Antioxidant and cytotoxic activity of three Turkish marine-derived fungi

General

1,1-Diphenyl-2-picryl-hydrazyl (DPPH), 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS), (±)-6-hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox), ascorbic acid, quercetin, 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-terazoliumbromide (MTT), sulfanilamide, naphthyl ethylenediamine dihydrochloride, and sea salts, RPMI, medium, fetal bovine serum (FBS), streptomycin, and glutamine were purchased from Sigma Aldrich. Sabouraud 4% dextrose agar, Mueller Hinton broth, Sabouraud dextrose broth, and ethyl acetate were purchased from Merck were from PAA. Nutrient agar was from Oxoid. The Biospeedy^® Fungal Diversity Kit was obtained from Bioeksen (Turkey) and the Bio-Rad CFX Connect detection system was from Bio-Rad Laboratories (USA). The ABI Prism 377 DNA Sequencer (Applied Biosystems) and Spectra MAX 190 Microplate Reader (Molecular Devices) were also used.

Marine sample collection and fungi isolation

Marine samples were collected from the Turkish Marmara and Seferihisar coasts by scuba diving and were transferred in sea water. The isolation process was carried out within the few hours. The samples were cut to approximately 1×1 cm and rinsed three times with sterile water to eliminate adherent surface debris; for surface sterilization, they were immersed in 70% EtOH (vol/vol) for 60–120 s. Samples were transferred to Sabouraud 4% dextrose agar and artificial sea salt petri dishes. The fungi species were kept for 5–7 days in natural light at 25°C [13]. Sample information is provided in Table 1.

Fungi identification

Fungi strains were identified by DNA isolation using a fungal DNA isolation kit. The PCR-based Biospeedy^® Fungal Diversity Kit was used to determine fungal diversity after spectrophotometric quality checks of the obtained DNA. The kit contains the forward primer (TCCTCCGCTTATTGATATGC) and reverse primer (GGAAGTAAAAGTCGTAACAAGG) pair and optimized qPCR (real-time PCR) chemistry specific to the ITS1-5.8S-ITS2 region in the fungal genomic DNA. All reactions were performed using Bio-Rad CFX Connect qPCR. The device was subjected to an optimized thermocycler program specific to the primer pair and melting curve analysis between 65°C and 95°C to determine that only the desired product was amplified during qPCR. The qPCR results were analyzed with Bio-Rad CFX Connect Software 3.0.

Sequences of the fungi amplicons were identified by the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit using ABI Prism 377 DNA Sequencer. The sequence obtained for each fungal sample was analyzed with the Chromas software package, version 1.45 (http://www.technelysium.com/au/chromas.html).

The sequences were compared with NCBI DNA database ITS regions identified from known fungal species and paired with the most similar species (BLAST: http://blast.ncbi.nlm.nih.gov/Blast.cgi). In this step, sequences with similarity of ≥98% were considered to belong to the same species [14].

Fungi extraction

Identified fungi were cultured on rice and artificial sea salt medium in Erlenmeyer flasks and were kept for 30 days in natural light at 25°C. After 30 days the grown fungi were subjected to extraction by ethyl acetate. The extracts were evaporated under vacuum and kept at 4°C until used [13].

Cell culture

HCT-116 colon cancer cells were grown in RPMI-1640 medium added with 10% fetal bovine serum, 2 mM L-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin and were incubated at 37°C in 5% CO₂. When cells were 80% confluent, they were passaged by trypsinization.

Cell viability assay

To test the cytotoxic activities of fungi extracts against HCT-116 colon cancer cells, the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test was performed [15]. HCT-116 cells (2×10⁴) were seeded in 96-well plates. After overnight incubation, cells were incubated with different concentrations of fungal extracts (1–60 μg/mL) for 72 h. Stock solutions of fungi extracts were prepared in DMSO. Final DMSO concentration did not exceed 0.5%. Equal amounts of DMSO were added to the control group. Camptothecin was used as a positive control. MTT solution (5 mg/mL) was prepared in PBS and cells were incubated with MTT solution for 4 h. Insoluble formazan crystals were dissolved by adding acidified SDS solution. Absorbance measurement at 550 nm was performed with a microplate reader (Thermo Scientific). IC₅₀ values were calculated using GraphPad Prism 7.0 software (GraphPad Software, USA).

DPPH antioxidant activity determination

Different concentrations of EtOAc extracts were added in an equal volume to methanolic DPPH solution (0.1 mM). The mixture was remained at room temperature. The absorbance of the mixture was recorded at 517 nm after 30 min. Ascorbic acid and quercetin were used as standards [16].

ABTS antioxidant activity determination

According to Huang et al. (2010), ABTS⁺ stock solution (7.4 mM ABTS in 2.6 mM potassium persulfate solution) was prepared and was allowed to react for 12–16 h at room temperature in the dark. ABTS⁺ solution absorbance must be around 0.7±0.02 units at 734 nm. In a final volume of 300 μL, the reaction mixture comprising 275 μL of ABTS⁺ solution was added to 25 μL of the crude extract at various concentrations. Absorbances of mixtures were measured at 734 nm in microplate reader. The calibration curve was calculated by the same methods to Trolox as standard antioxidant compound [17].

Superoxide radical scavenging activity by alkaline DMSO method (SO)

Superoxide radical scavenging activities of the extracts were determined by alkaline DMSO method. Briefly, nonenzymatic system was used for obtain the superoxide radical. To 1 mL of alkaline DMSO (5 mM NaOH in 0.1 mL of water) were added 10 μL of NBT (1 mg/mL) and 30 μL of different concentrations of extracts or standard compounds. To get final volume 140 μL DMSO added to mixture. The absorbance was measured at 560 nm using a microplate reader [18].

Nitric oxide radical scavenging activity (NO)

Briefly, 60 μL of serial diluted extract was added to 60 μL of sodium nitroprusside (10 mM phosphate buffered saline) and incubated 150 min under at 25°C. Griess reagent (1% sulfanilamide, 0.1% naphthyl ethylenediamine dihydrochloride, 2.5% H₃PO₄) was added to each test tube an equal volume. The mixture was kept at room temperature for 10 min and absorbance at 577 nm was measured using a microplate reader [19].

Radical scavenging activity was calculated by the following formula for all antioxidant assay:

Inhibition% = [(Absorbance control–Absorbance sample)                           /Absorbance control] × 100

For IC₅₀ values, GraphPad Prism software were used. All tests were performed in triplicate and standard deviation of all values were calculated.