotoxicity of green-synthesized silver nanoparticles by Adansonia digitata fruit extract against HTC116 and SW480 human colon cancer cell lines
  37. Optimization of biochar preparation process and carbon sequestration effect of pruned wolfberry branches
  38. Anticancer potential of biogenic silver nanoparticles using the stem extract of Commiphora gileadensis against human colon cancer cells
  39. Fabrication and characterization of lysine hydrochloride Cu(ii) complexes and their potential for bombing bacterial resistance
  40. First report of biocellulose production by an indigenous yeast, Pichia kudriavzevii USM-YBP2
  41. Biosynthesis and characterization of silver nanoparticles prepared using seeds of Sisymbrium irio and evaluation of their antifungal and cytotoxic activities
  42. Synthesis, characterization, and photocatalysis of a rare-earth cerium/silver/zinc oxide inorganic nanocomposite
  43. Developing a plastic cycle toward circular economy practice
  44. Fabrication of CsPb1−xMnxBr3−2xCl2x (x = 0–0.5) quantum dots for near UV photodetector application
  45. Anti-colon cancer activities of green-synthesized Moringa oleifera–AgNPs against human colon cancer cells
  46. Phosphorus removal from aqueous solution by adsorption using wetland-based biochar: Batch experiment
  47. A low-cost and eco-friendly fabrication of an MCDI-utilized PVA/SSA/GA cation exchange membrane
  48. Synthesis, microstructure, and phase transition characteristics of Gd/Nd-doped nano VO2 powders
  49. Biomediated synthesis of ZnO quantum dots decorated attapulgite nanocomposites for improved antibacterial properties
  50. Preparation of metal–organic frameworks by microwave-assisted ball milling for the removal of CR from wastewater
  51. A green approach in the biological base oil process
  52. A cost-effective and eco-friendly biosorption technology for complete removal of nickel ions from an aqueous solution: Optimization of process variables
  53. Protective role of Spirulina platensis liquid extract against salinity stress effects on Triticum aestivum L.
  54. Comprehensive physical and chemical characterization highlights the uniqueness of enzymatic gelatin in terms of surface properties
  55. Effectiveness of different accelerated green synthesis methods in zinc oxide nanoparticles using red pepper extract: Synthesis and characterization
  56. Blueprinting morpho-anatomical episodes via green silver nanoparticles foliation
  57. A numerical study on the effects of bowl and nozzle geometry on performances of an engine fueled with diesel or bio-diesel fuels
  58. Liquid-phase hydrogenation of carbon tetrachloride catalyzed by three-dimensional graphene-supported palladium catalyst
  59. The catalytic performance of acid-modified Hβ molecular sieves for environmentally friendly acylation of 2-methylnaphthalene
  60. A study of the precipitation of cerium oxide synthesized from rare earth sources used as the catalyst for biodiesel production
  61. Larvicidal potential of Cipadessa baccifera leaf extract-synthesized zinc nanoparticles against three major mosquito vectors
  62. Fabrication of green nanoinsecticides from agri-waste of corn silk and its larvicidal and antibiofilm properties
  63. Palladium-mediated base-free and solvent-free synthesis of aromatic azo compounds from anilines catalyzed by copper acetate
  64. Study on the functionalization of activated carbon and the effect of binder toward capacitive deionization application
  65. Co-chlorination of low-density polyethylene in paraffin: An intensified green process alternative to conventional solvent-based chlorination
  66. Antioxidant and photocatalytic properties of zinc oxide nanoparticles phyto-fabricated using the aqueous leaf extract of Sida acuta
  67. Recovery of cobalt from spent lithium-ion battery cathode materials by using choline chloride-based deep eutectic solvent
  68. Synthesis of insoluble sulfur and development of green technology based on Aspen Plus simulation
  69. Photodegradation of methyl orange under solar irradiation on Fe-doped ZnO nanoparticles synthesized using wild olive leaf extract
  70. A facile and universal method to purify silica from natural sand
  71. Green synthesis of silver nanoparticles using Atalantia monophylla: A potential eco-friendly agent for controlling blood-sucking vectors
  72. Endophytic bacterial strain, Brevibacillus brevis-mediated green synthesis of copper oxide nanoparticles, characterization, antifungal, in vitro cytotoxicity, and larvicidal activity
  73. Off-gas detection and treatment for green air-plasma process
  74. Ultrasonic-assisted food grade nanoemulsion preparation from clove bud essential oil and evaluation of its antioxidant and antibacterial activity
  75. Construction of mercury ion fluorescence system in water samples and art materials and fluorescence detection method for rhodamine B derivatives
  76. Hydroxyapatite/TPU/PLA nanocomposites: Morphological, dynamic-mechanical, and thermal study
  77. Potential of anaerobic co-digestion of acidic fruit processing waste and waste-activated sludge for biogas production
  78. Synthesis and characterization of ZnO–TiO2–chitosan–escin metallic nanocomposites: Evaluation of their antimicrobial and anticancer activities
  79. Nitrogen removal characteristics of wet–dry alternative constructed wetlands
  80. Structural properties and reactivity variations of wheat straw char catalysts in volatile reforming
  81. Microfluidic plasma: Novel process intensification strategy
  82. Antibacterial and photocatalytic activity of visible-light-induced synthesized gold nanoparticles by using Lantana camara flower extract
  83. Antimicrobial edible materials via nano-modifications for food safety applications
  84. Biosynthesis of nano-curcumin/nano-selenium composite and their potentialities as bactericides against fish-borne pathogens
  85. Exploring the effect of silver nanoparticles on gene expression in colon cancer cell line HCT116
  86. Chemical synthesis, characterization, and dose optimization of chitosan-based nanoparticles of clodinofop propargyl and fenoxaprop-p-ethyl for management of Phalaris minor (little seed canary grass): First report
  87. Double [3 + 2] cycloadditions for diastereoselective synthesis of spirooxindole pyrrolizidines
  88. Green synthesis of silver nanoparticles and their antibacterial activities
  89. Review Articles
  90. A comprehensive review on green synthesis of titanium dioxide nanoparticles and their diverse biomedical applications
  91. Applications of polyaniline-impregnated silica gel-based nanocomposites in wastewater treatment as an efficient adsorbent of some important organic dyes
  92. Green synthesis of nano-propolis and nanoparticles (Se and Ag) from ethanolic extract of propolis, their biochemical characterization: A review
  93. Advances in novel activation methods to perform green organic synthesis using recyclable heteropolyacid catalysis
  94. Limitations of nanomaterials insights in green chemistry sustainable route: Review on novel applications
  95. Special Issue: Use of magnetic resonance in profiling bioactive metabolites and its applications (Guest Editors: Plalanoivel Velmurugan et al.)
  96. Stomach-affecting intestinal parasites as a precursor model of Pheretima posthuma treated with anthelmintic drug from Dodonaea viscosa Linn.
  97. Anti-asthmatic activity of Saudi herbal composites from plants Bacopa monnieri and Euphorbia hirta on Guinea pigs
  98. Embedding green synthesized zinc oxide nanoparticles in cotton fabrics and assessment of their antibacterial wound healing and cytotoxic properties: An eco-friendly approach
  99. Synthetic pathway of 2-fluoro-N,N-diphenylbenzamide with opto-electrical properties: NMR, FT-IR, UV-Vis spectroscopic, and DFT computational studies of the first-order nonlinear optical organic single crystal
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 19.12.2025 from https://www.degruyterbrill.com/document/doi/10.1515/gps-2022-0031/html
Scroll to top button