The unusual yin-yang fashion of RIZ1/RIZ2 contributes to the progression of esophageal squamous cell carcinoma

Yuantao Cui; Min Ding; Shangwen Dong; Yuanguo Wang; Peng Zhang

doi:10.1515/biol-2016-0019

Article Open Access

The unusual yin-yang fashion of RIZ1/RIZ2 contributes to the progression of esophageal squamous cell carcinoma

Yuantao Cui , Min Ding , Shangwen Dong , Yuanguo Wang and Peng Zhang

Published/Copyright: August 20, 2016

Published by

Become an author with De Gruyter Brill

Submit Manuscript Author Information Explore this Subject

From the journal Open Life Sciences Volume 11 Issue 1

Abstract

Retinoblastoma protein-interacting zinc finger gene RIZ encodes two different protein products, RIZ1 and RIZ2. Observations suggest that RIZ1 is a tumor suppressor, while RIZ2 acts as a negative regulator of RIZ1 and may play a positive role in oncogenesis. The imbalance amount of RIZ1 and RIZ2 may be involved in cancer development. In this study we detected the expression levels of RIZ1 and RIZ2 mRNA in human esophageal squamous cell carcinoma (ESCC) tissue specimens, reexpressed RIZ1 in the human ESCC cell line EC109 in which RIZ1 mRNA level was not detected, examined the changes of RIZ1 and RIZ2 mRNA expression, investigated the changes of proliferation, and apoptosis of the cells. We found that RIZ1 mRNA expression is commonly decreased or at undetectable level in human esophageal squamous cancer tissue specimens compared to the normal tissue specimens, while RIZ2 is usually expressed. With the forced expression of RIZ1, RIZ2 mRNA expression did not change, The ESCC cell proliferation was inhibited and apoptosis was induced. This unusual yinyang fashion of RIZ1/RIZ2 may contribute to the progression of ESCC.

Keywords: RIZ1; RIZ2; esophageal squamous cell carcinoma; yin-yang fashion

1 Introduction

Retinoblastoma protein-interacting zinc finger gene (RIZ), was initially isolated from a functional screening for retinoblastoma tumor suppressor binding (Rb-binding) genes [1]. RIZ gene maps to human short chromosome band 1p36, a region usually altered in kinds of human cancers [2,3]. It encodes two protein products, RIZ1 and RIZ2, at different lengths, of 280KD and 250KD. They have the same amino acid sequences except that RIZ1 has PR domain while RIZ2 lacks this domain. RIZ1 was proved to be a tumor suppressor gene and the PR domain was considered to be responsible for the tumor suppressing activity. RIZ1 is commonly decreased or at undetectable levels in a broad spectrum of human malignant tumors including those of the breast [4], liver [5], prostate [6], thyroid gland [7] esophagus [8] and so on, and the aberrant methylation of its promoter region serves as an important mechanism. RIZ1 could induce G2-M cell cycle arrest and/or apoptosis [4,5]. RIZ2 was reported to act as a negative regulator of RIZ1 and may play a positive role in oncogenesis [9]. Researches revealed that the imbalance amounts of RIZ1 and RIZ2 as a result of either genetic or epigenetic events is involved in human cancers in an unusual yin-yang fashion [10,11]. However, the role of this RIZ1/RIZ2 unusual yin-yang fashion in ESCC remains unclear. In this study we showed that RIZ1 expression is decreased or lost in human esophageal squamous cancer, whereas RIZ2 expression is uniformly present in all samples examined, including both the esophageal squamous cancer and the normal esophageal tissues. The expression level of the RIZ2 gene mRNA did not change after RIZ1 re-expressed, and this unusual yin-yang fashion of RIZ1/RIZ2 gene may contribute to inhibit the proliferation and induce apoptosis of the ESCC cell, and may be involved in the development of ESCC.

2 Methods

2.1 Tissues and Cell line culture

Carcinoma and corresponding normal tissue (> 5 cm from the edge of tumor) specimens were obtained from 25 patients with ESCC, confirmed by pathological tests in our department. The specimens were frozen in liquid nitrogen immediately after resection and stored at −80°C for further studies. None of the patients in this study had received radiation therapy or chemotherapy before surgery.

Human esophageal squamous carcinoma cell line EC109 was purchased from ATCC (Rockville, MD, USA), incubated in RPMI1640 medium (Gibco-BRL, Carlsbad, CA, USA), supplemented with 10% new-born bovine serum (Gibco-BRL, Carlsbad, CA, USA), 2 mM 1 × L-glutamine, 100 U/ml penicillin and 100 mg/ml streptomycin (Life Technologies, Carlsbad, CA, USA), and maintained at 37°C in a humidified incubator with 5% CO₂.

2.2 MSP

Genomic DNA was extracted from the ESCC cell line EC109 using TIANamp Genomic DNA Kit (TIANGEN, Beijing, PRC) and anultraviolet spectrophotometer was used to detect the purity and the amount. 20 μg gDNA was modified with bisulfite according to the manufacturer’s protocols of EpiTect Fast DNA Bisulfite Kit (Qiagen, Hilden, GER), Methylation specific polymerase chain reaction (MSP) was used to detect the promoter region aberrant methylation of RIZ1 with respectively primers for methylated DNA (forward 5’- GTGGTGGTTATTGGGCGACGGC -3’; reverse 5’- GCTATTTCGCCGACCCCGACG -3’), and unmethylated DNA (forward 5’-TGGTGGTTATTGGGTGATGGT-3’; reverse 5’-ACTATTTCACCAACCCCAAGA-3’), the expected amplified fragments were 177 bp and 175 bp respectively. PCR conditions were as follows: 40 cycles of denaturation at 94°C for 30 seconds, annealing for methylation-specific amplification at 68°C or for unmethylation-specific at 60°C for 45 seconds, amplification at 72°C for 60 seconds, and finally extension at 72°C for 10 min. Agarose gel electrophoresis was used to analyze the PCR products.

2.3 Real time-PCR analysis

EC109 cells were cultured in 6-well plates and treated with 10 μmol/L 5-Aza-CdR (Sigma) for 72 h. The control group was routinely cultured without drugs. Then the cells were harvested for the next studies. Total RNA of the tissues and the cells was isolated with Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocols. Ultraviolet spectrophotometer was used to detect the purity and the amount. Reverse transcribed 2 μg RNA using Reverse Transcriptase M-MLV (Takara Bio, Inc., Shiga, Japan), Ribonuclease inhibitor (Takara Bio, Inc., Shiga, Japan) and dNTP mixture (Takara Bio, Inc., Shiga, Japan), according to the manufacturer’s protocols. The cDNA templates were used in the next RT-PCR. 0.75 μl cDNA was mixed with 5 μl 2 × SYBR Premix ExTaqTM (Takara Bio, Inc., Shiga, Japan). Two different sets of primers were used to amplify the first strand cDNA samples: one set (RP168 + RP217) was for RIZ1; RIZ2 transcripts cannot be differentiated from RIZ, so the other set which represents RIZ gene was (RP216 + RP217) for RIZ1+RIZ2. RP168 primer is located within exon 4 (5’-TGG CTG CGA TAT GTG AAT TG-3’). RP216 primer is located within exon 6 (5’-CAA CTG AAG ACA ACT GAG CCA GA-3’). RP217 primer is located in coding exon 7 (5’-CCT CTG AGC ACT CTT CAA GAGT-3’). The primers for GAPDH (forward 5’-GAAGGTGAAGGTCGGAGTC-3’, reverse 5’-GGGTGGAATCATATTGGAAC -3’) were used for the amplification in a Light Cycler (Roche) RT-PCR System according to the manufacturer’s protocols. An initial denaturation step at 94°C for 5 minutes, followed by 45 cycles of denaturation at 95°C for 5 seconds, annealing at 59°C (RIZ1) and 55°C (RIZ1+RIZ2) for 20 seconds, extension at 72°C for 10 seconds and then the solubility temperature curve assay was performed. The expression level of RIZ1and RIZ1+RIZ2 gene mRNA in normal esophageal tissues was presented as 2^{averageΔΔCT} × 100% compared to carcinoma, and the expression levels of RIZ1 and RIZ1+RIZ2 gene mRNA in EC109 after being treated with 5-Aza-CdR was also presented as 2^{averageΔΔCT} × 100% compared to that in the cells routinely cultured without the drug.

2.4 MTT assay

200 μl (1 × 10⁴/ml) EC109 cells were seeded in 96-wells plates. After 24 h the cells were treated with 5-Aza-CdR at different concentrations of 0, 2, 10, and 20 μmol/L. 5 wells in which the cells were cultured with the medium without the drug were used as control groups. And blank control groups without cells for comparison. After 24 hours, one of the 96-well plates was taken for the next examination: 20 μl MTT solution (5 mg/ml) was added, and the upper clear part was removed. Blank cells were used as zero for calculating the restraining rate of cell proliferation. Restraining rate of cell proliferation = [(comparison group A495 - blank group A495) - (experiment group A495 - blank group A495)]/ (comparison group A495 - blank group A 495) × 100%. The same steps of examination are repeated after 48 h, 72 h.

2.5 Flow cytometry

EC109 cells were seeded at 1 × 10⁶/well in 6-well plates. The cells were treated with 5-Aza-CdR at a concentration of 1 μmol/L for 72 h. Then the cells were harvested, washed twice with cold PBS and then fixed in 70% ethanol overnight, the fixed cells were stained with propidium iodide (50 μg/ml) and RNaseA (100 mg/ml) for 3 h at 37°C in the dark., FACS flow cytometry was used to measure the cell apoptosis. The process was repeated three times. Results were analyzed using ModFit software.

2.6 Statistical analysis

Statistical analysis was performed by SPSS 13.0 statistical software. The data were presented as mean ± standard deviation (SD). The results of Real-time PCR were analyzed by comparison of 2^{averageΔΔCT} × 100%. T-tests were used to analyze the parametric data, and analysis of variance (ANOVA) was used to analyze the continuous variables. p-values of 0.05 or less were considered to indicate statistically significant differences.

3 Results

3.1 Expression of RIZ1 and RIZ2 in ESCC carcinoma and corresponding normal tissue specimens

Real-time PCR analysis was used to examine the mRNA expression levels of RIZ1 and RIZ1 + RIZ2 in 40 pairs ESCC carcinoma and corresponding normal tissue specimens. The results showed that the expression level of RIZ1 mRNA in esophageal carcinoma tissue specimens had reduced while the expression levels of RIZ1 + RIZ2 mRNA in carcinoma and normal esophageal tissue specimens had no statistically significant change (Fig. 1).

Fig.1

The expression levels of RIZ1 (A) and RIZ1 + RIZ2 (B) mRNA in esophageal carcinomas and normal esophageal tissues.

3.2 Methylation status of RIZ1 gene in EC109

Methylation specific PCR (MSP) was used to examine the RIZ1 promoter methylation status in human ESCC cell line EC109. Amplified fragments of 177 bp and 175 bp were expected for methylated (M) and unmethylated (U) DNA respectively. Aberrant promoter region methylation status of RIZ1 gene in EC109 was detected (Fig. 2).

Fig.2

Aberrant promoter region methylation status of RIZ1 gene in ESCC cell line EC109.

3.3 Imbalance amounts of RIZ1 and RIZ2 after the re-expression of RIZ1

EC109 was treated with the DNA methyltransferase inhibitor 5-Aza-CdR. Real-time PCR was used to analyze the expression levels of RIZ1 and RIZ1 + RIZ2 in EC109 cells after being treated with 5-Aza-CdR and that in the cells routinely cultured without the drug. Restored expression of RIZ1 was detected while RIZ1 + RIZ2 mRNA expression level had no statistically significant difference (Fig. 3).

Fig. 3

The expression levels of RIZ1 (A) and RIZ1 + RIZ2 (B) mRNA in EC109 cells after being treated with 5-Aza-CdR compared to that in the cells routinely cultured without the drug.

3.4 The changes of proliferation and induce apoptosis

MTT assay results showed that the proliferation of ESCC cell line EC109 was inhibited after being treated with 5-Aza-CdR. The inhibition was enhanced with the tension of time (F = 562.055, p = 0.000) and the increasing of 5-Aza-CdR concentration (F = 324.998, p = 0.000) (Fig. 4).

Fig. 4

Inhibition Rate Curve of EC109 Cells after treatments with 0.2, 10, 20 μmol/L 5-Aza-CdR for 24, 48, and 72 h.

Flow cytometric analysis showed that the rate of apoptosis in EC109 after being treated with 5-Aza-CdR was higher than the cells routinely cultivated (Fig. 5).

Fig. 5

Flow cytometry analysis of apoptosis in EC109 after being treated with 5-Aza-CdR compared with that routinely cultivated.

4 Discussion

Esophageal cancer (EC) is one of the most common malignant tumors in the digestive system that seriously threatens human health. The incidence and mortality rate in China both rank first in the world and respectively rank the fifth and fourth in all malignant tumor pathological types [12]. Esophageal squamous cell carcinoma (ESCC) and adenocarcinoma account for more than 90% of all the esophageal tumor pathological type [13]. Unlike western countries and the USA, the main pathological type in our country is squamous cell carcinoma [14]. ESCC usually has a long asymptomatic latency period in its early stage, most of the patients have been in middle-late stage when they come to the hospital. ESCC is easy to recurrence and metastasis in postoperative patients because of the lack of indicators with high sensitivity and specificity, so the treatment efficacy remains unsatisfactory. We need to explore new insights into the molecular mechanisms of tumorigenesis and progression. Several lines of observation indicated that RIZ1 and RIZ2 regulate cell division and function in an unusual yin-yang fashion, and this unusual yin-yang fashion of RIZ1/RIZ2 was involved in tumorigenesis and progression [10,11,15-17]. In this study we hypothesized that the unusual yin-yang fashion of RIZ1/RIZ2 may contribute to the progression of ESCC.

Tumorigenesis and progression of ESCC involve multiple factors, multiple genes, and multi-stage progress [18,19]. Mutations or alterations in proto-oncogenes or tumor suppressor genes are usually linked to the progress. The mechanism involves genetics and epigenetics [20]. Promoter region aberrant methylation is an important epigenetic change in suppressor gene deletion. It usually takes place in the so-called CpG island, which is rich of cytosine and guanylic acid. Genes with inactivation due to high promoter region methylation are very sensitive to DNA methylation inhibitors and can be reversible [21]. RIZ1 was proved to be a tumor suppressor gene in ESCC in our previous studies, whereby RIZ1 was lowly expressed or deleted in ESCC tumor tissues and cell lines. Promoter region aberrant methylation serves as an important role [8,22]. In this paper Real-time PCR was used to examine both the expression levels of RIZ1 and RIZ1 + RIZ2 mRNA in ESCC carcinoma and corresponding normal tissue specimens. RIZ2 is generated by an internal promoter and RIZ2 transcripts cannot be differentiated from RIZ1. We use RIZI + RIZ2 represents PCR products derived from the overlapped sequences. The results suggested that RIZ1 was decreased (t = -57.738, p = 0.000) while RIZ2 was uniformly present in ESCC carcinoma (t = -1.180, p = 0.249) compared with the corresponding normal tissue specimens. Promoter region high methylation status serves as an important mechanism in RIZ1 down regulation or deletion [8,22]. In this study RIZ1 promoter region aberrant methylation was detected by MSP in ESCC cell line EC109. When EC109 was treated with DNA methyltransferase inhibitor 5-Aza-CdR, we found that RIZ1 was restored (p = 0.000) while the level of RIZ1 + RIZ2 mRNA expression did not change (p = 0.673). This phenomenon revealed that the imbalance amounts of RIZ1 and RIZ2 may be involved in esophageal squamous cell carcinoma. With the change of imbalance amounts of RIZ1 and RIZ2, MTT analysis revealed that the cell proliferation was inhibited in a time-dependent manner. Flow cytometric analysis revealed that cell apoptosis was induced. This unusual yin-yang fashion of RIZ1/RIZ2 may reveal an important underlying mechanism in ESCC tumorigenesis and progression. It may represent a potential target of novel therapeutic strategies and medication design. However, whether RIZ2 works as a negative factor of RIZ1, and how to regulate the RIZ1 tumor suppressing activity, need further study.

Acknowledgements

This study was supported by the National Natural Science Foundation of China (grant no. 81201945), the Science Foundation of Tianjin Medical University (grant no. 2014KYM02).

Conflict of interest: Authors declare nothing to disclose.

References

[1] Buyse I.M., Shao G., Huang S., The retinoblastoma protein binds to RIZ, a zinc-finger protein that shares an epitope with the adenovirus E1A protein, Proc. Natl. Acad. Sci. USA, 1995, 92, 4467-4471.10.1073/pnas.92.10.4467Search in Google Scholar

[2] Buyse I.M., Takahashi E.I., Huang S., Physical mapping of the retinoblastoma interacting zinc finger gene RIZ to D1S228 on chromosome 1p36, Genomics, 1996, 34, 119-121.10.1006/geno.1996.0249Search in Google Scholar

[3] Dave B.J., Hess M.M., Pickering D.L., Zaleski D.H., Pfeifer A.L., Rearrangements of chromosome band 1p36 in non-Hodgkin’s lymphoma, Clin. Cancer Res., 1999, 5, 1401-1409.Search in Google Scholar

[4] He L., Yu J.X., Liu L., Buyse I.M., Wang M.S., Yang Q.C., et al., RIZ1, but not the alternative RIZ2 product of the same gene, is underexpressed in breast cancer, and forced RIZ1 expression causes G2-M cell cycle arrest and/or apoptosis, Cancer Res., 1998, 58, 4238-4244.Search in Google Scholar

[5] Jiang G.L., Liu L., Buyse I.M., Simon D., Huang S., Decreased RIZ1 expression but not RIZ2 in hepatoma and suppression of hepatoma tumorigenicity by RIZ1, Int. J. Cancer, 1999, 83, 541–546.10.1002/(SICI)1097-0215(19991112)83:4<541::AID-IJC17>3.0.CO;2-FSearch in Google Scholar

[6] Hasegawa Y., Matsubara A., Teishima J., Seki M., Mita K., Usui T., et al., DNA methylation of the RIZ1 gene is associated with nuclear accumulation of p53 in prostate cancer, Cancer Sci., 2007, 98, 32-36.10.1111/j.1349-7006.2006.00338.xSearch in Google Scholar

[7] Lal G., Padmanabha L., Smith B.J., Nicholson R.M., Howe J.R., O’Dorisio M.S., et al., RIZ1 is epigenetically inactivated by promoter hypermethylation in thyroid carcinoma, Cancer, 2006, 107, 2752-2759.10.1002/cncr.22325Search in Google Scholar

[8] Dong S.W., Cui Y.T., Zhong R.R., Liang D.C., Liu Y.M., Wang Y.G., et al., Decreased expression of retinoblastoma proteininteracting zinc-finger gene 1 in human esophageal squamous cell cancer by DNA methylation, Clin. Lab., 2012, 58, 41-51.Search in Google Scholar

[9] Abbondanza C., De Rosa C., D’Arcangelo A., Pacifico M., Spizuoco C., Piluso G., et al., Identification of a functional estrogen-responsive enhancer element in the promoter 2 of PRDM2 gene in breast cancer cell lines, J. Cell Physiol., 2012, 227, 964-975.10.1002/jcp.22803Search in Google Scholar

[10] Liu L., Shao G., Steele-Perkins G., Huang S., The retinoblastoma interacting zinc finger gene RIZ produces a PR domain-lacking product through an internal promoter, J. Biol. Chem., 1997, 272, 2984-2991.10.1074/jbc.272.5.2984Search in Google Scholar

[11] Jiang G.L., Huang S., The yin-yang of PR-domain family genes in tumorigenesis, Histol. Histopathol., 2000, 15, 109-117.Search in Google Scholar

[12] Zeng H., Zheng R., Zhang S., Esophageal cancer statistics in China, 2011: Estimates based on 177 cancer registries, Thoracic Cancer, 2016, 7, 232-237.10.1111/1759-7714.12322Search in Google Scholar

[13] Enzinger PC., Mayer RJ., Esophageal cancer, N. Engl. J. Med., 2003, 349, 2241-2252.10.1056/NEJMra035010Search in Google Scholar

[14] Jemal A., Bray F., Center M.M., Ferlay J., Ward E., Forman D., Global cancer statistics, CA Cancer J. Clin., 2011, 61, 69-90.10.3322/caac.20107Search in Google Scholar

[15] Huang S., Shao G., Liu L., The PR domain of the Rb-binding zinc finger protein RIZ1 is a protein binding interface and is related to the SET domain functioning in chromatin-mediated gene expression, J. Biol. Chem., 1998, 273, 15933-15939.10.1074/jbc.273.26.15933Search in Google Scholar PubMed

[16] Du Y., Carling T., Fang W., Piao Z., Sheu J.C., Huang S., Hypermethylation in human cancers of the RIZ1 tumor suppressor gene, a member of a histone/protein methyl-transferase superfamily, Cancer Res, 2001, 61, 8094-8099.Search in Google Scholar

[17] Deng Q., Huang S., PRDM5 is silenced in human cancers and has growth suppressive activities, Oncogene, 2004, 17, 4903-4910.10.1038/sj.onc.1207615Search in Google Scholar PubMed

[18] An J.Y., Fan Z.M., Gao S.S., Zhuang Z.H., Qin Y.R., Li J.L., et al., Loss of heterozygosity in multi-stage carcinogenesis of esophageal carcinoma at high-incidence area in Henan Province, China, World J. Gastroenterol., 2005, 11, 2055-2060.10.3748/wjg.v11.i14.2055Search in Google Scholar PubMed PubMed Central

[19] Guo X.Q., Wang S.J., Zhang L.W., Wang X.L., Zhang J.H., Guo W., DNA methylation and loss of protein expression in esophageal squamous cellcarcinogenesis of high-risk area, J. Exp. Clin. Cancer Res., 2007, 26, 587-594.Search in Google Scholar

[20] Ooi S.K., Bestor T.H., The colorful history of active DNA Demethylation, Cell, 2008, 133, 1145-1148.10.1016/j.cell.2008.06.009Search in Google Scholar PubMed

[21] Long HK., Blackledge N.P., Klose R.J., ZF-CxxC domain-containing proteins, CpG islands and the chromatin connection, Biochem. Soc. Trans., 2013, 41, 727-740.10.1042/BST20130028Search in Google Scholar PubMed PubMed Central

[22] Dong S.W., Zhang P., Liu Y.M., Cui Y.T., Wang S., Liang S.J., He Z et al., Study on RIZ1 gene promoter methylation status in human esophageal squamous cell carcinoma, World J. Gastroenterol., 2012, 18, 576-582.10.3748/wjg.v18.i6.576Search in Google Scholar PubMed PubMed Central

Received: 2016-5-31

Accepted: 2016-7-10

Published Online: 2016-8-20

Published in Print: 2016-1-1

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.