Article Open Access

Chondrogenic potential of canine articular cartilage derived cells (cACCs)

  • , , and EMAIL logo
Published/Copyright: August 27, 2016

Abstract

In the present paper, the potential of canine articular cartilage-derived cells (cACCs) for chondrogenic differentiation was evaluated. The effectiveness of cACCs’ lineage commitment was analyzed after 14 days of culture in chondorgenic and non-chondrogenic conditions. Formation of proteoglycan-rich extracellular matrix was assessed using histochemical staining – Alcian Blue and Safranin-O, while elemental composition was determined by means of SEM-EDX. Additionally, ultrastructure of cACCs was evaluated using TEM. The expression of genes involved in chondrogenesis was monitored with quantitative Real Time PCR. Results obtained indicate that the potential of cACCs for cartilagous extracellular matrix formation may be maintained only in chondrogenic cultures. The formation of specific chondro-nodules was not observed in a non-chondrogenic culture environment. The analysis of cACCs’ ultrastructure, both in non-chondrogenic and chondrogenic cultures, revealed well-developed rough endoplasmatic reticulum and presence of mitochondria. The cACCs in chondrogenic medium shed an increased number of microvesicles. Furthermore, it was shown that the extracellular matrix of cACCs in chondrogenic cultures is rich in potassium and molybdenum. Additionally, it was determined that gene expression of collagen type II, aggrecan and SOX-9 was significantly increased during chondrogenic differentiation of cACCs. Results obtained indicate that the culture environment may significantly influence the cartilage phenotype of cACCs during long term culture.

1 Introduction

Osteochondral defects are a serious clinical problem both in human as well as in veterinary medicine. The avascular nature of articular cartilage and its limited capacity for spontaneous regeneration are the reasons why cartilage injuries have poor prognosis for repair [1].

Currently, cell-based therapies provide real promise for the treatment of musculoskeletal diseases involving osteochondrotic articular cartilage defects [2]. Due to the fact that articular cartilage lesions in dogs are very common, the treatment of these is a great challenge for orthopaedics. The naturally-occurring pathology of articular cartilage in dogs means that these animals represent a clinically important group, and the canine model is often used in translational research. Current studies in canine cartilage regenerative medicine are focusing on the application of multipotent stromal cells for treatment of defects, however the clinical application of chondrocytes in autologous transplantation (ACT) is also noted [14].

Nevertheless, a small percentage of the transplanted chondrocytes have sufficient ability to produce components of the extracellular matrix. Therefore, in considering autologous transplantation of chondrocytes, studies regarding optimal methods for the in vitro expansion of chondrocytes are essential, due to the fact that chondrocyte culture is an integral part of the ACT procedure [3].

The extracellular matrix (ECM) of functional articular cartilage is rich in proteoglycans and type II collagen (COL2A), constituting respectively 40% and 60% of the dry weight of cartilage. The main proteoglycan in cartilage tissue is aggrecan (ACAN). Both collagen type II network and proteoglycan aggregated complexes play a crucial function in protecting cartilage from mechanical deformation. Articular cartilage also contains small cellular proteoglycans, one of which is decorin (DCN), which responds in fibrillogenesis and interfibril interactions [5,6]. In the regulation of proteoglycan metabolism a number of growth factors are involved, especially those belonging to the transforming growth factor-β (TGF-β) superfamily [6]. The most important unique group of proteins within the TGF-β superfamily are bone morphogenetic proteins, including isoform 7 (BMP7), also known as a osteogenic protein-1 (OP-1). The BMP7 proteins play a crucial role in cartilage development, homeostasis and repair [7,8]. This is achieved by BMP7- depended up-regulation of chondrocyte metabolism and cartilage-specific extracellular proteins synthesis. It has been shown that BMP7 influences the synthesis of collagen type II, aggrecan and decorin [9]. Chondrocytes participating in ECM synthesis constitute only 2% of the total volume of articular cartilage [6,10,11]. The chondrogenic phenotype is characterized by an increased expression level of specific genes, coding expression of collagen type II, aggrecan and also SOX-9 [12]. During longterm, monolayer in vitro culture, chondrocytes undergo de-differentiation which is manifested by changes in cell morphology and alteration of the collagen expression phenotype. As a consequence of de-differentiation, in vitro cultures of chondrocytes are characterized by the presence of fibroblastic-like cells expressing collagen type I (COL1A) instead of collagen type II [13,14] and these features are typical for fibrotic tissues. Additionally, the chondrocytes are cells of mesenchymal origin, therefore the expression of vimentin is noted. Vimentin (VIM) belongs to the intermediate filaments that are responsible for maintaining the mechanical integrity of mesenchymal cells and tissue, also assisting in intracellular mRNA transport [15].

There are several ways to prevent the process of de-differentiation, one of which is to culture cells on specific chondrogenic medium [14,16].

The aim of this study was to evaluate the chondrogenic differentiation potential of canine articular cartilage derived cells (cACCs) during in vitro culture. In order to determine the influence of the culture environment on cells’ morphology, ultrastructure and gene expression profile, the cACCs were maintained in chondrogenic and non-chondrogenic conditions. Cultures of cACCs were evaluated using histochemical staining, scanning electron microscopy with an energy dispersive X-ray analytical system (SEM-EDX), transmission electron microscopy (TEM), while changes in cartilage specific genes were monitored using quantitative Real Time PCR.

2 Methods

All reagents used in this experiment were purchased from Sigma-Aldrich (Poland), unless indicated otherwise.

All experimental procedures were approved by the II Local Ethics Committee of Environmental and Life Science University (Dec. No. 177/2010 of 11.15.2010).

2.1 Tissue sampling

The cartilage was harvested in an aseptic manner, with owner consent, from dogs euthanized for reasons unrelated to this study. The dogs were skeletally mature, male and aged 4 years old. Samples were placed in Hank’s Balanced Salt Solution (HBSS) with addition of 1% antibiotic/antimycotic solution.

2.2 The isolation and propagation of canine articular cartilage derived cells (cACCs)

After surgical harvesting, cartilage was cut into small fragments and washed extensively in HBSS. Biopsies were pre-digested using 0.1% of hyaluronidase for 40 minutes at 37C. Subsequently, tissue fragments were washed with HBSS and digested using 0.2% collagenase type I for 6 hours at 37C. The cells were pelleted at 1200 × g for 10 minutes and re-suspended in Dulbecco’s modified Eagle’s medium (DMEM) with Nutrient F-12 Ham. Cells were maintained in a humidified incubator with 5% CO2 at 37C. Subsequent cultures, after first passage, were propagated in DMEM. Media were supplemented with 10% of fetal bovine serum (FBS) and 1% antibiotic/antimycotic solution. The culture medium was changed every two days. Cultures at 70% of confluency were detached from culture dishes using TrypLE Express solution (Life Technologies).

2.3 The isolation and propagation of canine articular cartilage derived cells (cACCs)

Morphology of primary cACC cultures and cultures at P1 were evaluated using the inverted microscope (Axio Observer A1). The 50 × and 100 × magnifications were used.

2.4 The chondrogenic cultures of cACCs

The cACC cultures, established at passage three (P3) were inoculated into 24-well plates. Chondrogenic differentiation (CH) of cACCs was induced using the commercial kit - StemPro® Mesenchymal Chondrogenic Medium (Life Technologies). In order to determine the effectiveness of chondrogenic stimulation, cultures were also maintained in non-chondrogenic conditions (NonCH; DMEM, 10% FBS and 1% antibiotic/antymycotic solution). Culture media were changed every two days. Evaluation of matrix assembly was performed after 14 day of the culture. The experiment was conducted in twelve independent repetitions.

2.5 Proliferation of cACCs in chondrogenic and non-chondrogenic cultures

Cells were cultured in 24-well plates at a concentration equal to 3 × 104 per 0.5 mL of proper growth medium. Cell proliferation was evaluated after 48, 96, 148, 172, 220 and 244 hours using a metabolic assay - Alamar Blue (resazurin – resorufin system). To perform the assay, culture media were removed and replaced with medium containing 10% dye. Cells were incubated with the dye for 2 hours in a CO2 incubator. Following incubation, supernatants were transferred into a 96-well microplate. The absorbance of the supernatants was measured by spectrophotometry (BMG Labtech, Germany) at a wavelength of 600 nm for resazurin and 690 nm as a reference wavelength. All measurements were verified according to spectrophotometric measurement of blank samples (complete growth medium with dye and without cells). Cell number was counted in a hemocytometer after trypan blue staining. For the assay, cells were trypsinized and re-suspended in equal volumes of medium and trypan blue (0.02% solution). Each assay was repeated three times.

2.6 The effectiveness of cACCs chondrogenic stimulation

2.6.1 Specific staining of chondrogenic matrix

Alcian blue staining included the following steps: (i) rinsing of cells using HBSS, (ii) fixation of cells in 10% formalin for 1 h, (iii) aspirating the formalin and washing twice with distilled water, (iv) staining the of the cACC cultures with Alcian Staining Solution (5 mg Alcian Blue in 50 mL ethyl acetate) overnight at room temperature in the dark, (v) washing twice with 25 mL ethyl acetate for 20 min at room temperature, (vi) rinsing with distilled water. Final washing was performed using HBSS. Stained cultures were examined under a light microscope. Images were taken using a Canon PowerShot Camera.

For Safranin-O staining cultures were: (i) washed three times with HBSS, (ii) rinsed with 1% acetic acid solution for 10 sec, (iii) stained with 0.1% Safranin-O solution for 5 min, (iv) washed using HBSS and (v) examined under light microscope. Images were taken using Canon PowerShot Camera.

2.6.2 Analysis of chondrogenic nodules formation and extracellular matrix elemental composition (SEM/ SEM-EDX)

The morphology of cACCs in culture was assessed using a scanning electron microscope (SEM, Zeiss Evo LS 15), inverted microscope and epifluorescent microscope (EpiFM); (Zeiss, Axio Observer A.1). The cultures analyzed under epiFM were prepared as previously described [17,18]. Briefly, the samples were (i) washed three times using HBSS, (ii) fixed with 4% paraformaldehyde for 45 min at room temperature, (iii) rinsed again as described above, (iv) permeabilized for 15 min using Triton X-100 at room temperature, (v) washed again, (vi) stained with atto- 488-labeled phalloidin (1 : 800) for 40 min in the dark at room temperature, (vii) counterstained with diamidino-2- phenylindole (DAPI; 1:1000) for 5 min in the dark at room temperature. Observations were performed under inverted and epifluorescent microscope at magnification 100 × and 50 ×, respectively. For SEM observations, cultures were prepared as described previously [17,19]. Briefly, the procedure included (i) fixation in 2.5% glutaraldehyde in DMEM; (ii) washing using HBSS; (iii) dehydrated in a graded ethanol series (50% - 100%); (iv) air-drying for 30 min at room temperature and (v) coating with gold using 300-second program (Edwards, Scancoat six). Cultures of cACCs were imaged with SE1 detector at 10 kV filament tension (SEM, Zeiss Evo LS 15) under 1000 ×, 3000 × and 20 000 × magnification.

2.6.3 Ultrastucture of chondrogenic and nonchondrogenic cACC cultures

The ultrastructure of cACC cultures was assessed using a scanning transmission electron microscope (TEM, Zeiss Evo LS 15). The cACC cultures for TEM analysis were prepared accordingly to the procedure described previously [17]. The preparations were: (i) fixed in 2.5% glutaraldehyde in DMEM overnight at 4C, (ii) centrifuged at 2000 × g for 10 min, (iii) rinsed with 0,1 M PBS (pH = 7,0) for 30 min at room temperature, (iv) centrifuged as described above, (v) incubated with 1% osmium tetroxide in PBS for 2 hours, (vi) washed using 0.1 M PBS and centrifuged again, (vii) dehydrated in a graded acetone series (30 - 100%) and (viii) embedded using Agar Low Viscosity Resin Kit (Agar Scientific Ltd., Stansted). Finally, the ultrathin sections (80 nm) of the specimens were collected on copper grids, contrasted with uranyl acetate (30 min incubation) and lead citrate (15 min incubation). Images of cACCs were captured using TEM detector, at 10 kV filament tension.

2.6.4 Analysis of gene expression in chondrogenic cACC cultures - RT-qPCR

Total RNA was isolated from cACCs using phenolguanidine isothiocyanate reagent (TriReagent®). All reagents used for total RNA extraction were of molecular biology grade.

The RNA extraction was performed according to the manufacturer’s instructions. Purity of total RNA samples was measured in a spectrophotometer (VPA Biowave II). The material obtained was characterized by a A260/ A280 ratio of between 1.8-2.0. For reverse transcription reaction, 500 ng of total RNA was used. The reaction was performed using a Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) and oligo(dT)15 primers (Verte KIT oligo(dT)15, Novazym). Synthesis of cDNA was completed according to the manufacturer’s protocol using T100 Thermo Cycler (Bio-Rad). The sequences of specific oligonucleotides, with characteristics, are presented in Table 1. The qRT-PCR mixtures were prepared using SensiFast SYBR & Fluorescein Kit (Bioline). The total reaction volume was 20 μL. The concentration of primers in each reaction was 0.5 μM. The thermal profile of qRT-PCR included the following steps: (i) 95C for 2 min; (ii) 95C denaturation for 30 s, annealing temperature gradient for 30 s, 72C measurement of single fluorescence for 30 s. Each cycle was repeated 45 times. A dissociation curve of amplicons was used to validate the specificity of the PCR products. Analysis of the melting curve was performed after each amplification at 65C - 95C with a heating rate of 0.2C/s and continuous fluorescence measurement. The matrices investigated were derived from three cultures that were propagated simultaneously. All samples were amplified in three repetitions. The values of the threshold cycle (Ct) acquired in each test were used to calculate the fold change in relation to the expression of housekeeping gene glyceraldehyde-3-phosphate dehydrogenase.

Table 1

Sequences of primers used in qPCR.

GenesGenBank accession numberPrimer pairsAnnealing temperature (C)Amplicon size (bp)
ACANNM_001113455.2F: GAGCCTGAAAACCAGACGGA

R: TCTCCTCTGTTGCTGTGCTG
58.1109
BMP-7NM_001197052F: GATCCTCTCTATCCTGGGCTTG

R: GGTGGTGGTAACGTGGATAGAA
58290
COL1ANM_001003090.1F: ACCGACCAAGAAACCACAGG

R: GCACGGAGATTCCTCCAGTT
58.1226
COL2ANM_001006951.1F: CAGGACGGGCAGAGGTATAATG

R: TTGATGTCTCCGGGTTCTCC
58.7233
DCNNM_001003228.1F: GGAGCCTTCCAGGGAATGAA

R: CACCGGGTACTCTGATGAGC
58.5280
GAPDHNM_001003142.2F: GATTGTCAGCAATGCCTCCT

R: GTGGAAGCAGGGATGATGTT
57.9198
SOX-9NM_001002978.1F: AGCAAGACGCTGGGCAAG

R: GGCGGGCCCTGGGATT
58.9299
TGFβ-1NM_001003309.1F: CAAGAAAAGTCCGCACAGCA

R: CTGAGGTAGCGCCAGGAATC
58.3177
VIMNM_001287023.1F: CTACGAGGAGGAGATGCGGGA

R: GCTCAAGGTCAAGACGTGCC
58.9218

3 Results

3.1 Morphology of cACCs

The cACCs in primary cultures resembled fibroblasts, predominantly of bipolar shape, however polygonal cells were also noted. The nuclei were centrally localized with round or oval shape. The presence of undigested tissue in primary cultures was noted. After first passage, cACCs appeared as single multipolar cells. After 72 hours of culture homogeneous a population of fibroblast-like cells, forming dense monolayer was observed (Fig 1).

Figure 1 The morphology of canine articular cartilage derived cells in primary cultures (PC) and at passage 1 (P1). Magnification used is 50 × and 100 ×. Scale bar is 100 μm.
Figure 1

The morphology of canine articular cartilage derived cells in primary cultures (PC) and at passage 1 (P1). Magnification used is 50 × and 100 ×. Scale bar is 100 μm.

3.2 Proliferation and metabolic activity of cACCs in vitro

The number of cells in differentiated cACC cultures slightly decreased, when compared to the control culture, however the difference was not statistically significant. In both cultures the percentage of dead cells did not exceed 12%. The metabolic activity of cACCs was evaluated using Alamar Blue test (Fig. 2). The course of growth curve of cACCs in non-chondrogenic and chondrogenic could be divided into phases typical for sub-cultured cells. The adaptation stage of cACC growth lasted 24 hours. The proliferation activity of chondrogenic cultures in this stage decreased in comparison with non-chondorgenic cultures. The exponential growth of cACCs in both culture environments was noted between 48 and 172 h of culture. Subsequently, cACCs entered into stationary phase of cell growth and after 220 h the growth rate declined, regardless of culture conditions.

Figure 2 Proliferation activity of cACCs under chondrogenic conditions (CH) in comparison to the control culture (NonCH) (a) results of trypan blue staining showing the number of dead and living cells (b) results of the Alamar Blue assay - the X-axis refers to the time of cells’ propagation. The difference between absorbance read at 600nm and 690 nm, including absorbance of blank sample, was indicated as ΔΔA mark (Y-axis). Error bars represent standard deviation from the mean value calculated from three separated measurements.
Figure 2

Proliferation activity of cACCs under chondrogenic conditions (CH) in comparison to the control culture (NonCH) (a) results of trypan blue staining showing the number of dead and living cells (b) results of the Alamar Blue assay - the X-axis refers to the time of cells’ propagation. The difference between absorbance read at 600nm and 690 nm, including absorbance of blank sample, was indicated as ΔΔA mark (Y-axis). Error bars represent standard deviation from the mean value calculated from three separated measurements.

3.3 The effectiveness of chondrogenic stimulation of cACCs

The results of the morphology evaluation are shown in Figure 3. To investigate the effectiveness of chondrogenic potential of cACCs the analysis was performed in comparison to the cACCs in non-chondrogenic culture environment. The extracellular matrix of cultures was stained with Safranin-O (3a) and Alcian Blue (3b). Results of staining showed a lack of chondrogenic nodules in non-stimulated cultures of cACCs, whereas formation of nodules rich in glycosaminoglycans was evident under chondrogenic conditions. The chondrogenic nodules were visualized under inverted microscope and epiFM (3c and 3d). The DAPI-derived fluorescence was intense within nodules formed by aggregated cells.

Figure 3 Morphology of cACCs under non-chondrogenic (NonCH) and chondrogenic (CH) conditions. For visualization of glycosaminoglycans deposits specific Safranin-O (a) and Alcian Blue (b) staining were used. Additionally, the morphology of NonCH and CH cultures of cACCs was showed using inverted microscope (c) and epifluorescent microscope – the actin filaments were stained using atto-488-labeled phalloidin, while nuclei were counterstained using DAPI (d). Magnification used is 100 × and 200 ×. Scale bar is 100 μm
Figure 3 Morphology of cACCs under non-chondrogenic (NonCH) and chondrogenic (CH) conditions. For visualization of glycosaminoglycans deposits specific Safranin-O (a) and Alcian Blue (b) staining were used. Additionally, the morphology of NonCH and CH cultures of cACCs was showed using inverted microscope (c) and epifluorescent microscope – the actin filaments were stained using atto-488-labeled phalloidin, while nuclei were counterstained using DAPI (d). Magnification used is 100 × and 200 ×. Scale bar is 100 μm
Figure 3 Morphology of cACCs under non-chondrogenic (NonCH) and chondrogenic (CH) conditions. For visualization of glycosaminoglycans deposits specific Safranin-O (a) and Alcian Blue (b) staining were used. Additionally, the morphology of NonCH and CH cultures of cACCs was showed using inverted microscope (c) and epifluorescent microscope – the actin filaments were stained using atto-488-labeled phalloidin, while nuclei were counterstained using DAPI (d). Magnification used is 100 × and 200 ×. Scale bar is 100 μm
Figure 3

Morphology of cACCs under non-chondrogenic (NonCH) and chondrogenic (CH) conditions. For visualization of glycosaminoglycans deposits specific Safranin-O (a) and Alcian Blue (b) staining were used. Additionally, the morphology of NonCH and CH cultures of cACCs was showed using inverted microscope (c) and epifluorescent microscope – the actin filaments were stained using atto-488-labeled phalloidin, while nuclei were counterstained using DAPI (d). Magnification used is 100 × and 200 ×. Scale bar is 100 μm

3.4 Analysis of extracellular matrix composition

The SEM analysis revealed differences in morphology of cACC cultures in chondrogenic conditions compared with the control cultures. The analysis confirmed observations obtained under light microscopy. The chondrogenic nodules were evident only in cultures where chondrogenesis was induced (Fig. 4). Additionally, analysis of the elemental composition of the extracellular matrix showed that chondrogenic cultures are rich in potassium (1.66% ± 0.20) and molybdenum (3.42% ± 0.58), whereas the level of carbon, oxygen and nitrogen decreased in chondrogenic cultures (Table 2).

Figure 4 SEM analysis of extracellular matrix of cACCs under non-chondrogenic and chondrogenic conditions. Images were captured at magnification 1000-, 3000-, 20 000-fold, scale bar = 20, 10, 2 μm.
Figure 4

SEM analysis of extracellular matrix of cACCs under non-chondrogenic and chondrogenic conditions. Images were captured at magnification 1000-, 3000-, 20 000-fold, scale bar = 20, 10, 2 μm.

Table 2

Analysis of the elemental composition of cells.

3.5 Analysis of ultrastucture of chondrogenic cACC cultures

The TEM analysis revealed euchromatic nuclei of cACCs cultured in non-chondrogenic conditions. The mitochondria observed in the cytoplasm had regular size and shape. Moreover, fragments of plasma membrane were formed into microvesicles (Fig. 5a). The analysis of ultrastructure of cACCs showed that cells derived from chondrogenic cultures had a number of elongated mitochondria and centrally localized, enlarge nuclei with visible nucleoli. The enhanced production and sheding of microvesicles in differentiated cACCs was visualized with TEM images (Fig. 5b).

Figure 5 Ultrastructure of cACCs in non-chondrogenic and chondrogenic condtions. Typical ultrastructural features were indicated with proper colors: violet – nucleus, blue – ER and green – microvesicles. Images were captured at magnification 18 000-fold, scale bar = 2 μm.
Figure 5

Ultrastructure of cACCs in non-chondrogenic and chondrogenic condtions. Typical ultrastructural features were indicated with proper colors: violet – nucleus, blue – ER and green – microvesicles. Images were captured at magnification 18 000-fold, scale bar = 2 μm.

3.6 Analysis of gene expression

The results of qRT PCR analysis of cACC culture showed that expression of specific markers (COL2A, SOX-9, ACAN) of chondrogenesis significantly increased in chondrogenic cultures (Fig. 6a, b). The expression of COL1A was elevated in chondrogenic cultures, however the difference noted was not statistically significant (Fig. 6a). The mRNA level of BMP-7 increased in chondrogenic stimulated cACCs (not statistically significant), while the expression of another growth factor, TGF-β, was not altered in chondrogenic cultures of cACCs (Fig. 6b). The increase of decorin transcription was also noted in chondrogenic cultures, nevertheless the observed difference was not statistically significant. Moreover, the expression of viementin mesenchymal marker was constitutive in both cultures of cACCs (Fig. 6c).

Figure 6 Expression of mRNA for a) COL2A, COL1A, b) ACAN, SOX-9, c) BMP-7, TGF-β, d) DEC, VIM in chondrogenic and non-chodrogenic cultures of cACCs. Quantification of relative values was performed using 2−ΔΔCT method, normalizing data to control culture and including expression of reference gene; error bars represent standard deviation from the mean calculated for normalized values obtained in three separate reactions; asterisks represent statistically significant differences (p < 0.05).
Figure 6 Expression of mRNA for a) COL2A, COL1A, b) ACAN, SOX-9, c) BMP-7, TGF-β, d) DEC, VIM in chondrogenic and non-chodrogenic cultures of cACCs. Quantification of relative values was performed using 2−ΔΔCT method, normalizing data to control culture and including expression of reference gene; error bars represent standard deviation from the mean calculated for normalized values obtained in three separate reactions; asterisks represent statistically significant differences (p < 0.05).
Figure 6

Expression of mRNA for a) COL2A, COL1A, b) ACAN, SOX-9, c) BMP-7, TGF-β, d) DEC, VIM in chondrogenic and non-chodrogenic cultures of cACCs. Quantification of relative values was performed using 2−ΔΔCT method, normalizing data to control culture and including expression of reference gene; error bars represent standard deviation from the mean calculated for normalized values obtained in three separate reactions; asterisks represent statistically significant differences (p < 0.05).

4 Discussion

In the recent years, much attention has been paid to the development of regenerative medicine [2, 20, 21]. The search for new cell-based methods of treatment can help in repair of cartilage injuries and osteoarthritis in dogs [22]. Articular cartilage can be used as a source of chondrocytes, used for autologous transplantation [1,2,21,22], however their potential for differentiation decreases during in vitro expansion.

In the present study, we investigated the influence of culture microenvironment on differentiation potential of canine articular cartilage derived cells. We have focused on examination of cell morphology, ultrastructure and gene expression of cACCs in long-term monolayer cultures under non-chondrogenic conditions and chondrogenicpromoting conditions. Our results revealed that cACCs may recover their chondrogenic potential in vitro, when propagated in specific differentiation medium.

The cells isolated from articular cartilage in monolayer, eventually lose their phenotype and become fibroblastic. This phenomenon is known as de-differentiation [23]. Our research confirmed that cACCs undergo de-differentiation manifested by changes in morphology and chondrogenic phenotype. The cells’ morphology was monitored in primary and subsequent cultures. In the primary cultures we noted both polygonal and round cells of chondrogenic morphotype, as well as bipolar cells resembling fibroblasts. In the subsequent cultures only fibroblast cells were noted. The same observations were made previously in cultures of human [24,25], bovine [26] and rabbit [27] chondrocytes growing in monolayer. It is worth mentioning that the proliferative activity of cACCs was not altered by chondrogenic stimulation: only in the characteristic lag phase of cell adaption was reduced cell activity noted.

The phenotypic stability of chondrocytes during in vitro cultures is a very important issue in the context of autologous transplantation. To reduce occurrence of de-differentiation of cartilage derived cells and to restore the chondrogenic potential in cACCs, it’s possible to use specific chondrogenic medium what was shown in pellet cultures [28]. Our results indicate that chondrogenic stimulation may also maintain proper differentiation potential of cACCs in monolayer cultures. The Alcian Blue and Safranin-O staining specific for cartilage matrix rich in glycosaminoglycans were positive only in chondrogenic cultures of cACCs. Cultures of cACCs under chondrogenic conditions were characterized by formation of glycosaminoglycan-rich nodules that were confirmed with Alcian blue and Safranin-O staining.

Furthermore, examination of extracellular matrix composition by SEM-EDX revealed that cACCs, maintained in chondrogenic medium, contained deposits of molybdenum and potassium. Molybdenum plays a significant role as a cofactor for enzymes involved in the reconstruction of the cartilage [29], whereas, potassium channels are crucial for chondrocyte biosynthetic activity [30].

The results of TEM analysis indeed showed that cACCs in chondrogenic cultures are metabolically active cells, releasing an increased number of microvesicles. This observation is consistent with the results of Roy [31] and Roy et al. [32].

Gene expression alterations are also evident during the de-differentiation process, especially in the context of the main chondrogenic markers. The de-differentiated chondrocytes are characterized by the replacement of collagen type II by collagen type I [33] and decreased expression of aggrecan [34]. Moreover, SOX-9, which plays crucial role by regulating the expression of collagen II-type [11,35,36], is another determinant of chondrogenesis, that decreased during chondrocyte, culture. In our experiments, cACCs cultured in chondrogenic conditions expressed a higher level of COL2A, ACAN and SOX-9 transcripts, when compared with cells derived from non-chondorgenic cultures. Burton-Wurster et al. [37] showed that synthesis and accumulation of DCN in articular cartilage is made as a response to TGFβ-1. The expression of DCN in the cACC chondrogenic cultures increased, while TGF-β transcript level was comparable both in chondrogenic and non-chondrogenic conditions. However, similarly to the increased expression of DCN we noted elevated mRNA levels for BMP7. The mesenchymal origin of cACCs was confirmed by expression of vimentin. The expression of this gene was constitutive and did not depend on culture condition [15].

In conclusion, we have shown that canine articular cartilage derived cells cultured under chondrogenic conditions maintain their characteristic phenotype and form chondrogenic nodules rich in proteoglycans. The chondrogenic stimulation of cACCs prevent these cultures from de-differenting. Propagation of cACCs in chondrogenic promoting conditions may influence the effectiveness and regeneration potential of chondrocytes in autologous transplantation.

  1. Conflict of interest: The authors declare that there is no conflict of interests regarding the publication of this paper.

Acknowledgements

Publication supported by Wroclaw Centre of Biotechnology, programme the Leading National Research Centre (KNOW) for years 2014–2018.

References

[1] Chu C.R., Szczodry M., Bruno S., Animal Models for Cartilage Regeneration and Repair, Tissue Eng. Part B Rev., 2010, 16, 105–11510.1089/ten.teb.2009.0452Search in Google Scholar PubMed PubMed Central

[2] Hardingham T., Tew S., Murdoch A., Tissue engineering: chondrocytes and cartilage, Arthritis Res., 2002, 3z 63–6810.1186/ar561Search in Google Scholar PubMed PubMed Central

[3] Brittberg M., Lindahl A., Nilsson A., Ohlsson C., Isaksson O., Peterson L., Treatment of deep cartilage defects in the knee with autologous chondrocyte transplantation, N. Engl. J. Med., 1994, 331, 889–89510.1056/NEJM199410063311401Search in Google Scholar PubMed

[4] Breinan H.A., Minas T., Hsu H.P., Nehrer S., Shortkroff S., Spector M., Autologous chondrocyte implantation in a canine model: change in composition of reparative tissue with time, J. Orthop. Res., 2001, 19, 482–49210.1016/S0736-0266(00)90015-9Search in Google Scholar PubMed

[5] Hardingham T.E., Fosang A.J., Proteoglycans: many forms and many functions, FASEB J., 1992, 6, 861–87010.1096/fasebj.6.3.1740236Search in Google Scholar

[6] Sophia Fox A.J., Bedi A., Rodeo S.A. The Basic Science of Articular Cartilage, Sports Health, 2009, 1, 461–46810.1177/1941738109350438Search in Google Scholar PubMed PubMed Central

[7] Kim M., Choe S., BMPs and their clinical potentials, BMB Rep., 2011, 44, 619–63410.5483/BMBRep.2011.44.10.619Search in Google Scholar PubMed PubMed Central

[8] Kuo A.C., Rodrigo J.J., Reddi A.H., Curtiss S., Grotkopp E., Chiu M., Microfracture and bone morphogenetic protein 7 (BMP-7) synergistically stimulate articular cartilage repair, Osteoarthr. Cartil., 2006, 14, 1126–113510.1016/j.joca.2006.04.004Search in Google Scholar PubMed

[9] Chubinskaya S., Hurtig M., Rueger D.C., OP-1/BMP-7 in cartilage repair, Int. Orthop., 2007, 31, 773–78110.1007/s00264-007-0423-9Search in Google Scholar PubMed PubMed Central

[10] DeLise A.M., Fischer L., Tuan R.S., Cellular interactions and signaling in cartilage development, Osteoarthr. Cartil., 2000, 8, 309–33410.1053/joca.1999.0306Search in Google Scholar PubMed

[11] Archer C.W., Francis-West P., The chondrocyte, Int. J. Biochem. Cell Biol., 2003, 35, 401–40410.1016/S1357-2725(02)00301-1Search in Google Scholar PubMed

[12] Garnero P., Delmas P.D., Biomarkers in osteoarthritis, Curr. Opin. Rheumatol., 2003, 15, 641–64610.1097/00002281-200309000-00020Search in Google Scholar PubMed

[13] Schulze-Tanzil G., Mobasheri A., de Souza P., John T., Shakibaei M., Loss of chondrogenic potential in dedifferentiated chondrocytes correlates with deficient Shc–Erk interaction and apoptosis, Osteoarthr. Cartil., 2004, 12, 448–45810.1016/j.joca.2004.02.007Search in Google Scholar PubMed

[14] Caron M.M., Emans P.J., Coolsen M.M., Voss L., Surtel D.A., Cremers A., et al., Redifferentiation of dedifferentiated human articular chondrocytes: comparison of 2D and 3D cultures, Osteoarthr. Cartil., 2012, 20, 1170–117810.1016/j.joca.2012.06.016Search in Google Scholar PubMed

[15] Blain E.J., Involvement of the cytoskeletal elements in articular cartilage homeostasis and pathology, Int. J. Exp. Pathol., 2009, 90, 1–1510.1016/j.joca.2012.06.016Search in Google Scholar

[16] Liu H., Lee Y-W., Dean M., Re-expression of differentiated proteoglycan phenotype by dedifferentiated human chondrocytes during culture in alginate beads, Biochim. Biophys. Acta, 1998, 1425, 505–51510.1016/S0304-4165(98)00105-6Search in Google Scholar

[17] Smieszek A., Czyrek A., Basinska K., Trynda J., Skaradzinska A., Siudzinska A., et al., Effect of Metformin on Viability, Morphology, and Ultrastructure of Mouse Bone Marrow- Derived Multipotent Mesenchymal Stromal Cells and Balb/3T3 Embryonic Fibroblast Cell Line, Biomed Res Int, 2015, http://dx.doi.org/10.1155/2015/76940210.1155/2015/769402Search in Google Scholar PubMed PubMed Central

[18] Smieszek A., Donesz-Sikorska A., Grzesiak J., Krzak J., Marycz K., Biological effects of sol-gel derived ZrO2 and SiO2/ZrO2 coatings on stainless steel surface--In vitro model using mesenchymal stem cells, J. Biomater. Appl., 2014, 29, 699–71410.1177/0885328214545095Search in Google Scholar PubMed

[19] Kosiorowska A., Puggaard L., Hedemann M.S., Sehested J., Jensen S.K., Kristensen N.B., et al., Gastrointestinal development of dairy calves fed low- or high-starch concentrate at two milk allowances, Animal, 2011, 5, 211–21910.1017/S1751731110001710Search in Google Scholar PubMed

[20] Sittinger M., Bujia J., Rotter N., Reitzel D., Minuth W.W., Burmester G.R., Tissue engineering and autologous transplant formation: practical approaches with resorbable biomaterials and new cell culture techniques, Biomaterials, 1996, 17, 237–24210.1016/0142-9612(96)85561-XSearch in Google Scholar PubMed

[21] Temenoff J.S., Mikos A.G., Review: tissue engineering for regeneration of articular cartilage, Biomaterials, 2000, 21, 431–44010.1016/S0142-9612(99)00213-6Search in Google Scholar

[22] Breinan H.A., Martin S.D., Hsu H.-P., Spector M., Healing of canine articular cartilage defects treated with microfracture, a type-II collagen matrix, or cultured autologous chondrocytes, J. Orthop. Res., 2000,18, 781–78910.1002/jor.1100180516Search in Google Scholar PubMed

[23] Hsieh-Bonassera N.D., Wu I., Lin J.K., Schumacher B.L., Chen A.C., Masuda K., et al., Expansion and Redifferentiation of Chondrocytes from Osteoarthritic Cartilage: Cells for Human Cartilage Tissue Engineering, Tissue Eng. Part A, 2009, 15, 3513–352310.1089/ten.tea.2008.0628Search in Google Scholar PubMed PubMed Central

[24] Aulthouse A.L., Beck M., Griffey E., Sanford J., Arden K., Machado M.A., et al., Expression of the human chondrocyte phenotype in vitro, In Vitro Cell Dev. Biol., 1989, 25, 659–66810.1007/BF02623638Search in Google Scholar PubMed

[25] Stokes D.G., Liu G., Coimbra I.B., Piera-Velazquez S., Crowl R.M., Jiménez S.A. Assessment of the gene expression profile of differentiated and dedifferentiated human fetal chondrocytes by microarray analysis, Arthritis Rheum., 2002, 46, 404–41910.1002/art.10106Search in Google Scholar PubMed

[26] Rosenzweig D.H., Matmati M., Khayat G., Chaudhry S., Hinz B., Quinn T.M., Culture of Primary Bovine Chondrocytes on a Continuously Expanding Surface Inhibits Dedifferentiation, Tissue Eng. Part A, 2012, 18, 2466–247610.1089/ten.tea.2012.0215Search in Google Scholar PubMed PubMed Central

[27] Villar-Suárez V., Calles-Venal I., Bravo I.G., Fernández-Alvarez J.G., Fernández-Caso M., et al., Differential Behavior Between Isolated and Aggregated Rabbit Auricular Chondrocytes on Plastic Surfaces, J. Biomed. Biotechnol., 2004, 86–9210.1155/S1110724304312039Search in Google Scholar PubMed PubMed Central

[28] Innes J.F., Gordon C., Vaughan-Thomas A., Rhodes N.P., Clegg P.D. Evaluation of cartilage, synovium and adipose tissue as cellular sources for osteochondral repair, Vet. J., 2013, 197, 619–62410.1016/j.tvjl.2013.05.044Search in Google Scholar PubMed

[29] Parry N.M., Phillippo M., Reid M.D., McGaw B.A., Flint D.J., Loveridge N. Molybdenum-induced changes in the epiphyseal growth plate, Calcif. Tissue Int., 1993, 53, 180–18610.1007/BF01321835Search in Google Scholar PubMed

[30] Mobasheri A., Lewis R., Ferreira-Mendes A., Rufino A., Dart C., Barrett-Jolley R., Potassium channels in articular chondrocytes, Channels (Austin), 2012, 6, 416–42510.4161/chan.22340Search in Google Scholar PubMed PubMed Central

[31] Roy S., Ultrastructure of articular cartilage in experimental immobilization, Ann. Rheum. Dis., 1970, 29, 634–64210.1136/ard.29.6.634Search in Google Scholar PubMed PubMed Central

[32] Roy S., Meachim G., Chondrocyte ultrastructure in adult human articular cartilage, Ann. Rheum. Dis., 1968, 27, 544–55810.1136/ard.27.6.544Search in Google Scholar PubMed PubMed Central

[33] Marlovits S., Hombauer M., Truppe M., Vècsei V., Schlegel W. Changes in the ratio of type-I and type-II collagen expression during monolayer culture of human chondrocytes, J. Bone Joint Surg. Br., 2004, 86, 286–29510.1302/0301-620X.86B2.14918Search in Google Scholar PubMed

[34] Binette F., McQuaid D.P., Haudenschild D.R., Yaeger P.C., McPherson J.M., Tubo R., Expression of a stable articular cartilage phenotype without evidence of hypertrophy by adult human articular chondrocytes in vitro, J. Orthop. Res., 1998, 16, 207-21610.1002/jor.1100160208Search in Google Scholar PubMed

[35] Bell D.M., Leung K.K., Wheatley S.C., Ng L.J., Zhou S., Ling K.W., et.al., SOX9 directly regulates the type-II collagen gene, Nat. Genet., 1997, 16, 174–17810.1038/ng0697-174Search in Google Scholar PubMed

[36] Yamashita S., Andoh M., Ueno-Kudoh H., Sato T., Miyaki S., Asahara H., Sox9 directly promotes Bapx1 gene expression to repress Runx2 in chondrocytes, Exp. Cell Res., 2009, 315, 2231–224010.1016/j.yexcr.2009.03.008Search in Google Scholar PubMed PubMed Central

[37] Burton-Wurster N., Liu W., Matthews G.L., Lust G., Roughley P.J., Glant T.T., et al., TGF beta 1 and biglycan, decorin, and fibromodulin metabolism in canine cartilage, Osteoarthr. Cartil., 2003, 11, 167–17610.1016/j.yexcr.2009.03.008Search in Google Scholar

Received: 2016-3-17
Accepted: 2016-5-23
Published Online: 2016-8-27
Published in Print: 2016-1-1

© 2016 Urszula Nowak et al., published by De Gruyter Open

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Articles in the same Issue

  1. Regular article
  2. Purification of polyclonal IgG specific for Camelid’s antibodies and their recombinant nanobodies
  3. Regular article
  4. Antioxidative defense mechanism of the ruderal Verbascum olympicum Boiss. against copper (Cu)-induced stress
  5. Regular article
  6. Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice
  7. Regular article
  8. Expression and characterization of a cutinase (AnCUT2) from Aspergillus niger
  9. Regular article
  10. The Lytic SA Phage Demonstrate Bactericidal Activity against Mastitis Causing Staphylococcus aureus
  11. Regular article
  12. MafB, a target of microRNA-155, regulates dendritic cell maturation
  13. Regular article
  14. Plant regeneration from protoplasts of Gentiana straminea Maxim
  15. Regular article
  16. The effect of radiation of LED modules on the growth of dill (Anethum graveolens L.)
  17. Regular article
  18. ELF-EMF exposure decreases the peroxidase catalytic efficiency in vitro
  19. Regular article
  20. Cold hardening protects cereals from oxidative stress and necrotrophic fungal pathogenesis
  21. Regular article
  22. MC1R gene variants involvement in human OCA phenotype
  23. Regular article
  24. Chondrogenic potential of canine articular cartilage derived cells (cACCs)
  25. Regular article
  26. Cloning, expression, purification and characterization of Leishmania tropica PDI-2 protein
  27. Regular article
  28. High potential of sub-Mediterranean dry grasslands for sheep epizoochory
  29. Regular article
  30. Identification of drought, cadmium and root-lesion nematode infection stress-responsive transcription factors in ramie
  31. Regular article
  32. Herbal supplement formula of Elephantopus scaber and Sauropus androgynus promotes IL-2 cytokine production of CD4+T cells in pregnant mice with typhoid fever
  33. Regular article
  34. Caffeine effects on AdoR mRNA expression in Drosophila melanogaster
  35. Regular article
  36. Effects of MgCl2 supplementation on blood parameters and kidney injury of rats exposed to CCl4
  37. Regular article
  38. Effective onion leaf fleck management and variability of storage pathogens
  39. Regular article
  40. Improving aeration for efficient oxygenation in sea bass sea cages. Blood, brain and gill histology
  41. Regular article
  42. Biogenic amines and hygienic quality of lucerne silage
  43. Regular article
  44. Isolation and characterization of lytic phages TSE1-3 against Enterobacter cloacae
  45. Regular article
  46. Effects of pH on antioxidant and prooxidant properties of common medicinal herbs
  47. Regular article
  48. Relationship between cytokines and running economy in marathon runners
  49. Regular article
  50. Anti-leukemic activity of DNA methyltransferase inhibitor procaine targeted on human leukaemia cells
  51. Regular article
  52. Research Progress in Oncology. Highlighting and Exploiting the Roles of Several Strategic Proteins in Understanding Cancer Biology
  53. Regular article
  54. Ectomycorrhizal communities in a Tuber aestivum Vittad. orchard in Poland
  55. Regular article
  56. Impact of HLA-G 14 bp polymorphism and soluble HLA-G level on kidney graft outcome
  57. Regular article
  58. In-silico analysis of non-synonymous-SNPs of STEAP2: To provoke the progression of prostate cancer
  59. Regular article
  60. Presence of sequence and SNP variation in the IRF6 gene in healthy residents of Guangdong Province
  61. Regular article
  62. Environmental and economic aspects of Triticum aestivum L. and Avena sativa growing
  63. Regular article
  64. A molecular survey of Echinococcus granulosus sensu lato in central-eastern Europe
  65. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  66. Molecular genetics related to non-Hodgkin lymphoma
  67. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  68. Roles of long noncoding RNAs in Hepatocellular Carcinoma
  69. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  70. Advancement of Wnt signal pathway and the target of breast cancer
  71. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  72. A tumor suppressive role of lncRNA GAS5 in human colorectal cancer
  73. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  74. The role of E-cadherin - 160C/A polymorphism in breast cancer
  75. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  76. The proceedings of brain metastases from lung cancer
  77. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  78. Newly-presented potential targeted drugs in the treatment of renal cell cancer
  79. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  80. Decreased expression of miR-132 in CRC tissues and its inhibitory function on tumor progression
  81. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  82. The unusual yin-yang fashion of RIZ1/RIZ2 contributes to the progression of esophageal squamous cell carcinoma
  83. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  84. Human papillomavirus infection mechanism and vaccine of vulva carcinoma
  85. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  86. Abnormal expressed long non-coding RNA IRAIN inhibits tumor progression in human renal cell carcinoma cells
  87. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  88. UCA1, a long noncoding RNA, promotes the proliferation of CRC cells via p53/p21 signaling
  89. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  90. Forkhead box 1 expression is upregulatedin non-small cell lung cancer and correlateswith pathological parameters
  91. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  92. The development of potential targets in the treatment of non-small cell lung cancer
  93. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  94. Low expression of miR-192 in NSCLC and its tumor suppressor functions in metastasis via targeting ZEB2
  95. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  96. Downregulation of long non-coding RNA MALAT1 induces tumor progression of human breast cancer through regulating CCND1 expression
  97. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  98. Post-translational modifications of EMT transcriptional factors in cancer metastasis
  99. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  100. EZH2 Expression and its Correlation with Clinicopathological Features in Patients with Colorectal Carcinoma
  101. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  102. The association between EGFR expression and clinical pathology characteristics in gastric cancer
  103. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  104. The peiminine stimulating autophagy in human colorectal carcinoma cells via AMPK pathway by SQSTM1
  105. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  106. Activating transcription factor 3 is downregulated in hepatocellular carcinoma and functions as a tumor suppressor by regulating cyclin D1
  107. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  108. Progress toward resistance mechanism to epidermal growth factor receptor tyrosine kinase inhibitor
  109. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  110. Effect of miRNAs in lung cancer suppression and oncogenesis
  111. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  112. Role and inhibition of Src signaling in the progression of liver cancer
  113. Topical Issue on Cancer Signaling, Metastasis and Target Therapy
  114. The antitumor effects of mitochondria-targeted 6-(nicotinamide) methyl coumarin
  115. Special Issue on CleanWAS 2015
  116. Characterization of particle shape, zeta potential, loading efficiency and outdoor stability for chitosan-ricinoleic acid loaded with rotenone
  117. Special Issue on CleanWAS 2015
  118. Genetic diversity and population structure of ginseng in China based on RAPD analysis
  119. Special Issue on CleanWAS 2015
  120. Optimizing the extraction of antibacterial compounds from pineapple leaf fiber
  121. Special Issue on CleanWAS 2015
  122. Identification of residual non-biodegradable organic compounds in wastewater effluent after two-stage biochemical treatment
  123. Special Issue on CleanWAS 2015
  124. Remediation of deltamethrin contaminated cotton fields: residual and adsorption assessment
  125. Special Issue on CleanWAS 2015
  126. A best-fit probability distribution for the estimation of rainfall in northern regions of Pakistan
  127. Special Issue on CleanWAS 2015
  128. Artificial Plant Root System Growth for Distributed Optimization: Models and Emergent Behaviors
  129. Special Issue on CleanWAS 2015
  130. The complete mitochondrial genomes of two weevils, Eucryptorrhynchus chinensis and E. brandti: conserved genome arrangement in Curculionidae and deficiency of tRNA-Ile gene
  131. Special Issue on CleanWAS 2015
  132. Characteristics and coordination of source-sink relationships in super hybrid rice
  133. Special Issue on CleanWAS 2015
  134. Construction of a Genetic Linkage Map and QTL Analysis of Fruit-related Traits in an F1 Red Fuji x Hongrou Apple Hybrid
  135. Special Issue on CleanWAS 2015
  136. Effects of the Traditional Chinese Medicine Dilong on Airway Remodeling in Rats with OVA-induced-Asthma
  137. Special Issue on CleanWAS 2015
  138. The effect of sewage sludge application on the growth and absorption rates of Pb and As in water spinach
  139. Special Issue on CleanWAS 2015
  140. Effectiveness of mesenchymal stems cells cultured by hanging drop vs. conventional culturing on the repair of hypoxic-ischemic-damaged mouse brains, measured by stemness gene expression
Downloaded on 8.4.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2016-0021/html
Scroll to top button