Home Life Sciences Activating transcription factor 3 is downregulated in hepatocellular carcinoma and functions as a tumor suppressor by regulating cyclin D1
Article Open Access

Activating transcription factor 3 is downregulated in hepatocellular carcinoma and functions as a tumor suppressor by regulating cyclin D1

  • Zheng-xia Wang , Si-neng Yin EMAIL logo , Gang Tian and Xian-lin Chen
Published/Copyright: November 25, 2016

Abstract

Objectives

To investigate the expression as well as biological roles of activating transcription factor 3 (ATF3) in human hepatocellular carcinoma (HCC) cells.

Methods

Real time PCR and western blot were applied to detect the expression of ATF3 in human HCC specimens. MTT assay was used to analyze cell proliferation after ATF3 was overexpressed. The expression of cyclin D1 was detected by real time PCR in ATF3-silenced/-overexpressed cells and HCC samples. Correlation coefficient was finally analyzed between ATF3 and cyclin D1 in the HCC samples.

Results

The expression of ATF3 was found to be downregulated in tested HCC specimens. Cellular MTT assays showed that cell proliferation was suppressed in ATF3-overexpressing HepG2 cells. In addition, cyclin D1 gene expression exhibited negative correlation with ATF3 in both cell lines and tissue samples.

Conclusion

Low expression of ATF3 may function as a tumor suppressor via inhibiting cyclin D1 in HCC.

1 Introduction

The activating transcription factor 3 (ATF3), as a member of the ATF/CREB subfamily, is a stress-inducible gene, whose expression is rapidly induced by a wide range of cellular stresses including DNA damage, cellular injury and oxidative stress [1, 2]. It belongs to a basic leucine-zipper transcription factor, sharing the basic leucinezipper DNA binding domain and binding to the ATF/ CRE consensus sequence TGACGTCA [3, 4]. More and more evidence has linked ATF3 to several important cellular signaling pathways, including those vital for ontogenesis, such as p53, TGF-b and Wnt/b-catenin [3, 5, 6]. In addition, numerous reports had evaluated the role of ATF3 in human cancers, but found that ATF3 might play different functions in cancer development depending on the cell type and context. Until recently, there were few studies investigating the significance of ATF3 in human hepatocellular carcinoma (HCC).

As is known, HCC is one of the most frequent cancers worldwide with high incidence in East Asia, and is responsible for approximately one million deaths every year [7]. Chronic tissue damage due to liver cirrhosis induced by HBV, HCV, alcohol intake, and so on often results in HCC [8]. HCC is associated with a poor prognosis in most patients, with the median survival of less than 6 months after diagnosis. Due to the unsatisfied therapeutic effect of current anticancer drugs on this disease, studying the molecular mechanisms that control/regulate pathogenesis and progression of HCC is crucial for the development of new therapeutic strategies.

Here we investigated the potential role of ATF3 in HCC progression, especially on its impact on cell proliferation. The results suggest that ATF3 may function through altering the cyclin D1 expression to inhibit the cell growth of HCC cells.

2 Materials and methods

2.1 Patients and tissues

Paired samples were taken from 30 HCC patients at the at the Chengdu Second People’s Hospital between 2015 and 2016. None of the patients received preoperative chemotherapy or radiation therapy. This project was approved by the Research Ethics Committee of Chengdu Second People’s Hospital. Informed consent was obtained from each patient.

2.2 Cell lines and cell culture

HepG2 cells were grown in DMEM supplemented with 10% fetal bovine serum (Life Technology) according to ATCC protocols. Cells were maintained in a humidified incubator at 37°C and 5% CO2.

2.3 RNA preparation and Quantitative Real Time PCR

Total RNA was extracted with Trizol reagents (Life technologies) as per manufacturer’s instruction. Reverse transcription was performed with reverse transcription kit (Promega). Briefly, 2 μg total RNA was used as template to synthesize the first strand of cDNA with M-MLV reverse transcriptase in a 20 μl reaction system. Real time PCR was performed with SYBR Green Mix (TAKARA) on ABI 7500 system (Life technologies). Data were normalized to GAPDH expression and primers were synthesized by Shanghai Sangon Company. The sequences of PCR primers used in this study were as follows:

GAPDH-F: ATTGCCCTCAACGACCACTT,

-R: CCCTGTTGCTGTAGCCAAATTC

ATF3-F: CTCTGCGCTGGAATCAGTCA,

-R: GGCTACCTCGGCTTTTGTGA

cyclin D1-F: ACCTGAGGAGCCCCAACAAC,

-R: GTCCGGGTCACACTTGATC.

2.4 SDS-PAGE and Western blot

Total cell lysate was extracted from cells by RIPA buffer. After boiling for 5min at 100°C, protein samples were loaded onto a 12% SDS-PAGE gel. After migration, proteins were transferred to NC membrane (Amersham Bioscience). Then the membrane was blocked in PBS containing 0.05% Tween-20 and 5% non-fat milk. After washing for three times the membrane was incubated with primary antibodies: anti-ATF3, anti-cyclin D1 and anti-Actin (Santa Cruz) at 4°C over night. After washing for three times, the blots were incubated with certain secondary antibodies (Pierce) at RT for 2 h. Finally, the protein-antibody complexes were visualized by a chemiluminescence detection system (Milipore).

2.5 Short interfering RNAs and transfections

ATF3 siRNA and control siRNA were purchased from Santa Cruz. Transfections were performed by Lipofectamin2000 as per the manufacturer’s instruction. Sequences of ATF3 siRNA were: UCCUGGGUCACUGGUGUUUdTdT.

2.6 Plasmids construction

The pcDNA3.0 plasmid was purchased from Life Technology Company. ATF3 coding region was amplified by PCR and cloned into pcDNA3.0 plasmids with specific restriction enzymes by adding an HA tag.

2.7 MTT assay

Hep2G cells were transfected with ATF3 over-expression plasmid or control plasmid at varying time: Dayl (D1), Day2 (D2), Day3 (D3) and Day4 (D4). Then, 20 μl of sterile MTT (5 mg/ml, sigma) was added and incubation for another 4 h at 37°C. Then, 150 μl of DMSO was added to each well and the contents of the plates were thoroughly mixed for 10 min. Spectrometric absorbance at a wavelength of 490 nm was measured on a microplate reader.

2.8 Statistical analysis

All calculations and statistical analyses were performed using Microsoft Excel 2007 or Graphpad Prism v5 software. Student’s t test was used to compare paired or grouped data in experiments. Linear regression was used to analyze the correlation between genes. All data are presented as average ± SD. A P values less than 0.05 was considered to be statistically significant.

3 Results

3.1 Expression of ATF3 was decreased in HCC specimens

Real time PCR was firstly used to detect the mRNA level of ATF3 in 30 pairs of human HCC specimens. The results shown in Figure 1A suggest that ATF3 mRNA was is significantly lower in cancerous HCC tissues (P < 0.05). In addition, to further explore its protein expression, we randomly selected 6 pairs HCC specimens from the above 30 pairs of samples, and total protein was extracted for western blot to analyze its expression. As shown in Figure 1B, our results confirmed its downregulation in HCC specimens.

Figure 1 mRNA and protein expression levels of ATF3 in HCC and paired normal liver tissues distant from the HCC. (A) Real time PCR assay was performed to determine ATF3 mRNA levels of HCC and paired normal liver tissues (n = 30). (B) Western blot assay was performed to determine ATF3 protein levels of HCC and paired normal liver tissues (n = 6).
Figure 1

mRNA and protein expression levels of ATF3 in HCC and paired normal liver tissues distant from the HCC. (A) Real time PCR assay was performed to determine ATF3 mRNA levels of HCC and paired normal liver tissues (n = 30). (B) Western blot assay was performed to determine ATF3 protein levels of HCC and paired normal liver tissues (n = 6).

3.2 ATF3-overexpressing inhibited cell proliferation of HepG2 cells

After verifying the lower expression of ATF3 in HCC, we then set out to determine its role in cell proliferation. HepG2 was used and ATF3 was overexpressed by plasmid transfection. After confirming the overexpression efficiency by both real time PCR and western blot (Figure 2A and 2B), MTT assay was performed to quantify the cellular growth rate of HepG2 cells for 4 days. The results showed that ATF3 overexpression in HepG2 cells could led to an obvious decrease in cell viability and slow growth rate than the vector-expressing cells (P < 0.05, Figure 2C).

Figure 2 ATF3 suppresses cell growth in hepatoma cells. (A) HepG2 cells were transfected with HA-ATF3 or control plasmids. 24 h later, total RNA was extracted and the over-expression effect was analyzed by real time PCR. (B) HepG2 cells were transfected with HA-ATF3 or control plasmids. 24 h later, total protein was extracted and the over-expression effect was analyzed by western blot. (C) After HepG2 cells were transfected with ATF3 over-expression plasmid or control plasmid, MTT assay was performed. The proliferative rate of HepG2 cells was evidently decreased according to each different time point (Day1, Day2, Day3, and Day4, respectively) compared with the control group.
Figure 2

ATF3 suppresses cell growth in hepatoma cells. (A) HepG2 cells were transfected with HA-ATF3 or control plasmids. 24 h later, total RNA was extracted and the over-expression effect was analyzed by real time PCR. (B) HepG2 cells were transfected with HA-ATF3 or control plasmids. 24 h later, total protein was extracted and the over-expression effect was analyzed by western blot. (C) After HepG2 cells were transfected with ATF3 over-expression plasmid or control plasmid, MTT assay was performed. The proliferative rate of HepG2 cells was evidently decreased according to each different time point (Day1, Day2, Day3, and Day4, respectively) compared with the control group.

3.3 ATF3 negatively regulated cyclin D1 expression

From the above results, we concluded that ATF3 inhibited cell proliferation. Next, to determine the growth-related molecule-cyclin D1 expression in ATF3-overexpressing cells, real time PCR was also performed to analyze the cyclin D1 mRNA. The results showed that cyclin D1 was reduced in ATF3-overexpressing HepG2 cells (Figure 3A, left). In addition, using ATF3-targeted siRNA, we found that cyclin D1 was elevated in ATF3-siRNA transfected cells than that of control cells (Figure 3A, right). Most importantly, we validated the upregulation of cyclin D1 in the above-mentioned 30 pairs of HCC specimens (Figure 3B) and there was a negative correlation between ATF3 and cyclinDl mRNA expression in these samples (Figure 3C, n = 30, P < 0.001).

Figure 3 ATF3 negatively regulated cyclinD1 expression. (A) HepG2 cells were transfected with HA-ATF3 or control plasmids, ATF3 siRNA or control siRNAs. 24 h or 48 h later, cells were harvested for western blot. (B) Real time PCR assay was performed to determine cyclin D1 mRNA levels of HCC and paired normal liver tissues (n = 30). (C) The correlation between the mRNA expression of ATF3 and cyclin D1 was analyzed by linear regression.
Figure 3

ATF3 negatively regulated cyclinD1 expression. (A) HepG2 cells were transfected with HA-ATF3 or control plasmids, ATF3 siRNA or control siRNAs. 24 h or 48 h later, cells were harvested for western blot. (B) Real time PCR assay was performed to determine cyclin D1 mRNA levels of HCC and paired normal liver tissues (n = 30). (C) The correlation between the mRNA expression of ATF3 and cyclin D1 was analyzed by linear regression.

4 Discussion

ATF3 exerts transcriptional repressing or activating activities in a context- and cell type-dependent manner [9, 10]. Surprisingly, recent studies have unveiled crucial but controversial roles of ATF3 in human cancers [11]. Although it was previously shown to be a metastasis promoter in a murine B16 melanoma model, other groups have found that ATF3 could suppress invasion and metastasis of lung and bladder cancers [12, 13]. Similarly, ATF3 may be oncogenic as it can be protective against apoptosis, but it was found to be induced following DNA damage in colon cancer cells and suppressed the growth of HeLa cells [14, 15].

The occurrence of HCC is as complicated as other malignant tumors. In HCC, ATF3 was found to be expressed at lower levels in HCC and lower expression was seen in patients with capsule invasion [16]. This finding indicates that ATF3 may serve as a tumor suppressor during human hepatocellular oncogenesis but direct evidence was lacking at that time. Besides, in a more recent study, Weng et al. showed that niclosamide, an antihelminthic drug for treatment of tapeworm infections approved by FDA, could induce cell apoptosis via upregulating ATF3 and they further demonstrated that ATF3 played an integral role in ER stress activated and cell apoptosis induced by niclosamide in HCC cells [17]. All these findings suggested an anti-tumor role of ATF3 in HCC. We noticed that the cell proliferation ability of HCC cells was not investigated so far. Hence, our attempt to evaluate its role in cell growth of HCC was to provide useful information to some extent.

In this study, we validated that ATF3 mRNA and protein expression was downregulated in HCC specimens. Our novel finding was to show its anti-growth activity in HCC cells, since overexpression of ATF3 caused cell proliferation arrest. The results were the same as another report in esophageal squamous cell carcinoma (ESCC), in which they also found ATF3 was decreased in ESCC and colony formation as well as tumor formation were inhibited by ATF3 overexpression [18]. We speculate that negative regulation of cyclin D1 by ATF3 is responsible for its tumor suppressor function in HCC. However, how ATF3 impacts on the expression of cyclin D1 remains to be further studied.

Taken together, our findings demonstrate that ATF3 was downregulated in HCC and functioned as a tumor suppressor to inhibit cell growth. Moreover, we suggested that these growth inhibitory effects of ATF3 might be related with cylin D1 signaling. Our data supported that targeting ATF3 pathway might be beneficial for anti-HCC therapy.

  1. Conflict of interest: Authors declare nothing to disclose.

Reference

[1] Hashimoto Y., Zhang C., Kawauchi J., Imoto I., Adachi M.T., Inazawa J., et al., An alternatively spliced isoform of transcriptional repressor ATF3 and its induction by stress stimuli, Nucleic Acids Res., 2002, 30, 2398-406.10.1093/nar/30.11.2398Search in Google Scholar

[2] Hai T., Wolfgang C.D., Marsee D.K., Allen A.E., Sivaprasad U., ATF3 and stress responses, Gene Expr., 1999,7, 321-35.Search in Google Scholar

[3] Yan L., Della Coletta L., Powell K.L., Shen J., Thames H., Aldaz C.M., et al., Activation of the canonical Wnt/²-catenin pathway in ATF3-induced mammary tumors, PLoS One, 2011, 6, e16515.10.1371/journal.pone.0016515Search in Google Scholar

[4] Yin X, Wolford CC, Chang YS, McConoughey SJ, Ramsey SA, Aderem A, et al., ATF3, an adaptive-response gene, enhances TGF{beta} signaling and cancer-initiating cell features in breast cancer cells, J. Cell Sci., 2010, 123, 3558-65.10.1242/jcs.064915Search in Google Scholar

[5] Yan C., Lu D., Hai T., Boyd D.D., Activating transcription factor 3, a stress sensor, activates p53 by blocking its ubiquitination, EMBO J., 2005, 24, 2425-35.10.1038/sj.emboj.7600712Search in Google Scholar

[6] Kang Y., Chen CR., Massagué J., A self-enabling TGFbeta response coupled to stress signaling: Smad engages stress response factor ATF3 for Id1 repression in epithelial cells, Mol. Cell., 2003, 11, 915-26.10.1016/S1097-2765(03)00109-6Search in Google Scholar

[7] Wörns M.A., Galle P.R., HCC therapies--lessons learned, Nat. Rev. Gastroenterol. Hepatol., 2014, 11, 447-52.10.1038/nrgastro.2014.10Search in Google Scholar

[8] Tejeda-Maldonado J., García-Juárez I., Aguirre-Valadez J., González-Aguirre A., Vilatobá-Chapa M., Armengol-Alonso A., et al., Diagnosis and treatment of hepatocellular carcinoma: An update, World J. Hepatol., 2015, 7, 362-76.10.4254/wjh.v7.i3.362Search in Google Scholar

[9] Allan A.L., Albanese C., Pestell R.G., LaMarre J., Activating transcription factor 3 induces DNA synthesis and expression of cyclin D1 in hepatocytes, J. Biol. Chem., 2001, 276, 27272-80.10.1074/jbc.M103196200Search in Google Scholar

[10] Hai T., Hartman M.G., The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis, Gene, 2001, 273, 1-11.10.1016/S0378-1119(01)00551-0Search in Google Scholar

[11] Yan C., Boyd D.D., ATF3 regulates the stability of p53: a link to cancer, Cell Cycle, 2006, 5, 926-9.10.4161/cc.5.9.2714Search in Google Scholar PubMed

[12] Wei S., Wang H., Lu C., Malmut S., Zhang J., Ren S., et al., The activating transcription factor 3 protein suppresses the oncogenic function of mutant p53 proteins, J. Biol. Chem., 2014, 289, 8947-59.10.1074/jbc.M113.503755Search in Google Scholar PubMed PubMed Central

[13] Yuan X., Yu L., Li J., Xie G., Rong T., Zhang L., et al., ATF3 suppresses metastasis of bladder cancer by regulating gelsolin-mediated remodeling of the actin cytoskeleton, Cancer Res., 2013, 73, 3625-37.10.1158/0008-5472.CAN-12-3879Search in Google Scholar PubMed

[14] Thompson M.R., Xu D., Williams B.R., ATF3 transcription factor and its emerging roles in immunity and cancer, J. Mol. Med. (Berl.), 2009, 87, 1053-60.10.1007/s00109-009-0520-xSearch in Google Scholar PubMed PubMed Central

[15] Fan F., Jin S., Amundson S.A., Tong T., Fan W., Zhao H., et al., ATF3 induction following DNA damage is regulated by distinct signaling pathways and over-expression of ATF3 protein suppresses cells growth, Oncogene, 21, 7488-96.10.1038/sj.onc.1205896Search in Google Scholar PubMed

[16] Xiaoyan L., Shengbing Z., Yu Z., Lin Z., Chengjie L., Jingfeng L., et al., Low expression of activating transcription factor 3 in human hepatocellular carcinoma and its clinicopathological significance, Pathol. Res. Pract., 2014, 210, 477-81.10.1016/j.prp.2014.03.013Search in Google Scholar PubMed

[17] Weng S., Zhou L., Deng Q., Wang J., Yu Y., Zhu J., et al., Niclosamide induced cell apoptosis via upregulation of ATF3 and activation of PERK in Hepatocellular carcinoma cells, BMC Gastroenterology, 2016,16,25.10.1186/s12876-016-0442-3Search in Google Scholar PubMed PubMed Central

[18] Xie J.J., Xie Y.M., Chen B., Pan F., Guo J.C., Zhao Q., et al., ATF3 functions as a novel tumor suppressor with prognostic significance in esophageal squamous cell carcinoma, Oncotarget, 2014, 5, 8569-82.10.18632/oncotarget.2322Search in Google Scholar PubMed PubMed Central

Received: 2016-8-27
Accepted: 2016-10-14
Published Online: 2016-11-25
Published in Print: 2016-1-1

© 2016 Zheng-xia Wang et al., published by De Gruyter Open

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Articles in the same Issue

  1. Regular article
  2. Purification of polyclonal IgG specific for Camelid’s antibodies and their recombinant nanobodies
  3. Regular article
  4. Antioxidative defense mechanism of the ruderal Verbascum olympicum Boiss. against copper (Cu)-induced stress
  5. Regular article
  6. Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice
  7. Regular article
  8. Expression and characterization of a cutinase (AnCUT2) from Aspergillus niger
  9. Regular article
  10. The Lytic SA Phage Demonstrate Bactericidal Activity against Mastitis Causing Staphylococcus aureus
  11. Regular article
  12. MafB, a target of microRNA-155, regulates dendritic cell maturation
  13. Regular article
  14. Plant regeneration from protoplasts of Gentiana straminea Maxim
  15. Regular article
  16. The effect of radiation of LED modules on the growth of dill (Anethum graveolens L.)
  17. Regular article
  18. ELF-EMF exposure decreases the peroxidase catalytic efficiency in vitro
  19. Regular article
  20. Cold hardening protects cereals from oxidative stress and necrotrophic fungal pathogenesis
  21. Regular article
  22. MC1R gene variants involvement in human OCA phenotype
  23. Regular article
  24. Chondrogenic potential of canine articular cartilage derived cells (cACCs)
  25. Regular article
  26. Cloning, expression, purification and characterization of Leishmania tropica PDI-2 protein
  27. Regular article
  28. High potential of sub-Mediterranean dry grasslands for sheep epizoochory
  29. Regular article
  30. Identification of drought, cadmium and root-lesion nematode infection stress-responsive transcription factors in ramie
  31. Regular article
  32. Herbal supplement formula of Elephantopus scaber and Sauropus androgynus promotes IL-2 cytokine production of CD4+T cells in pregnant mice with typhoid fever
  33. Regular article
  34. Caffeine effects on AdoR mRNA expression in Drosophila melanogaster
  35. Regular article
  36. Effects of MgCl2 supplementation on blood parameters and kidney injury of rats exposed to CCl4
  37. Regular article
  38. Effective onion leaf fleck management and variability of storage pathogens
  39. Regular article
  40. Improving aeration for efficient oxygenation in sea bass sea cages. Blood, brain and gill histology
  41. Regular article
  42. Biogenic amines and hygienic quality of lucerne silage
  43. Regular article
  44. Isolation and characterization of lytic phages TSE1-3 against Enterobacter cloacae
  45. Regular article
  46. Effects of pH on antioxidant and prooxidant properties of common medicinal herbs
  47. Regular article
  48. Relationship between cytokines and running economy in marathon runners
  49. Regular article
  50. Anti-leukemic activity of DNA methyltransferase inhibitor procaine targeted on human leukaemia cells
  51. Regular article
  52. Research Progress in Oncology. Highlighting and Exploiting the Roles of Several Strategic Proteins in Understanding Cancer Biology
  53. Regular article
  54. Ectomycorrhizal communities in a Tuber aestivum Vittad. orchard in Poland
  55. Regular article
  56. Impact of HLA-G 14 bp polymorphism and soluble HLA-G level on kidney graft outcome
  57. Regular article
  58. In-silico analysis of non-synonymous-SNPs of STEAP2: To provoke the progression of prostate cancer
  59. Regular article
  60. Presence of sequence and SNP variation in the IRF6 gene in healthy residents of Guangdong Province
  61. Regular article
  62. Environmental and economic aspects of Triticum aestivum L. and Avena sativa growing
  63. Regular article
  64. A molecular survey of Echinococcus granulosus sensu lato in central-eastern Europe
  65. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  66. Molecular genetics related to non-Hodgkin lymphoma
  67. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  68. Roles of long noncoding RNAs in Hepatocellular Carcinoma
  69. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  70. Advancement of Wnt signal pathway and the target of breast cancer
  71. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  72. A tumor suppressive role of lncRNA GAS5 in human colorectal cancer
  73. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  74. The role of E-cadherin - 160C/A polymorphism in breast cancer
  75. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  76. The proceedings of brain metastases from lung cancer
  77. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  78. Newly-presented potential targeted drugs in the treatment of renal cell cancer
  79. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  80. Decreased expression of miR-132 in CRC tissues and its inhibitory function on tumor progression
  81. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  82. The unusual yin-yang fashion of RIZ1/RIZ2 contributes to the progression of esophageal squamous cell carcinoma
  83. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  84. Human papillomavirus infection mechanism and vaccine of vulva carcinoma
  85. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  86. Abnormal expressed long non-coding RNA IRAIN inhibits tumor progression in human renal cell carcinoma cells
  87. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  88. UCA1, a long noncoding RNA, promotes the proliferation of CRC cells via p53/p21 signaling
  89. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  90. Forkhead box 1 expression is upregulatedin non-small cell lung cancer and correlateswith pathological parameters
  91. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  92. The development of potential targets in the treatment of non-small cell lung cancer
  93. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  94. Low expression of miR-192 in NSCLC and its tumor suppressor functions in metastasis via targeting ZEB2
  95. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  96. Downregulation of long non-coding RNA MALAT1 induces tumor progression of human breast cancer through regulating CCND1 expression
  97. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  98. Post-translational modifications of EMT transcriptional factors in cancer metastasis
  99. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  100. EZH2 Expression and its Correlation with Clinicopathological Features in Patients with Colorectal Carcinoma
  101. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  102. The association between EGFR expression and clinical pathology characteristics in gastric cancer
  103. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  104. The peiminine stimulating autophagy in human colorectal carcinoma cells via AMPK pathway by SQSTM1
  105. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  106. Activating transcription factor 3 is downregulated in hepatocellular carcinoma and functions as a tumor suppressor by regulating cyclin D1
  107. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  108. Progress toward resistance mechanism to epidermal growth factor receptor tyrosine kinase inhibitor
  109. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  110. Effect of miRNAs in lung cancer suppression and oncogenesis
  111. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  112. Role and inhibition of Src signaling in the progression of liver cancer
  113. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  114. The antitumor effects of mitochondria-targeted 6-(nicotinamide) methyl coumarin
  115. Special Issue on CleanWAS 2015
  116. Characterization of particle shape, zeta potential, loading efficiency and outdoor stability for chitosan-ricinoleic acid loaded with rotenone
  117. Special Issue on CleanWAS 2015
  118. Genetic diversity and population structure of ginseng in China based on RAPD analysis
  119. Special Issue on CleanWAS 2015
  120. Optimizing the extraction of antibacterial compounds from pineapple leaf fiber
  121. Special Issue on CleanWAS 2015
  122. Identification of residual non-biodegradable organic compounds in wastewater effluent after two-stage biochemical treatment
  123. Special Issue on CleanWAS 2015
  124. Remediation of deltamethrin contaminated cotton fields: residual and adsorption assessment
  125. Special Issue on CleanWAS 2015
  126. A best-fit probability distribution for the estimation of rainfall in northern regions of Pakistan
  127. Special Issue on CleanWAS 2015
  128. Artificial Plant Root System Growth for Distributed Optimization: Models and Emergent Behaviors
  129. Special Issue on CleanWAS 2015
  130. The complete mitochondrial genomes of two weevils, Eucryptorrhynchus chinensis and E. brandti: conserved genome arrangement in Curculionidae and deficiency of tRNA-Ile gene
  131. Special Issue on CleanWAS 2015
  132. Characteristics and coordination of source-sink relationships in super hybrid rice
  133. Special Issue on CleanWAS 2015
  134. Construction of a Genetic Linkage Map and QTL Analysis of Fruit-related Traits in an F1 Red Fuji x Hongrou Apple Hybrid
  135. Special Issue on CleanWAS 2015
  136. Effects of the Traditional Chinese Medicine Dilong on Airway Remodeling in Rats with OVA-induced-Asthma
  137. Special Issue on CleanWAS 2015
  138. The effect of sewage sludge application on the growth and absorption rates of Pb and As in water spinach
  139. Special Issue on CleanWAS 2015
  140. Effectiveness of mesenchymal stems cells cultured by hanging drop vs. conventional culturing on the repair of hypoxic-ischemic-damaged mouse brains, measured by stemness gene expression
Downloaded on 24.2.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2016-0048/html
Scroll to top button