The complete mitochondrial genomes of two weevils, Eucryptorrhynchus chinensis and  E. brandti:  conserved genome arrangement in Curculionidae and deficiency of tRNA-Ile gene

Zhen-Kai Liu; Peng Gao; Muhammad Aqeel Ashraf; Jun-Bao Wen

doi:10.1515/biol-2016-0060

Article Open Access

The complete mitochondrial genomes of two weevils, Eucryptorrhynchus chinensis and E. brandti: conserved genome arrangement in Curculionidae and deficiency of tRNA-Ile gene

Zhen-Kai Liu , Peng Gao , Muhammad Aqeel Ashraf and Jun-Bao Wen

Published/Copyright: December 15, 2016

Published by

Become an author with De Gruyter Brill

Submit Manuscript Author Information Explore this Subject

From the journal Open Life Sciences Volume 11 Issue 1

Abstract

The weevils Eucryptorrhynchus chinensis and Eucryptorrhynchus brandti (Coleoptera: Curculionidae), are two of the most important pests of the tree-of-heaven, Ailanthus altissima, which is found throughout China. In this study, the complete mitogenomes of the two weevils have been sequenced using Illumina HiSeq^TM 2000. The mitogenomes of E. chinensis and E. brandti are 15,628bp and 15,597bp long with A+T contents of 77.7% and 76.6%, respectively. Both species have typical circular mitochondrial genomes that encode 36 genes. Except the deficiency of tRNA-Ile, the gene composition and order of E. chinensis and E. brandti are identical to the inferred ancestral gene arrangement of insects. In both mitochondrial genomes, the start codons for COI and ND1 are AAT and TTG, respectively. A5bp motif (TACTA) is detected in intergenic region between the tRNA-Ser (UCN) and ND1 genes. The ATP8/ATP6 and ND4L/ND4 gene pairs appear to overlap four or seven nucleotides (ATAA/ATGATAA) in different reading frames. The complete sequences of AT-rich region have two regions including tandem repeats. The study identifies useful genetic markers for studying the population genetics, molecular identification and phylogeographics of Eucryptorrhynchus weevils. The features of the mitochondrial genomes are expected to be valuable in

Keywords: Mitochondrial genome; Eucryptorrhynchus chinensis; Eucryptorrhynchus brandti; Curculionidae

1 Introduction

Mitochondrial DNA has been used commonly as a molecular marker for phylogenetic, population genetics, phylogeography and molecular evolutionary studies over the last three decades [1–3]. This widespread use is due to their unique features, including a high copy number, maternal inheritance, lack of recombination, and a generally higher mutation rate than nuclear DNA [1,4,5]. Complete mitochondrial genomes also provide a suite of genome-level characters, such as gene content and gene arrangement, base composition, modes of replication and transcription, tRNA and rRNA gene secondary structures, and genetic codon variation [3,6–8].

The number of complete mtgenomes has steadily been on the rise with the technical feasibility of sequencing [9–13]. Currently, nearly fifty coleopteran mitochondrial genomes have been completely or near completely sequenced. These provide the possibility to reinvestigate long-standing phylognetic questions, especially the weevils of Curculionidae [14].

Although weevils constitute a vast and diverse family of beetles, the basal relationships between species remain controversial [14–16]. Compared to the size and diversity of Curculionidae, which contains over 51,000 described species [17], the existing information on Curculionidae mtDNA is very limited. To date only three Curculionidae (Sphenophorus sp., Naupactus xanthographus and Hylobitelus xiaoi) mitochondrial genomes have been completely or near completely sequenced [7].

Eucryptorrhynchus chinensis and Eucryptorrhynchus brandti (Coleoptera: Curculionidae) are two of the most important pests of the tree-of-heaven, Ailanthus altissima (Mill.), which is found throughout China. Larvae of E. chinensis feed on the root tissues and E. brandti feed on the phloem and cambial, and often occur concurrently. After A. altissima was first introduced into North America in the 1700s, it spread rapidly, outcompeting native vegetation [18]. Accordingly, E. chinensis and E. brandti are currently considered as potential biological control agents to limit the spread of A. altissima [19].

In this study, we sequenced the complete mitogenomes of E. chinensis and E. brandti analyzed the gene content, organization and codon usage, and compared them with other species of Curculionidae. The newly sequenced mitogenomes of Curculionidae are expected to be valuable in enhancing our understanding of the mitogenomes of congeneric species, as well as in yielding a valuable approach for assessing mtDNA evolutionary trends [6,20].

2 Materials and Methods

2.1 Sample origin and DNA extraction

Adult species of E. chinensis and E. brandti were collected from the farmland shelter-forest in Lingwu city (N 38°03′, E 106°20′), Ningxia Hui Autonomous Region in northwest China in 2013. Specimens were preserved in 100% ethanol and stored at -20°C until DNA extraction. Mitochondrial DNA was extracted using the mtDNA isolation kit (Biovision) according to the manufacturer’s instruction. Prior to extraction, muscle tissue under pronotum was selected to avoid possible contamination from gut content.

2.2 DNA sequencing and assembly

MtDNA was sequenced with Illumina HiSeq^TM 2000. Using the default parameters, reads were assembled using velvet (1.2.09).

2.3 Gap PCR amplification and sequencing

After assembly, the mitochondrial genomes were nearly completely sequenced with the exception of an A+T-rich region and tRNA-Ile. According to the flanking sequences of the gap, we designed a pair of primers (SR-J: 5’- ATAATAGGGTATCTAATCCTAGT/TM-N: 5’-ACCTTTATATTTGGGGTATGAACC) to bridge the gap. PCR

with Fast HiFidelity PCR Kit (TIANGEN, China) was carried out using the following conditions: 94°C for 3 min, 30 cycles at 94°C for 30s, 56°C for 30s, 68°C for 2 min, and a final extension at 68°C for 5 min. The PCR products were examined by agarose gel electrophoresis (1%). After purification, the products were directly sequenced using ABI technology.

2.4 Annotation and analysis

The MITOS database http://mitos.bioinf.uni-leipzig.de/ was used to identify the mitogenomic sequences including protein-coding genes, rRNAs, and tRNAs [21]. Transfer RNA gene analysis was conducted using tRNAscan-SE software v.1.21 [22]. After MITOS reported general locations, the precise locations of Protein-coding genes, ribosomal RNA genes and AT-rich region were identified by comparing their similarity to published Curculionidae mitochondrial sequences. The tandem repeats in the AT-rich region were predicted by the Tandem Repeats Finder available online http://tandem.bu.edu/trf/trf.html [23]. Codon usage and nucleotide composition statistics were computed using MEGA 5.0 software [24]. Circular genetic maps were generated with mtviz http://pacosy.informatik.uni-leipzig.de/mtviz/.

3 Results and discussion

3.1 Genome organization, structure and composition

Complete mitogenome sequences were obtained for E. chinensis (15,628bp) and E.brandti (15,597bp), and have been deposited in GenBank (E. chinensis: KP410324 and E. brandti: KP455482). They are typical circular molecules and include 36 genes usually present in animal mtDNA [1], including 13 PCG, 21tRNA genes, 2 ribosomal genes and A+T- rich region (Figure 1 and Figure 2). Among these, 22 genes (nine PCGs, and thirteen tRNA genes) are located on the majority strand (J-strand) and the others on the minority strand (N-strand) (Table 1 and Table 2).

Figure 1

Circular map of the mitogenome of E. chinensis.

Figure 2

Circular map of the mitogenome of E. brandti.

Table 1

Organization of the E. chinensis mitochondrial genome.

Gene	location	size/bp	codon		anticodon	IGS/bp	strand
					anticodon	IGS/bp	strand
			start	stop
tRNA-Gln	1-67	67			TTG	0	N
tRNA-Met	87-156	70			CAT	+19	J
ND2	157-1167	1011	ATT	TAA		0	J
tRNA-Trp	1167-1236	70			TCA	-1	J
tRNA-Cys	1251-1318	68			GCA	+14	N
tRNA-Tyr	1335-1397	63			GTA	+16	N
COI	1399-2929	1531	AAT	T		+1	J
tRNA-Leu	2930-2994	65			TAA	0	J
COII	2995-3678	684	ATT	TAA		0	J
tRNA-Lys	3681-3752	72			CTT	+2	J
tRNA-Asp	3752-3815	64			GTC	-1	J
ATP8	3816-3971	156	ATT	TAA		0	J
ATP6	3968-4639	672	ATA	TAA		-4	J
COIII	4639-5421	783	ATG	TAA		-1	J
tRNA-Gly	5426-5490	65			TCC	+4	J
ND3	5491-5844	354	ATA	TAA		0	J
tRNA-Ala	5848-5915	68			TGC	+3	J
tRNA-Arg	5916-5979	64			T CG	0	J
tRNA-Asn	5979-6042	64			GTT	-1	J
tRNA-Ser	6043-6109	67			TCT	0	J
tRNA-Glu	6109-6172	64			TTC	-1	J
tRNA-Phe	6179-6244	66			GAA	+6	N
ND5	6244-7968	1725	ATT	TAA		-1	N
tRNA-His	7969-8034	66			GTG	0	N
ND4	8035-9364	1330	ATA	T		0	N
ND4L	9361-9654	294	ATG	TAA		-4	N
tRNA-Thr	9660-9724	65			TGT	+5	J
tRNA-Pro	9725-9788	64			TGG	0	N
ND6	9791-10297	507	ATT	TAA		+2	J
CYTB	10298-11437	1140	ATG	TAA		0	J
tRNA-Ser	11437-11504	68			TGA	-1	J
ND1	11524-12474	951	TTG	TAG		+19	N
tRNA-Leu	12476-12541	66			TAG	+1	N
lrRNA	12542-13861	1320				0	N
tRNA-Val	13862-13927	66			TAC	0	N
srRNA	13928-14709	782				0	N
CR	14710-15628	919				0	-

Note: IGS denotes the length of intergenic spacer region, for which negative numbers indicate nucleotide overlapping between adjacent genes.

Table 2

Organization of the E. chinensis mitochondrial genome.

Gene	location	size/bp	codon		anticodon	IGS/bp	strand
					anticodon	IGS/bp	strand
			start	stop
tRNA-Gln	1-67	67			TTG	0	N
tRNA-Met	77-145	69			CAT	+9	J
ND2	146-1159	1014	ATT	TAA		0	J
tRNA-Trp	1159-1227	69			TCA	-1	J
tRNA-Cys	1227-1292	66			GCA	-1	N
tRNA-Tyr	1306-1370	65			GTA	+13	N
COI	1372-2902	1531	AAT	T		+1	J
tRNA-Leu	2903-2967	65			TAA	0	J
COII	2968-3651	684	ATC	TAA		0	J
tRNA-Lys	3653-3723	71			CTT	+1	J
tRNA-Asp	3724-3789	66			GTC	0	J
ATP8	3790-3945	156	AT T	TAA		0	J
ATP6	3942-4613	672	ATA	TAA		-4	J
COIII	4613-5395	783	ATG	TAA		-1	J
tRNA-Gly	5401-5464	64			TCC	+5	J
ND3	5465-5818	354	ATT	TAA		0	J
tRNA-Ala	5818-5886	69			TGC	-1	J
tRNA-Arg	5887-5949	63			T CG	0	J
tRNA-Asn	5949-6011	63			GTT	-1	J
tRNA-Ser	6012-6077	66			TCT	0	J
tRNA-Glu	6077-6139	63			TTC	-1	J
tRNA-Phe	6140-6205	66			GAA	0	N
ND5	6205-7926	1721	ATT	TAA		-1	N
tRNA-His	7927-7991	65			GTG	0	N
ND4	7992-9321	1330	ATA	T		0	N
ND4L	9318-9611	294	ATG	TAG		-4	N
tRNA-Thr	9617-9680	64			TGT	+6	J
tRNA-Pro	9681-9748	67			TGG	0	N
ND6	9751-10257	507	ATT	TAA		+2	J
CYTB	10258-11397	1140	ATG	TAA		0	J
tRNA-Ser	11398-11465	68			TGA	0	J
ND1	11484-12434	951	TTG	TAG		+8	N
tRNA-Leu	12436-12501	66			TAG	+1	N
lrRNA	12502-13805	1304				0	N
tRNA-Val	13806-13870	65			TAC	0	N
srRNA	13871-14641	771				0	N
CR	14642-15597	956				0	-

Note: IGS denotes the length of intergenic spacer region, for which negative numbers indicate nucleotide overlapping between adjacent genes.

A comparison with previous studies suggests that the orientation and gene order of E. chinensis and E. brandti are identical to the inferred ancestral gene arrangement of insects [1]. However, one striking difference is the deficiency of tRNA-Ile genes (Figure 1 and Figure 2). This deletion is also found in other species, such as the Sphenophorus striatopunctatus (GU176342) and Naupactus xanthographus (GU176345), which belong to Curculionidae [7]. We considered that the deficiency of tRNA-Ile in the mitochondria may provide valuable phylogenetic characters at the family level of coleopteran insects [25]. tRNA arrangement is usually conserved in Coleoptera with no rearrangement and deletions. Only Tribolium castaneum differs from the most common type [26]. In addition, the feature only exists in most Curculionidae insects which have been sequenced mitogenome [7].

The coding strand is indicated by think line; abbreviations are as in the text and for tRNAs the one letter code of the corresponding amino acid is given. The one-letter symbols L1, L2, S1 and S2 denote tRNA-Leu (CUN), tRNA-Leu (UUR), tRNA-Ser (AGN), tRNA-Ser (UCN).

3.2 Nucleotide composition

The composition of the majority strand (J-strand) of E. chinensis mtDNA is A = 6,189 (39.6%), T = 5,954 (38.1%), G = 1,360 (8.7%), C = 2,125 (13.6%). The composition of the J strand of E. brandti mtDNA is A = 6,067 (38.9%), T = 5,880 (37.7%), G = 1,404 (9.0%), C = 2,246 (14.4%).

Similarly, to most Coleopteran insects, the two weevils’ mitogenomes show a high A+T bias (77.7% in E. chinensis and 76.6% in E. brandti), compared with most beetles (e.g., A+T% ranges from 66% in Cheirotonus jansonito 81% in Sphaerius sp.) [9,27]. The analysis of the base composition at each codon position of the concatenated 13 PCGs of E. chinensis and E. brandti revealed that the third codon position (91.6% in E. chinensis and 90.6% in E. brandti) showed an AT content higher than that of the first (70.3% in E. chinensis and 69.4% in E. brandti) and second (68.1% in E. chinensis and 68.5% in E. brandti) codon positions, as has also been observed in other sequenced coleopteran species [27].

The AT skew is 0.019 in E. chinensis and 0.016 in E. brandti, while the GC skew is -0.220 in E. chinensis and -0.231 in E. brandti. This suggests a weak A skew and a strong C skew in the J-strand, similar to those typically found in most coleopteran mitochondrial genomes [28,29].

3.3 Intergenic spacers and gene overlaps

Mitochondrial evolution has traditionally been viewed as favoring genome size reduction, possibly by eliminating intergenic spacers [30].

In addition to the A+T- rich region, a total of 92 bp noncoding sequences are present in the mitogenomes of E. chinensis, which contain 12 intergenic spacers, ranging in size from 1 to 19 bp. The longest of these exist between tRNA-Serand ND1 gene, tRMA-Gln and tRNA-Met including the microsatellite-like repeats (AT)₇ (Table 1). A total of 46 bp noncoding sequences are present in the mitogenomes of E. brandti, which contain 9 intergenic spacers, ranging in size from 1 to 13 bp. The longest of these exists between tRNA-Cys and tRNA-Tyr (Table 2).

Genes overlap in the E. chinensis mitogenome in a total of 15 bp in 9 locations; the longest overlap is 4 bp, and is located between ATP8 and ATP6 (Table 1). In E. brandti, a total of 15 bp overlapped regions are scattered in 9 locations; the longest overlap is 4 bp, and is located between ATP8 and ATP6 (Table 2). In annotations, many gene boundaries have been signed to avoid the implications of noncoding intergenic spacers and genes overlaps [9].

Although most spacers and overlaps appeared to be unique to individual species, Curculionidae species appeared to share the conserved sequence length and location of non-coding regions.

The majority of the intergenic space sequences are far less than 50 bp [28]. A small intergenic region between the tRNA-Ser (UCN) and ND1 genes and including a 5 bp motif (TACTA), is also found in most sequenced coleopterans [9,27,31]. The ATP8/ATP6 and ND4L/ND4 gene pairs appear to overlap four or seven nucleotides (ATAA/ATGATAA) in different reading frames [9,27,32].

3.4 Protein-coding genes (PCGs) and codon usage pattern

The mtDNA of E. chinensis and E. brandti contain the full set of PCGs usually present in animal mtDNA [1].

In E. chinensis and E. brandti, with the exception of COI and ND1, all protein-coding sequences originate with the typical ATN start codon. The start codons for COI and ND1 are AAT and TTG, respectively. In E. chinensis, five PCGs (ND2, COII, ATP8, ND5, ND6) start with ATT codons, three (ATP6, ND3 and ND4) with ATA, and there (COIII, ND4L, CYTB) with ATG (Table 1). In E. brandti, five (ND2, ATP8, ND3, ND5, ND6) start with ATT, two (ATP6 and ND4) with ATA, one (COII) with ATC and three (COIII, ND4L, CYTB) with ATG (Table 2).

COIhas been characterized in many species of diverse insect orders, including Diptera, Lepidoptera, Orthoptera and Coleoptera [32,33]. Generally, some other amino acids (AAA (lysine), ATY (isoleucine), CTA (leucine), AAY (asparagine)) have all been proposed as possible start codons in Coleoptera [9,34]. We propose that the COImay start with AAT in two weevils. By aligning the sequence region encompassing tRNA-Tyr and COI from all known weevil mitogenomes, the Asparagine (AAT or AAC) start location has been well conserved, and is located only a single base pair downstream from the end of the tRNA-Tyr [9, 27].

We propose that the ND1 may start with TTG in two weevils. The start codons creating a single base pair between tRNA-Leu and ND1 gene also appear to be more plausible in the evolutionary economic perspective. The feature has been identified in several insects, including Damaster mirabilissimus mirabilissim [32], Trachypachus holmbergi [9] and Pyrocoelia rufa [35].

Two standard stop codons TAA/TAG and incomplete stop codons T are utilized in the PCGs. For E. chinensis, ten PCGs (ND2, COII, ATP8, ATP6, COIII, ND3, ND5, ND4L, ND6, CYTB) terminate with TAA, one (ND1) with TAG, two (COI, ND4) with T (Table 1). For E. brandti, nine PCGs (ND2, COII, ATP8, ATP6, COIII, ND3, ND5, ND6, CYTB) terminate with TAA, two (ND1, ND4L) with TAG, two (COI, ND4) with T (Table 2). These abbreviated stop codons are found in PCGs that are followed by a downstream tRNA gene. The most common interpretation of this phenomenon is that TAA termini are created via posttranscriptional polyadenylation that changed T to the TAA stop codon [36].

The pattern of codon usage in the E. chinensis and E. brandti mtDNA were also studied. There are a total of 3,711 codons in all thirteen mitochondrial PCGs, excluding incomplete termination codons. The condon families exhibit a very similar behavior among these two species (Table 3 and Table 4). The most frequently use amino acids were Leu (E. chinensis: 15.55%; E. brandti: 16.03%), followed by Ile (10.64%; 10.78%), Phe (9.86%; 10.05%), Ser (9.67%; 9.49%) and Met (6.68%; 6.17%). The RSCU revealed that codons harboring A or T in the third position are more frequently used than those of G or C in the third position. In the PCGs, the four AT-rich codons (UUA-Leu, AUU-Ile, UUU-Phe and AUA-Met) were the most frequently used and GCG were not observed, which is consistent with finding in other coleopteran insects [9, 34].

Table 3

RSCU and codon usage of the PCGs of the E. chinensis.

Codon (aa)	N (RSCU)	Codon (aa)	N (RSCU)	Codon (aa)	N (RSCU)	Codon (aa)	N (RSCU)
UUU-F	330 (1.80)	UCU-S	124 (2.76)	UAU-Y	161 (1.82)	UGU-C	31 (1.94)
UUC-F	36 (0.20)	UCC-S	8 (0.18)	UAC-Y	16 (0.18)	UGC-C	1 (0.06)
UUA-L	404 (4.20)	UCA-S	104 (2.32)	UAA-*	10 (2.00)	UGA-W	89 (1.98)
UUG-L	28 (0.29)	UCG-S	5 (0.11)	UAG-*	0 (0.00)	UGG-W	1 (0.02)
CUU-L	84 (0.87)	CCU-P	72 (2.25)	CAU-H	62 (1.63)	CGU-R	13 (0.96)
CUC-L	14 (0.15)	CCC-P	8 (0.25)	CAC-H	14 (0.37)	CGC-R	3 (0.22)
CUA-L	41 (0.43)	CCA-P	45 (1.41)	CAA-Q	57 (1.84)	CGA-R	36 (2.67)
CUG-L	6 (0.06)	CCG-P	3 (0.09)	CAG-Q	5 (0.16)	CGG-R	2 (0.15)
AUU-I	360 (1.82)	ACU-T	93 (2.09)	AAU-N	175 (1.84)	AGU-S	19 (0.42)
AUC-I	35 (0.18)	ACC-T	11 (0.25)	AAC-N	15 (0.16)	AGC-S	1 (0.02)
AUA-M	231 (1.86)	ACA-T	71 (1.60)	AAA-K	121 (1.83)	AGA-S	92 (2.05)
AUG-M	17 (0.14)	ACG-T	3 (0.07)	AAG-K	11 (0.17)	AGG-S	6 (0.13)
GUU-V	57 (1.48)	GCU-A	73 (1.97)	GAU-D	54 (1.83)	GGU-G	61 (1.26)
GUC-V	7 (0.18)	GCC-A	11 (0.30)	GAC-D	5 (0.17)	GGC-G	8 (0.17)
GUA-V	81 (2.10)	GCA-A	62 (1.68)	GAA-E	73 (1.76)	GGA-G	114 (2.36)
GUG-V	9 (0.23)	GCG-A	2 (0.05)	GAG-E	10 (0.24)	GGG-G	10 (0.21)

Table 4

RSCU and codon usage of the PCGs of the E. brandti.

Codon (aa)	N (RSCU)	Codon (aa)	N (RSCU)	Codon (aa)	N (RSCU)	Codon (aa)	N (RSCU)
UUU-F	338 (1.81)	UCU-S	134 (3.05)	UAU-Y	143 (1.71)	UGU-C	28 (1.81)
UUC-F	35 (0.19)	UCC-S	18 (0.41)	UAC-Y	24 (0.29)	UGC-C	3 (0.19)
UUA-L	406 (4.09)	UCA-S	83 (1.89)	UAA-^[*]	9 (1.8)	UGA-W	86 (1.91)
UUG-L	32 (0.32)	UCG-S	6 (0.14)	UAG-^[*]	1 (0.2)	UGG-W	4 (0.09)
CUU-L	85 (0.86)	CCU-P	79 (2.47)	CAU-H	65 (1.78)	CGU-R	17 (1.24)
CUC-L	11 (0.11)	CCC-P	5 (0.16)	CAC-H	8 (0.22)	CGC-R	2 (0.15)
CUA-L	58 (0.58)	CCA-P	42 (1.31)	CAA-Q	59 (1.87)	CGA-R	32 (2.33)
CUG-L	3 (0.03)	CCG-P	2 (0.06)	CAG-Q	4 (0.13)	CGG-R	4 (0.29)
AUU-I	355 (1.78)	ACU-T	81 (1.94)	AAU-N	179 (1.84)	AGU-S	19 (0.43)
AUC-I	45 (0.23)	ACC-T	12 (0.29)	AAC-N	16 (0.16)	AGC-S	3 (0.07)
AUA-M	214 (1.87)	ACA-T	72 (1.72)	AAA-K	113 (1.82)	AGA-S	84 (1.91)
AUG-M	15 (0.13)	ACG-T	2 (0.05)	AAG-K	11 (0.18)	AGG-S	5 (0.11)
GUU-V	74 (1.75)	GCU-A	85 (2.25)	GAU-D	55 (1.75)	GGU-G	62 (1.27)
GUC-V	6 (0.14)	GCC-A	18 (0.48)	GAC-D	8 (0.25)	GGC-G	9 (0.18)
GUA-V	81 (1.92)	GCA-A	48 (1.27)	GAA-E	72 (1.78)	GGA-G	106 (2.17)
GUG-V	8 (0.19)	GCG-A	0 (0)	GAG-E	9 (0.22)	GGG-G	18 (0.37)

Note: aa: amino acid; N: frequency of codon used; RSCU: relative synonymous codon usage;

3.5 Transfer and ribosomal RNA genes

The two mitogenomes have 21 tRNA genes that are present in most metazoan mitogenome [37]. The 21 tRNA genes of the E. chinensis and E. brandti mitogenome are interspersed in the genome, ranging in size from 63 to

72 bp (Table 1 and Table 2). With the exception of serine and leucine, there is only a single tRNA for each amino acid. All tRNA can be folded into the typical clover-leaf structure, with the exception of tRNA-Ser (AGN) (Figure S1 and Figure S2), which lacked the dihydrouridine (DHU) arm, as is the case with several insects [38,39].

Figure S1

Predicted secondary clover-leaf structures for the 21 tRNA genes of E. chinensis.

The tRNAs are labeled with the abbreviations of their corresponding amino acids. Arms of tRNAs (clockwise from top) are the amino acid acceptor (AA) arm, TC (T) arm, the anticodon (AC) arm, and the dihydrouridine (DHU) arm.

Figure S2

Predicted secondary clover-leaf structures for the 21 tRNA genes of E. brandti.

Two rRNA (lrRNA and srRNA) are located between tRNA-Leu (CUN) and tRNA-Val, and between tRNA-Val and the A+T-rich region, respectively (Figure 1 and Figure 2).

3.6 A+T-rich region

The A+T-rich region of E. chinensis (919 bp) and E. brandti (956 bp) are located between srRNA and tRNA-Gln- tRNA-Met (Figure 1 and Figure 2), which are supposed to contain the replication origin site and show high A+T bias (E. chinensis: 82.4%; E. brandti: 76.3%).

The A + T-rich region has been identified as the source of size variation in the entire mitochondrial genome, especially in Curculionidae, from 734 bp in Batocera lineolata (NC_022671) to 4,468 bp in Coccinella septempunctata (JQ321839), usually due to the presence of a variable copy number of repetitive elements [9,29,34,40,41].

In E. chinensis, the complete sequences of AT-rich region have two regions including tandem repeats:1) a short 16 bp sequence tandemly repeated two times, with a partial third (3 bp), 2) a 92 bp sequence tandemly repeated four times, with a partial fifth (53 bp). In E. brandti, the AT-rich region also has two regions including tandem repeats:1) a 49 bp sequence tandemly repeated three times, with a partial fourth (9 bp), 2) a 81 bp sequence tandemly repeated there times, with a partial forth (54 bp).

4 Conclusion

Our study presents the mitogenome sequences of two Eucryptorrhynchus weevils. The results indicate that these mitogenomes follow the ancestral insect arrangement, except the deficiency of tRNA-Ile. There are several common features that many weevil lineages share; such as share the conserved sequence length and location of non-coding regions, using AAT and TTG as start codons for CO1 and ND1, respectively and two regions including tandem repeats in the AT-rich region. Our results identify useful genetic markers for studying population genetics, molecular identification and phylogeographics of Eucryptorrhynchus weevils. The feature of mitochondrial genome of the two weevils adds more examples to determine rearrangement mechanisms and evolutionary processes.

Ethics statement

Eucryptorrhynchus chinensis and Eucryptorrhynchus brandti (Coleoptera: Curculionidae) are not an endangered or protected species and has recently become an important pest of A. altissima in China. In recent years, E. chinensis and E. brandti outbreak occurred in the Ningxia Hui Autonomous Region and provided ample opportunity for sample collection. No specific permits were required for collection in these locations or for these activities.

Conflict of interest: The authors declare that no conflict of interest exist.

Acknowledgments

This work was supported by grants from The Special Fund for Forestry Scientific Research in the Public Interest (NO. 201204501); The Special Fund for Forestry Scientific Research in the Public Interest (NO. 201304412); “Twelfth Five-year” National Science and Technology Support Program of China (NO. 2012BAD19B07).

References

[1] Boore J.L., Animal mitochondrial genomes, Nucleic Acids Res., 1999, 27 (8), 1767-1780.10.1093/nar/27.8.1767Search in Google Scholar PubMed PubMed Central

[2] Cameron S.L., Insect mitochondrial genomics: implications for evolution and phylogeny, Ann. Rev. Entomol., 2014, 59, 95-117.10.1146/annurev-ento-011613-162007Search in Google Scholar PubMed

[3] Simon C., Buckley T.R., Frati F., Stewart J.B., Beckenbach A.T., Incorporating molecular evolution into phylogenetic analysis, and a new compilation of conserved polymerase chain reaction primers for animal mitochondrial DNA, Ann. Rev. Ecol. Evol. Syst., 2006, 37, 545-579.10.1146/annurev.ecolsys.37.091305.110018Search in Google Scholar

[4] Moritz C., Dowling T.E., Brown W.M., Evolution of animal mitochondrial DNA: relevance for population biology and systematics, Ann. Rev. Ecol. Evol. Syst., 1987, 18, 269-292.10.1146/annurev.es.18.110187.001413Search in Google Scholar

[5] Ballard J.W., Whitlock M.C., The incomplete natural history of mitochondria, Mol. Ecol., 2004, 13 (4), 729-744.10.1046/j.1365-294X.2003.02063.xSearch in Google Scholar

[6] Gissi C., Iannelli F., Pesole G., Evolution of the mitochondrial genome of Metazoa as exemplified by comparison of congeneric species, Heredity (Edinb), 2008, 101 (4), 301-320.10.1038/hdy.2008.62Search in Google Scholar PubMed

[7] Song H., Sheffield N.C., Cameron S.L., Miller K.B., Whiting M.F., When phylogenetic assumptions are violated: base compositional heterogeneity and among-site rate variation in beetle mitochondrial phylogenomics, Syst. Entomol., 2010, 35 (3), 429-448.10.1111/j.1365-3113.2009.00517.xSearch in Google Scholar

[8] Boore J.L., Fuerstenberg S.I., Beyond linear sequence comparisons: the use of genome-level characters for phylogenetic reconstruction, Phil. Trans. Royal Soc. B-Biol. Sci., 2008, 363 (1496), 1445-1451.10.1093/acprof:oso/9780199549429.003.0013Search in Google Scholar

[9] Sheffield N.C., Song H., Cameron S.L., Whiting M.F., A comparative analysis of mitochondrial genomes in Coleoptera (Arthropoda: Insecta) and genome descriptions of six new beetles, Mol. Biol. Evol., 2008, 25 (11), 2499-2509.10.1093/molbev/msn198Search in Google Scholar PubMed PubMed Central

[10] Timmermans M.J.T.N., Dodsworth S., Culverwell C.L., Bocak L., Ahrens D., Littlewood D.T.J., Why barcode? High-throughput multiplex sequencing of mitochondrial genomes for molecular systematics, Nucleic Acids Res., 2010, 38 (21), e197.10.1093/nar/gkq807Search in Google Scholar PubMed PubMed Central

[11] Hwang U.W., Park C.J., Yong T.S., Kim W., One-step PCR amplification of complete arthropod mitochondrial genomes, Mol. Phyl. Evol., 2001, 19 (3), 345-352.10.1006/mpev.2001.0940Search in Google Scholar PubMed

[12] Cameron S.L., How to sequence and annotate insect mitochondrial genomes for systematic and comparative genomics research, Syst. Entomol., 2014, 39 (3), 400-411.10.1111/syen.12071Search in Google Scholar

[13] Gillett C.P.D.T., Crampton-Platt A., Timmermans M.J.T.N., Jordal B.H., Emerson B.C., Vogler A.P., Bulk de novo mitogenome assembly from pooled total DNA elucidates the phylogeny of weevils (Coleoptera: Curculionoidea), Mol. Biol. Evol., 2014, 31 (8), 2223-37.10.1093/molbev/msu154Search in Google Scholar PubMed PubMed Central

[14] Hunt T., Bergsten J., Levkanicova Z., Papadopoulou A., John O.S., Wild R., et al., A comprehensive phylogeny of beetles reveals the evolutionary origins of a superradiation, Science, 2007, 318 (5858), 1913-1916.10.1126/science.1146954Search in Google Scholar PubMed

[15] Lawrence J.F., Evolution and Classification of Beetles, Ann. Rev. Ecol. Syst., 1982, 13, 261-290.10.1146/annurev.es.13.110182.001401Search in Google Scholar

[16] Haran J., Timmermans M.J., Vogler A.P., Mitogenome sequences stabilize the phylogenetics of weevils (Curculionoidea) and establish the monophyly of larval ectophagy, Mol. Phylogenet. Evol., 2013, 67 (1), 156-166.10.1016/j.ympev.2012.12.022Search in Google Scholar PubMed

[17] Oberprieler R.G., Marvaldi A.E., Anderson R.S., Weevils, weevils, weevils everywhere, Zootaxa, 2007, 1668, 491-520.10.11646/zootaxa.1668.1.24Search in Google Scholar

[18] Ding J., Reardon R., Yun W., Hao Z., Fu W., Biological control of invasive plants through collaboration between China and the United States of America: a perspective, Biol. Inv., 2006, 8 (7), 1439-1450.10.1007/s10530-005-5833-2Search in Google Scholar

[19] Ding J.Q., Wu Y., Hao Z., Fu W.D., Reardon R., Min L., Assessing potential biological control of the invasive plant, tree-of-heaven, Ailanthus altissima, Biocontrol Sci. Technol., 2006, 16 (6), 547-566.10.1080/09583150500531909Search in Google Scholar

[20] Coates B.S., Assembly and annotation of full mitochondrial genomes for the corn rootworm species, Diabrotica virgifera virgifera and Diabrotica barberi (Insecta: Coleoptera: Chrysomelidae), using Next Generation Sequence data, Gene, 2014, 542 (2), 190-197.10.1016/j.gene.2014.03.035Search in Google Scholar PubMed

[21] Bernt M., Donath A., Jühling F., Externbrink F., Florentz C., Fritzsch G., et al., MITOS: Improved de novo metazoan mitochondrial genome annotation, Mol. Phylogenet. Evol., 2013, 69 (2), 313-319.10.1016/j.ympev.2012.08.023Search in Google Scholar PubMed

[22] Lowe T.M., Eddy S.R., tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence, Nucleic Acids Res., 1997, 25 (5), 955-964.10.1093/nar/25.5.955Search in Google Scholar PubMed PubMed Central

[23] Benson G., Tandem repeats finder: a program to analyze DNA sequences, Nucleic Acids Res., 1999, 27 (2), 573-580.10.1093/nar/27.2.573Search in Google Scholar PubMed PubMed Central

[24] Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S., MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods, Mol. Biol. Evol., 2011, 28 (10), 2731-2739.10.1093/molbev/msr121Search in Google Scholar PubMed PubMed Central

[25] Alfonzo J.D., Soll D., Mitochondrial tRNA import - the challenge to understand has just begun, Biol. Chem., 2009, 390 ( 8), 717-722.10.1515/BC.2009.101Search in Google Scholar PubMed PubMed Central

[26] Friedrich M., Muqim N., Sequence and phylogenetic analysis of the complete mitochondrial genome of the flour beetle Tribolium castanaeum, Mol. Phylogenet. Evol., 2003, 26 (3), 502-512.10.1016/S1055-7903(02)00335-4Search in Google Scholar PubMed

[27] Shao L.L., Huang D.Y., Sun X.Y., Hao J.S., Cheng C.H., Zhang W., Yang Q., Complete mitochondrial genome sequence of Cheirotonus jansoni (Coleoptera: Scarabaeidae), Genet. Mol. Res., 2014, 13 (1), 1047-1058.10.4238/2014.February.20.6Search in Google Scholar PubMed

[28] Hong M.Y., Heoncheon J., Minjee K., Hyunguk J., Sanghyun L., Iksoo K., Complete mitogenome sequence of the jewel beetle, Chrysochroa fulgidissima (Coleoptera: Buprestidae), Mit. DNA, 2009, 20 (2-3), 46-60.10.1080/19401730802644978Search in Google Scholar PubMed

[29] Kim M.J., Wan X., Kim I., Complete mitochondrial genome of the seven-spotted lady beetle, Coccinella septempunctata (Coleoptera: Coccinellidae), Mit. DNA, 2012, 23 (3), 179-181.10.3109/19401736.2012.668901Search in Google Scholar PubMed

[30] Burger G., Gray M. W., Lang B. F., Mitochondrial genomes: anything goes, Trends Genet., 2003, 19 (12), 709-716.10.1016/j.tig.2003.10.012Search in Google Scholar PubMed

[31] Li X., Ogoh K., Ohba N., Liang X., Ohmiya Y., Mitochondrial genomes of two luminous beetles, Rhagophthalmus lufengensis and R. ohbai (Arthropoda, Insecta, Coleoptera), Gene, 2007, 392 (1-2), 196-205.10.1016/j.gene.2006.12.017Search in Google Scholar PubMed

[32] Wan X., Hong M.Y., Liao A., Kim M.I., Kim K.G., Han Y.S., Kim I., Complete mitochondrial genome of a carabid beetle, Damaster mirabilissimus mirabilissim (Coleoptera: Carabidae), Entomol. Res., 2012, 42 (1), 44-54.10.1111/j.1748-5967.2011.00355.xSearch in Google Scholar

[33] Cameron S.L., Whiting M.F., The complete mitochondrial genome of the tobacco hornworm, Manduca sexta, (Insecta: Lepidoptera: Sphingidae), and an examination of mitochondrial gene variability within butterflies and moths, Gene, 2008, 408 (1-2), 112-123.10.1016/j.gene.2007.10.023Search in Google Scholar PubMed

[34] Kim K.G., Hong M.Y., Kim M.J., Im H.H., Kim M.I., Bae C.H., et al., Complete mitochondrial genome sequence of the yellow-spotted long-horned beetle Psacothea hilaris (Coleoptera: Cerambycidae) and phylogenetic analysis among coleopteran insects, Molecules Cells, 2009, 27 (4), 429-441.10.1007/s10059-009-0064-5Search in Google Scholar PubMed

[35] Bae J.S., Kim I., Sohn H.D., Jin B.R., The mitochondrial genome of the firefly, Pyrocoelia rufa: complete DNA sequence, genome organization, and phylogenetic analysis with other insects, Mol. Phylogenet. Evol., 2004, 32 (3), 978-985.10.1016/j.ympev.2004.03.009Search in Google Scholar PubMed

[36] Ojala D., Montoya J., Attardi G., tRNA punctuation model of RNA processing in human mitochondria, Nature, 1981, 290 (5806), 470-474.10.1038/290470a0Search in Google Scholar PubMed

[37] Taanman J.W., The mitochondrial genome: structure, transcription, translation and replication, Biochim. Biophys. Acta, 1999, 1410 (2), 103-123.10.1016/S0005-2728(98)00161-3Search in Google Scholar

[38] Zhang Z., Wang X., Li R., Guo R., Zhang W., Song W., et al., The mitochondrial genome of Dastarcus helophoroides (Coleoptera: Bothrideridae) and related phylogenetic analyses, Gene, 2015, 560 (1), 15-24.10.1016/j.gene.2014.12.026Search in Google Scholar PubMed

[39] Wolstenholme D.R., Animal mitochondrial DNA: structure and evolution, Int. Rev. Cytol., 1992, 141, 173-216.10.1016/S0074-7696(08)62066-5Search in Google Scholar

[40] Zhang D.X., Szymura J.M., Hewitt G.M., Evolution and structural conservation of the control region of insect mitochondrial DNA, J. Mol. Evol., 1995, 40 (4), 382-391.10.1007/BF00164024Search in Google Scholar PubMed

[41] Zhang D.X., Hewitt G.M., Insect mitochondrial control region: A review of its structure, evolution and usefulness in evolutionary studies, Biochem. Systemat. Ecol., 1997, 25, 99-120.10.1016/S0305-1978(96)00042-7Search in Google Scholar

Received: 2016-5-14

Accepted: 2016-9-14

Published Online: 2016-12-15

Published in Print: 2016-1-1

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.