Home Cross transferability of barley nuclear SSRs to pearl millet genome provides new molecular tools for genetic analyses and marker assisted selection
Article Open Access

Cross transferability of barley nuclear SSRs to pearl millet genome provides new molecular tools for genetic analyses and marker assisted selection

  • Mériam Ben Romdhane EMAIL logo , Leila Riahi , Raghda Yazidi , Ahmed Mliki and Nejia Zoghlami
Published/Copyright: September 1, 2022
Download Article (PDF)
Open Agriculture
From the journal Open Agriculture Volume 7 Issue 1

Abstract

Pearl millet (Pennisetum glaucum (L.) R. Br.) is a valuable agronomic and industrial promising crop with high adaptation potentials considered as understudied species and is not attributed the interest it deserves. This investigation reports for the first time the transferability of barley nuclear microsatellites to pearl millet genome. This allowed the inference of the considerable potential of transferability of the nuclear simple sequence repeats (nSSRs) mapped from Hordeum vulgare L. genome to P. glaucum species. Out of the 42 tested SSRs, ten were found to be transferable, giving a transferability rate of 23.8%. These latter markers enabled the molecular characterization of the nine barley and nine pearl millet autochthonous landraces and revealed high levels of polymorphism and discriminatory powers. All the microsatellites were proved to be highly informative with an average polymorphic information content value of 0.74. The gene diversity index revealed a high level of diversity encompassed in both germplams with a mean H e value of 0.80. At the species level, comparable amounts of genetic variability were detected for H. vulgare and P. glaucum landraces. Furthermore, the set of ten transferable nSSRs exhibited high ability in revealing the genetic structure, differentiation and phylogenetic relationships among the studied germplasms. The new available nSSRs present an additional informative and discriminant set of molecular markers which will be useful in further genetic studies concerning the multipurpose species P. glaucum L. such as molecular fingerprinting, genetic purity assessment, genome mapping, marker-assisted breeding and conservation programs.

Keywords: Hordeum vulgare L.; Pennisetum glaucum L.; landraces; nSSR; transferability; genetic analyses

1 Introduction

Pearl millet (Pennisetum glaucum (L.) R. Br., 2n = 2x = 14, Poaceae) is a staple crop cultivated mainly in arid and semi-arid regions of the West and Central Africa and South Asia but also cropped in the Americas and Australia [1]. Pearl millet is recognized for its high drought, heat and soil salinity tolerance when other cereals failed to survive in such harsh conditions [2]. This species serves for millions of poor people as food, fodder and fuel [3]. It is the sixth most important world cereal characterized by high nutritional values with a superior protein contents than other major cereals and considered as a food security crop for more than 500 million of the world’s poorest and nutritionally insecure people [4,5]. Pearl millet grains are gluten-free with a low glycemic index and rich dietary fibres which promote its use in human functional foods [6].

Furthermore, pearl millet is recently considered as an industrial crop used for alcohol extraction [7,8], in bone tissue engineering [9] and as a source of cellulosic fluff [10]. Recent scientific reports pointed out P. glaucum as a reservoir of health promoting compounds, which has high potentials in pharmaceutical, nutraceutical and cosmetic industries [11–13].

Despite its interest and high adaptation potential, pearl millet is considered as an understudied species referred to as orphan crop as its genetic improvement and conservation is lagging behind other major cereals [2,14]. The local genetic resources of pearl millet in its distribution area are mainly represented by scattered landrace populations which are facing negligence and threats of severe climatic changes and genetic erosion [15].

The last few decades have increasingly seen the advent of molecular tools in investigating plant cereal crops for their characterization, improvement and conservation. Several DNA-based markers have been developed, and among them simple sequence repeats (SSR) have been proven to be a suitable molecular tool for genetic diversity assessment [16], marker-assisted selection of interesting traits [17,18], genome mapping [19] and development of conservation strategies [20]. Nuclear microsatellites owed their success to their genome wide coverage, high reproducibility, high polymorphism, codominance inheritance and high transferability rates [21].

Compared to other major cereal crops, the available SSR molecular marker technologies for pearl millet are still limited [15]. The development of microsatellite markers for plant species remains highly expensive, as it requires the creation and the screening of enriched libraries, the sequencing of many clones and the testing of various primer pairs [22]. Despite the complexity of the aforementioned steps, the efficiency of developed microsatellites was reported to not exceed 30%; this can be avoided when SSRs across species/genera transferability is properly applied [23].

The conservation of microsatellite loci within related genera has been widely described [24,25]. This kind of interspecific markers’ transferability could pave the way to the inference of genetic information for poorly investigated related species, therefore facilitating their genomic selection and improvement face to the emerging abiotic stresses [26]. For cereals, numerous flanking sequences of microsatellite loci have sufficient homology to allow cross-amplification among the genera. Thus, SSRs mapped from major cereal genomes mainly corn, rice, wheat, barley and sorghum are frequently used in closely related species [23].

Based on the last considerations, the main objectives of this study are to assess for the first time the transferability of a set of nuclear microsatellite markers developed from Hordeum vulgare genome to P. glaucum and to evaluate the levels of their molecular polymorphism and discriminatory power among a sample of barley and pearl millet landraces. Furthermore, the efficiency of the detected transferable nuclear SSR (nSSR) markers to assess the genetic structure and phylogenetic analyses among germplasms of both species was carried out. The detected transferable set of nSSR markers will be of great interest as a new molecular tool which could be exploited in pearl millet genetic and breeding investigations especially in the development of new varieties with high adaptation potentials to various abiotic stresses.

2 Materials and methods

2.1 Plant material

The transferability of a set of nSSR molecular markers from barley to pearl millet genomes along with their discriminatory potential and efficiency in genetic analyses were assessed using nine local landraces from each species. The seeds of the selected accessions were collected from various bioclimatic zones of Tunisia. These genotypes are representative of the geographical distribution of the existing germplasms of local barley and pearl millet in Tunisia. The characteristics of the studied accessions are listed in Table 1.

Table 1

List and characteristics of the studied landraces tested for nSSR markers transferability among H. vulgare and P. glaucum genomes

Species Accession Code Location Sampling region Bioclimatic zone
P. glaucum Weslatia 1 Kairouan Centre East Arid superior
P. glaucum Marg Ellil 2 Kairouan Centre East Arid superior
P. glaucum Zaafrana 3 Kairouan Centre East Arid superior
P. glaucum Rejiche 4 Mahdia Centre East Semi-arid
P. glaucum Haouaria 5 Haouaria North East Sub-humid
P. glaucum Hammem Jebli 6 Kelibia North East Sub-humid
P. glaucum Hammem Laghzez 7 Kelibia North East Sub-humid
P. glaucum Jorf 8 Jorf South East Arid inferior
P. glaucum Boughrara 9 Jorf South East Arid inferior
H. vulgare Touiref 10 Kef North West Sub-humid
H. vulgare Massouj 11 Siliana North West Semi-arid
H. vulgare Gabes 12 Gabes South East Arid inferior
H. vulgare Gerjis 13 Medenine South East Arid inferior
H. vulgare Gallala 14 Medenine South East Arid inferior
H. vulgare Bir Mcherga 15 Zaghouan North East Semi-arid
H. vulgare Sidi Alouane 16 Mahdia Centre East Semi-arid
H. vulgare Hencha 17 Sfax South East Arid superior
H. vulgare Dehmani 18 Kef North West Semi-arid

2.2 DNA extraction and molecular analyses

Genomic DNA of nine H. vulgare and nine P. glaucum landraces was extracted from leaf samples of 2-week-old seedlings applying the cetyltrimethylammonium bromide method [27] with some modifications [28]. A set of 42 nuclear microsatellite markers [29–32] representing the whole barley genome with at least five loci from each linkage group was screened for transferability to P. glaucum L. (Table 2). Five primers among them were identified earlier as a referral SSR set in fingerprinting and the assessment of genetic purity of F1 barley hybrids and their salt tolerant/sensitive parental lines [33]. DNA amplifications were conducted as described by Macaulay et al. [34]. Polymerase chain reaction products were analysed in 3% agarose gels using 100 bp DNA ladder.

Table 2

List and characteristics of barley nSSRs markers tested for transferability into pearl millet landraces

No. SSR name Motif LG Sequence 5′–3′ Source
1 Bmac0032 (AC)7T(CA)15(AT)9 1H CCATCAAAGTCCGGCTAG [31]
GTCGGGCCTCATACTGAC
2 Bmac0154* (AT)19(AC)6 1H CTGGGTGATGAATAGAGTTTC [31]
TATTCTTCAAAAGATGTTCTGC
3 Bmag0211 (CT)16 1H ATTCATCGATCTTGTATTAGTCC [31]
ACATCATGTCGATCAAAGC
4 WMC1E8* (AC)24 1H TCATTCGTTGCAGATACACCAC [30]
TCAATGCCCTTGTTTCTGACCT
5 HVM54 (GA)14 2H AACCCAGTAACACCGTCCTG [30]
AGTTCCCTGACCCGATGTC
6 Bmac0222 (AC)23 2H ATTTGAATGTCCAACAGAATC [31]
GGGACTAAAGCCCCTTAC
7 EBmac0415 (AC)17 2H GAAACCCATCATAGCAGC [32]
AAACAGCAGCAAGAGGAG
8 Bmac0134* (AC)28 2H CCAACTGAGTCGATCTCG [31]
CTTCGTTGCTTCTCTACCTT
9 Bmac0093 (AC)24 2H CGT TTG GGA CGT ATC AAT [31]
GGG AGTCTTGAGCCTACTG
10 HVM36 (GA)13 2H TCCAGCCGACAATTTCTTG [30]
AGTACTCCGACACCACGTCC
11 HVM62 (GA)11 3H TCGCGACCAGACGAGAAG [30]
AGCTAGCCGACGACGCAC
12 HVM33* (CA)7 3H ATATTAAAAAAGGTGGAAAGCC [30]
CACGCCCTCTCCCTAGAT
13 Bmac0209 (AC)13 3H CTAGCAACTTCCCAACCGAC [31]
ATGCCTGTGTGTGGACCAT
14 Bmac0136 AG)6(AG)10(AG)6 3H GTACGCTTTCAAACCTGG [31]
GTAGGAGGAAGAATAAGGAGG
15 Bmag0225 (AG)26 3H AACACACCAAAAATATTACATCA [31]
CGAGTAGTTCCCATGTGAC
16 Bmac0067 (AC)18 3H AACGTACGAGCTCTTTTTCTA [31]
ATGCCAACTGCTTGTTTAG
17 Bmag0013* (CT)21 3H AAGGGGAATCAAAATGGGAG [31]
TCGAATAGGTCTCCGAAGAAA
18 HVM09 (TCT)5 3H CTTCGACACCATCACCCAG [29]
ACCAAAATCGCATCGAACAT
19 HVM67 (GA)11 4H GTCGGGCTCCATTGCTCT [30]
CCGGTACCCAGTGACGAC
20 HVM40 (GA)6-(GT)4(GA)7 4H CGATTCCCCTTTTCCCAC [30]
ATTCTCCGCCGTCCACTC
21 EBmac0701 (AC)23 4H ATGATGAGAACTCTTCACCC [31]
TGGCACTAAAGCAAAAGAC
22 Bmag0353 (AG)21 4H ACTAGTACCCACTATGCACGA [31]
ACGTTCATTAAAATCACAACTG
23 Bmag0384 (AG)18 4H TGTGAGTAGTTCACCATAGACC [31]
TGCCATTATCATTGTATTGAA
24 HVMLO3 (CTT)6 4H CTTCCATGTCACCTACAG [31]
CGAACTGGTATTCCAAGG
25 HVM03 (AT)29 4H ACACCTTCCCAGGACAATCCATTG [29]
AGCACGCAGAGCACCGAAAAAGTC
26 Bmag0223 (AG)16 5H TTAGTCACCCTCAACGGT [31]
CCCCTAACTGCTGTGATG
27 Bmac0113* (AT)7(AC)18 5H TCAAAAGCCGGTCTAATGCT [31]
GTGCAAAGAAAATGCACAGATAG
28 Bmac0684 (TA)7(TG)11(TG)11(TTTG)5 5H TTCCGTTGAGCTTTCATACAC [31]
ATTGAATCCCAACAGACACAA
29 EBmac0970* (AC)8 5H ACATGTGATACCAAGGCAC [31]
TGCATAGATGATGTGCTTG
30 HVM07 (CA)10(GA)10 5H ATGTAGCGGAAAAAATACCATCAT [29]
CCTAGCTAGTTCGTGAGCTACCTC
31 Bmac0018 (AC)11 6H GTCCTTTACGCATGAACCGT [31]
ACATACGCCAGACTCGTGTG
32 Bmac0040* (AC)20 6H AGCCCGATCAGATTTACG [31]
TTCTCCCTTTGGTCCTTG
33 Bmac0218 (AC)14 6H ATTGCATTGATTAACTCCTACA [32]
GGGGGAATCTTTGTGTAAG
34 Bmac0316 (AC)19 6H ATGGTAGAGGTCCCAACTG [31]
ATCACTGCTGTGCCTAGC
35 Bmag0009 (AG)13 6H AAGTGAAGCAAGCAAACAAACA [31]
ATCCTTCCATATTTTGATTAGGCA
36 HVM11 (GGA)3(GGA)(GGA)2 6H CCGGTCGGTGCAGAAGAG [29]
AAATGAAAGCTAAATGGCGATAT
37 Bmac 0156* (AC)22(AT)5 7H AACCGAATGTATTCCTCTGTA [31]
GCCAAACAACTATCGTGTAC
38 Bmag0007* (AG)16(AC)16 7H TGAAGGAAGAATAAACAACCAACA [31]
TCCCCTATTATAGTGACGGTGTG
39 Bmag120 (AG)15 7H ATTTCATCCCAAAGGAGAC [31]
GTCACATAGACAGTTGTCTTCC
40 HVM05 (GT)6(AT)16 7H AACGACGTCGCCACACAC [30]
AGGAACGAAGGGAGTATTAAGCAG
41 HVM04 (AT)9 7H AGAGCAACTACCAGTCCAATGGCA [30]
GTCGAAGGAGAAGCGGCCCTGGTA
42 Bmac0273 (AC)20(AG)20 7H ACAAAGCTCGTGGTACGT [31]
AGGGAGTATTTCACCCTTG

LG – linkage groups; *SSRs used earlier in testing the genetic purity of F1 barley hybrids of salt susceptible/tolerant parental lines [33].

2.3 Banding scoring and data analysis

Among the SSR banding patterns, only distinct and unique amplified fragments were converted into genotype/locus matrix. In order to evaluate the efficiency of the tested microsatellites, the number of detected alleles per locus (A n), the number of effective alleles (A e), the gene diversity (H e) and the observed heterozygosity (H o) were calculated using the software POPGENE 1.32 [35]. The number of private alleles (A p) and the number of genotypes (G n) were determined from the data matrix using Excel. The probabilities of identity (PI) per locus [36] were determined using the software Identity 4.0 [37]. Cervus 3.0 [38] was applied to calculate the polymorphic information content (PIC) of the tested SSR loci. The visualization of the genetic structure and phylogenetic relationships among barley and pearl millet landraces was performed using the software DARwin v5 based on factorial analysis and Neighbour-Joining tree constructed using the generated genetic dissimilarity matrix [39]. The amount of genetic differentiation among the two investigated germplasms was estimated using pairwise Fst values determined according to Weir and Cockerham [40] using the software GENEPOP [41].

3 Results and discussion

3.1 Transferability of nSSRs from barley to pearl millet genome

The obtained results showed that out of the 42 tested SSRs, 15 were able to generate cross-species amplifications. Among them, ten transferable primers were retained in this analysis for their consistency in detecting polymorphism in both species. These primers were exclusively of HVM type [30] and were found to consist of di and tri-nucleotide SSR motifs. The tri- and di-metric repeats were reported to be the most abundant microsatellite motifs in barley [42] and pearl millet [43] genomes. The banding patterns of two markers HVM54 and HVM03 are shown in Figure 1.

Figure 1 Banding pattern of the nSSR loci HVM54 and HVM03 for two barley (B1 and B2) and four pearl millet (PM1, PM2, PM3 and PM4) accessions testifying the microsatellite transferability across the H. vulgare and P. glaucum genomes. M – 100 bp DNA ladder.
Figure 1

Banding pattern of the nSSR loci HVM54 and HVM03 for two barley (B1 and B2) and four pearl millet (PM1, PM2, PM3 and PM4) accessions testifying the microsatellite transferability across the H. vulgare and P. glaucum genomes. M – 100 bp DNA ladder.

The detection of ten transferable loci across barley and pearl millet landraces among the 42 tested SSRs resulted in a transferability rate of 23.8%. The observed transferability rate of nSSR molecular markers from barley to pearl miller was higher than those previously reported for EST-SSR transferability from wheat, rye, tef and rice to pearl millet, 0, 7.69, 14.81, and 18.33%, respectively [44]. However, higher EST-SSR markers transferability percentages were recorded from barley to wheat (78.2%), rye (75.2%) and rice (42.4%) [22]. Generally EST-SSRs showed higher transferability potentials among related species than SSR markers developed from genomic DNA which is explained by the fact that coding genome regions are more conserved than non-coding genomic DNA [45]. However, the cross-species transferability of nuclear microsatellites depends also on the phylogenetic links among the analysed species. Indeed, it has been shown that SSRs mapped from barley genome displayed more homology across Secale cereale L. and Triticum aestivum L. belonging to Triticeae tribe, just like barley, than the other examined cereals [22].

The transferability of barley molecular markers to other cereal crops can have various applications especially comparative mapping investigations among these species. According to Yadav et al. [44], when genomic regions are conserved, the map location of a sequence in major species can be employed in predicting the location of the sequence in other related crops. In the present investigation, HVM33 one of the five markers identified earlier by Ben Romdhane et al. [33] as the most efficient in testing the genetic purity of F1 barley hybrids and its salt tolerant/sensitive parental lines was found to be also transferable in pearl millet. This locus could be useful in further marker-assisted selection applications in both species for salinity tolerance.

3.2 Efficiency of transferable SSRs in describing genetic diversity of barley and pearl millet landraces

The efficiency of the ten detected transferable nSSR markers in the characterization of genetic diversity of the investigated barley and pearl millet landraces was assessed using several statistical parameters. All used markers were shown to be polymorphic in the analysed samples. Overall, for the 18 accessions, a total of 69 alleles were obtained with an average of 6.9 alleles per locus (Table 3). The loci HVM54, HVM03, HVM09 and HVM05 generated the highest number of alleles (8) while the lowest number of alleles (5) was detected for the locus HVM36. Lower detected allele number (7) was reported for the locus HVM54 when applied on 64 accessions of Brazilian wild and cultivated barley [16]. Moreover, higher detected number of alleles were recorded in this study for the loci HVM33, HVM40, HVM09 and HVM11 compared to that previously reported for these loci when they were used for the characterization of 26 cultivars and local varieties from Tunisia [46]. This result could probably be attributed to the wild nature of landraces which exhibited higher molecular polymorphism than cultivated germplasms which give them a renewed interest in modern plant breeding to ensure a sustainable agriculture face to the emerging abiotic and biotic stresses [47].

Table 3

Characterization of the ten transferable microsatellite markers across H. vulgare and P. glaucum Tunisian landraces

Locus A n A e G n H e H o PIC PI
HVM54 8 5.40 8 0.83 0.72 0.79 0.05
HVM33 6 2.95 5 0.67 0.83 0.59 0.17
HVM40 6 3.26 5 0.71 0.05 0.64 0.14
HVM03 8 5.31 8 0.83 0.27 0.78 0.06
HVM09 8 4.35 7 0.79 0.61 0.74 0.08
HVM07 7 6.29 7 0.86 0.38 0.82 0.04
HVM11 7 5.18 7 0.83 0.38 0.78 0.06
HVM36 5 4.41 6 0.79 0.05 0.73 0.09
HVM05 8 6.17 8 0.86 0.16 0.81 0.04
HVM04 6 4.95 7 0.82 0.16 0.76 0.07
Means 6.9 4.82 6.8 0.80 0.36 0.74 5.83 × 10−12

A n – Number of alleles; A e – effective number of alleles; G n – number of genotypes; H e – expected heterozygosity; H o – observed heterozygosity; PIC and PI – calculated by pooling all the accessions into one group.

The number of effective alleles ranged from 2.95 (HVM33) to 6.29 (HVM07) with a mean value of 4.82 efficient alleles per locus. Moreover, allelic combinations resulted in the generation of 68 genotypes, with an average of 6.8 genotypes per locus. The primer pairs HVM54, HVM03 and HVM05 generated the highest number of genotypes (8), whereas HVM33 and HVM40 generated the lowest number (5). The gene diversity index (H e) of the studied loci varied from 0.67 (HVM33) to 0.86 (HVM05 and HVM07) with an expected heterozygosity mean value of 0.80. Conversely, lower level of observed heterozygosity (H o) was recorded for the major part of the tested microsatellite loci. The highest H o value was registered for the locus HVM33 (0.83), while the lowest value was obtained using HVM36 and HVM40 (0.05). A H o mean value of 0.36 was recorded across the total genotyped sample.

The detected low amounts of observed heterozygosity for the studied loci may be explained by the inbreeding mating system of barley species for which the outcrossing rate was reported to not exceed 0.60% [48]. The reported level of observed heterozygosity for Tunisian barley landraces was about 0.12 [20] which is comparable to H o values reported for other African germplasms of barley from Ethiopia [49] and Morocco [50].

In order to assess the ability of the ten transferable nSSR loci to discriminate between the studied genotypes their PIC and PI were calculated (Table 3). According to our findings, all the nuclear microsatellites have proved to be informative with an average PIC value of 0.74. The highest PIC value was recorded for the marker HVM07 (0.82) while the lowest value was obtained for the locus HVM33 (0.59). These results were confirmed by low PI values for all the studied loci ranging from 0.04 (HVM05) to 0.17 (HVM33). The cumulative probability of obtaining identical genotypes from the studied accessions calculated across the ten SSR loci was 5.83 × 10−12. High PIC values and low PI levels outlined the high discriminatory power of these applied nSSR and their considerable molecular polymorphism [33].

The ten transferable nSSR previously described and characterized were applied to evaluate the genetic diversity of barley and pearl millet germplasms separately (Table 4). The obtained results highlighted comparable levels for the main determined genetic diversity indexes among barley and pearl millet landraces. Among the 69 yielded alleles, 38 alleles (A n) were detected in barley while 36 alleles were observed in pearl millet landraces despite the implementation of specific H. vulgare markers for the genotyping of the P. glaucum gene pool.

Table 4

Variation of the genetic diversity parameters among the two investigated germplasms of barley and pearl millet

Species Size A n A p MNA A e H o H e
P. glaucum L. 9 36 32 3.6 2.65 0.37 0.62
H. vulgare L. 9 38 34 3.8 2.70 0.36 0.63

A n – Allele number; A p – private allele number; MNA – mean number of alleles per locus; A e – effective allele number per locus; H o – observed heterozygosity; H e – expected heterozygosity.

Private alleles were considered as more determining in deciphering the genetic polymorphism of the studied genotypes. For barley, among the 38 detected alleles, 34 were shown specific to this species. For pearl millet, we found 32 private alleles amongst the 36 generated ones. This finding revealed that the barley developed microsatellites are not only transferable to pearl millet, but they also provide a relevant picture of molecular polymorphism in P. glaucum species. This outcome was corroborated by a comparable effective allele number per locus (A e) for barley (2.70) and pearl millet (2.65) accessions. The observed heterozygosity estimated at species level displayed well comparable values for pearl millet (0.37) and barley (0.36). Likewise, barley germplasm highlighted a gene diversity index (H e = 0.63) comparable to pearl millet landraces (H e = 0.62).

The detected genetic diversity indexes recorded for the nine barley landraces are considered high compared to that reported for the same species in other regions of the world. A lower genetic diversity (H e) values were reported for the Tibetan wild barley (0.12) and for the wild barley from the Middle East (0.11) [42]. A comparable level of genetic diversity index H e (0.65) was reported when a large collection of 384 Ethiopian barley genotypes was characterized [51]. However, lower gene diversity (0.55) was reported for a panel of 144 barley genotypes consisting mainly of landraces from various regions of the world [52].

Concerning the nine investigated genotypes of pearl millet, the obtained results showed a considerable genetic diversity level compared to previous reports. Comparable averages of alleles number per SSR marker (3.72) and of heterozygosity H e (0.61) were recorded when 86 landrace populations of pearl millet grown in Burkina Faso were analysed [53]. The obtained H e amount for pearl millet landraces in this study is higher than that recorded for pearl millet landraces from the Lake Chad Basin (H e = 0.5) [54], from Niger (H e = 0.49) [55] and from Benin (H e = 0.40) [56].

On the other hand, a heterozygosity deficit for pearl miller landraces as observed in this study has been reported by other previous investigations. Thus, lower observed heterozygosity (H o = 0.44) than the expected heterozygosity (H e = 0.54) was also highlighted by Diack et al. [57] for pearl millet originated from Senegal. However, this pattern was not observed for 114 accessions of pearl millet originated from Benin for which comparable levels of observed and expected heterozygosity were found [56]. Generally, pearl millet germplasms exhibited high genetic diversity levels explained by a high outcrossing rate reaching 75% and a considerable gene flow [55]. However, a considerable variation in the amount of observed heterozygosity was revealed for pearl millet germplasms among the various analysed geographical areas of the studied samples. The observed genetic polymorphism increases in the regions forming the zones of primary and secondary domestication events.

Based on the obtained results in this study, the set of transferable SSRs from barley to pearl millet genomes showed an untapped potential in the discrimination and analysis of genetic diversity of pearl millet landraces. It forms a promising molecular tool which could be used in further genetic studies concerning the species pearl millet.

3.3 Genetic structure, differentiation and phylogenetic relationships analyses

In order to apprehend the genetic structure pattern and phylogenetic relationships among H. vulgare and P. glaucum landraces, a factorial analysis and UnWeighted Neighbour-Joining tree were implemented based on the ten transferable nSSR molecular markers. The factorial analysis highlighted a clear genetic structure and separation of barley and pearl millet accessions into two distant groups (Figure 2). The plot showed that pearl millet accessions were agglomerated (A) while barley genotypes (B) were broadly distributed. The UnWeighted Neighbour-Joining clustering analysis confirmed FA analysis (Figure 3) and showed a strong genetic structure of the studied accessions which was ‘species-dependent’. Indeed, two groups were clearly defined: group A including pearl millet accessions and group B containing barley genotypes. These findings were confirmed by high significant genetic differentiation value (Fst = 0.32, P-value <0.001).

Figure 2 Factorial analysis based on the ten transferable nSSRs: pearl millet accessions (red), barley accessions (black), landrace names according to codes listed in Table 1.
Figure 2

Factorial analysis based on the ten transferable nSSRs: pearl millet accessions (red), barley accessions (black), landrace names according to codes listed in Table 1.

Figure 3 UnWeighted Neighbour-Joining tree illustrating the genetic relationships between the two studied gene pools based on the ten transferable nSSRs: pearl millet accessions (red), barley accessions (black), landrace names according to codes listed in Table 1.
Figure 3

UnWeighted Neighbour-Joining tree illustrating the genetic relationships between the two studied gene pools based on the ten transferable nSSRs: pearl millet accessions (red), barley accessions (black), landrace names according to codes listed in Table 1.

In addition to their high potential in revealing the genetic diversity of the studied landraces, the detected transferable nSSRs showed their ability in multivariate, phylogenetic and genetic differentiation analyses. According to Mohammadi et al. [52], knowledge of genetic structure and phylogenetic relationships among investigated genetic resources is required for further genome-wide association studies and plant breeding programmes. In this context, multi-allelic microsatellite markers are considered as the markers of choice in plant genetic structure investigations. Interestingly, SSR markers are valuable and cost-effective molecular technology for the genetic surveys of cereal crops [58].

4 Conclusion

In the current study, the transferability of barley nuclear microsatellite markers to pearl millet landraces was successfully highlighted for the first time. The obtained results showed that despite the evolutionary distance among barley and pearl millet genomes, a considerable nSSR transferability rate still exists. The detected transferable molecular markers exhibited high genetic diversity and discriminatory potentials among the studied landraces. Moreover, the ability of these nSSRs in achieving genetic structure, differentiation and phylogenetic analyses was confirmed. This investigation confirms the utility of barley as an efficient source of transferable molecular markers to other cereal crops. The new detected molecular markers will serve as a complementary molecular tool to the available informative and discriminant molecular markers for pearl millet considered as an understudied species compared to other cereal crops. This is of great interest for further valorization, conservation and genomic surveys toward the development of tolerant pearl millet varieties face to the emerging abiotic stresses.

Acknowledgments

The authors are grateful to the Tunisian Ministry of Higher Education and Scientific Research for financial support.

  1. Funding information: The study was funded by sources of Tunisian Ministry of Higher Education and Scientific Research.

  2. Author contributions: M.B.R.: investigation, methodology, formal analysis, writing original draft and review. L.R.: investigation, methodology, writing and review. R.Y.: investigation, writing and review. A.M.: supervision, review and editing. N.Z.: conceptualization, supervision, validation, writing, review and editing.

  3. Conflict of interest: The authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Poncet V, Lamy F, Devos KM, Gale MD, Sarr A, Robert T. Genetic control of domestication traits in pearl millet (Pennisetum glaucum L., Poaceae). Theor Appl Genet. 2000;100:147–59.10.1007/s001220050020Search in Google Scholar

[2] Serba D, Yadav R. Genomic tools in pearl millet breeding for drought tolerance: status and prospects. Front Plant Sci. 2016;7:1724–33.10.3389/fpls.2016.01724Search in Google Scholar PubMed PubMed Central

[3] Sehgal D, Rajaram V, Armstead IP, Vadez V, Yadav YP, Hash CT, et al. Integration of gene-based markers in a pearl millet genetic map for identification of candidate genes underlying drought tolerance quantitative trait loci. BMC Plant Biol. 2012;12:9.10.1186/1471-2229-12-9Search in Google Scholar PubMed PubMed Central

[4] Gari JA. Review of the African millet diversity. Paper for the International workshop on fonio, food security and livelihood among the rural poor in West Africa. Edited by the Programme for Neglected and Underutilised Species International Plant Genetic Resources Institute. Rome, Italy: 2002.Search in Google Scholar

[5] Bollam S, Pujarula V, Srivastava RK, Gupta R. Genomic approaches to enhance stress tolerance for productivity improvements in pearl millet. In: Gosal S, Wani S, editors. Biotechnologies of crop improvement. Vol. 3. Cham: Springer; 2018.10.1007/978-3-319-94746-4_11Search in Google Scholar

[6] Jaiswal S, Antala TJ, Mandavia MK, Chopra M, Jasrotia RS, Tomar RS, et al. Transcriptomic signature of drought response in pearl millet (Pennisetum glaucum (L.) and development of web-genomic resources. Sci Rep. 2018;8:3382.10.1038/s41598-018-21560-1Search in Google Scholar PubMed PubMed Central

[7] Yadav HP, Gupta SK, Rajpurohit BS, Pareek N. Pearl millet. In: Singh M, Kumar S, editors. Broadening the genetic base of grain cereals. New Delhi: Springer; 2016.10.1007/978-81-322-3613-9_8Search in Google Scholar

[8] Badejo AA, Nwachukwu U, Ayo-Omogie HN, Fasuhanmi OS. Enhancing the antioxidative capacity and acceptability of Kunnu beverage from gluten-free pearl millet (Pennisetum glaucum) through fortification with tigernut sedge (Cyperus esculentus) and coconut (Cocos nucifera) extracts. J Food Meas Charact. 2020;14:438–45.10.1007/s11694-019-00305-2Search in Google Scholar

[9] Athinarayanan J, Periasamy VS, Qasem AA, Al-Shagrawi RA, Alshatwi AA. Synthesis of SiO2 nanostructures from Pennisetum glaucum and their effect on osteogenic differentiation for bone tissue engineering applications. J Mater Sci Mater Med. 2019;30:23.10.1007/s10856-019-6223-0Search in Google Scholar PubMed

[10] Yadav M, Rengasamy RS, Gupta D. Characterization of pearl millet (Pennisetum glaucum) waste. Carbohydr Polym. 2019;212:160–8.10.1016/j.carbpol.2019.02.034Search in Google Scholar PubMed

[11] Ben Mustapha M, Bousselmi M, Jerbi T, Ben Bettaïeb N, Fattouch S. Gamma radiation effects on microbiological, physico-chemical and antioxidant properties of Tunisian millet (Pennisetum Glaucum L. R. Br.). Food Chem. 2014;154:230–7.10.1016/j.foodchem.2014.01.015Search in Google Scholar PubMed

[12] Salar RK, Purewal SS. Phenolic content, antioxidant potential and DNA damage protection of pearl millet (Pennisetum glaucum) cultivars of North Indian region. Food Measure. 2017;11:126–33.10.1007/s11694-016-9379-zSearch in Google Scholar

[13] Nani A, Belarbi M, Murtaza B, Benammar C, Merghoub T, Rialland M, et al. Polyphenols from Pennisetum glaucum grains induce MAP kinase phosphorylation and cell cycle arrest in human osteosarcoma cells. J Funct Foods. 2019;54:422–32.10.1016/j.jff.2019.01.042Search in Google Scholar

[14] Oumar I, Chibani F, Oran SA, Boussaid M, Karamanos Y, Raies A. Allozyme variation among some pearl millet (Pennisetum glaucum L.) cultivars collected from Tunisia and West Africa. Genet Resour Crop Evol. 2005;52:1087–97.10.1007/s10722-004-6090-4Search in Google Scholar

[15] Riahi L, Snoussi M, Ben Romdhane M, Zoghlami N. New insights into the intraspecific cytoplasmic DNA diversity, maternal lineages classification and conservation issues of Tunisian pearl millet landraces. Plant Biotechnol. 2021;38:17–22.10.5511/plantbiotechnology.20.0831aSearch in Google Scholar PubMed PubMed Central

[16] Ferreira R, Fernando PJ, Turchetto J, Minella C, Consoli E, Luciano D, et al. Assessment of genetic diversity in Brazilian barley using SSR markers. Genet Mol Biol. 2016;39:86–96.10.1590/1678-4685-GMB-2015-0148Search in Google Scholar PubMed PubMed Central

[17] Tyrka M, Perovic D, Wardynska A, Ordon F. A new diagnostic SSR marker for selection of the Rym4/Rym5 locus in barley breeding. J Appl Geneti. 2008;49:127–34.10.1007/BF03195605Search in Google Scholar PubMed

[18] Kaur S, Panesar PS, Bera MB, Kaur V. Simple sequence repeat markers in genetic divergence and marker-assisted selection of rice cultivars: a review. Crit Rev Food Sci Nutr. 2015;55:41–9.10.1080/10408398.2011.646363Search in Google Scholar PubMed

[19] Varshney RK, Marceln TC, Ramsay L, Russell J, Röder MS, Stein N, et al. A high-density barley microsatellite consensus map with 775 SSR loci. Theor Appl Genet. 2007;114:1091–103.10.1007/s00122-007-0503-7Search in Google Scholar PubMed

[20] Ben Romdhane M, Riahi L, Selmi A, Jardak R, Bouagila A, Ghorbel A, et al. Low genetic differentiation and evidence of gene flow among barley landrace populations in Tunisia. Crop Sci. 2017;57:1–9.10.2135/cropsci2016.05.0298Search in Google Scholar

[21] Agarwal M, Shrivastava N, Padh H. Advances in molecular marker techniques and their applications in plant sciences. Plant Cell Rep. 2008;27:617–31.10.1007/s00299-008-0507-zSearch in Google Scholar PubMed

[22] Varshney RK, Sigmund R, Borner A, Korzun V, Stein N, Sorrells ME, et al. Interspecific transferability and comparative mapping of barley EST-SSR markers in wheat, rye and rice. Plant Sci. 2005;168:195–202.10.1016/j.plantsci.2004.08.001Search in Google Scholar

[23] Yildirim A, Kandemir N, Ateş-Sönmezoğlu Ö, Güleç TE. Transferability of microsatellite markers among cool season cereals. Biotechnol Biotechnol Equip. 2009;23:1299–302.10.1080/13102818.2009.10817657Search in Google Scholar

[24] Rai MK, Phulwaria M, Shekhawat NS. Transferability of simple sequence repeat (SSR) markers developed in guava (Psidium guajava L.) to four Myrtaceae species. Mol Biol Rep. 2013;40:5067–71.10.1007/s11033-013-2608-1Search in Google Scholar PubMed

[25] Datta S, Kaashyap M, Singh P, Gupta P, Anjum KT, Mahfooz S, et al. Conservation of microsatellite regions across legume genera enhances marker repertoire and genetic diversity study in Phaseolus genotypes. Plant Breed. 2012;131:307–11.10.1111/j.1439-0523.2011.01892.xSearch in Google Scholar

[26] Xiao Y, Xia W, Ma J, Mason AS, Fan H, Shi P, et al. Genome-wide identification and transferability of microsatellite markers between Palmae species. Front Plant Sci. 2016;7:1578.10.3389/fpls.2016.01578Search in Google Scholar PubMed PubMed Central

[27] Bowers JE, Bandmann EB, Meredith CP. DNA fingerprinting and characterization of some wine grape cultivars. Am J Enol Vitic. 1993;44:266–74.10.5344/ajev.1993.44.3.266Search in Google Scholar

[28] Zoghlami N, Bouagila A, Lamine M, Hajri H, Ghorbel A. Population genetic structure analysis in endangered Hordeum vulgare landraces from Tunisia: conservation strategies. Afr J Biotechnol. 2011;10:10344–51.10.5897/AJB10.1666Search in Google Scholar

[29] Saghai Maroof MA, Biyashev RM, Yang GP, Zhang Q, Allard RW. Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. Proc Natl Acad Sci USA. 1994;91:5466–70.10.1073/pnas.91.12.5466Search in Google Scholar PubMed PubMed Central

[30] Liu ZW, Biyashev RM, Saghai-Maroof MA. Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theor Appl Genet. 1996;93:869–76.10.1007/BF00224088Search in Google Scholar PubMed

[31] Ramsay L, Macaulay M, Ivanissevich SD, Maclean K, Cardle L, Fuller J. A simple sequence repeat-based linkage map of barley. Genetics. 2000;156:1997–2005.10.1093/genetics/156.4.1997Search in Google Scholar PubMed PubMed Central

[32] Wenzl P, Li H, Carling J, Zhou M, Raman H, Paul E, et al. A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits. BMC Genomics. 2006;7:206.10.1186/1471-2164-7-206Search in Google Scholar PubMed PubMed Central

[33] Ben Romdhane M, Riahi L, Jardak R, Ghorbel A, Zoghlami N. Fingerprinting and genetic purity assessment of F1 barley hybrids and their salt-tolerant parental lines using nSSR molecular markers. 3 Biotech. 2018;8:57.10.1007/s13205-017-1080-3Search in Google Scholar PubMed PubMed Central

[34] Macaulay M, Ramsay L, Powell W, Waugh RA. Representative, highly informative ‘genotyping set’ of barley SSRs. Theor Appl Genet. 2001;102:801–9.10.1007/s001220000487Search in Google Scholar

[35] Francis C, Yang Y, Yang R, Boyle T. POPGENE version 1.31: Microsoft Window-based freeware for population genetic analysis. University of Alberta Centre for International Forestry Research, Edmonton; 1999.Search in Google Scholar

[36] Paetkau D, Calvert W, Stirling I, Strobeck C. Microsatellite analysis of population structure in Canadian polar bears. Mol Ecol. 1995;4:347–58.10.1111/j.1365-294X.1995.tb00227.xSearch in Google Scholar PubMed

[37] Wagner HW, Sefc KM. Identity 1.0: Freeware program for the analysis of microsatellite data. Manual program. Center for applied genetics, University of Agricultural Sciences, Vienna, Austria; 1999.Search in Google Scholar

[38] Marshall TC, Slate J, Kruuk LEB, Pemberton JM. Statistical confidence for likelihood-based paternity inference in natural populations. Mol Ecol. 1998;7:639–55.10.1046/j.1365-294x.1998.00374.xSearch in Google Scholar PubMed

[39] Perrier X, Jacquemoud-Collet JP. DARwin Software. Dissimilarity Analysis and Representation for Windows; 2006. http://darwin.cirad.fr/.Search in Google Scholar

[40] Weir BS, Cockerham CC. Estimating F-statistics for the analysis of population structure. Evolution. 1984;38:1358–70.10.1111/j.1558-5646.1984.tb05657.xSearch in Google Scholar PubMed

[41] Raymond M, Rousset F. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Hered. 1995;86:248–9.10.1093/oxfordjournals.jhered.a111573Search in Google Scholar

[42] Wang A, Yu Z, Ding Y. Genetic diversity analysis of wild close relatives of barley from Tibet and the Middle East by ISSR and SSR markers. C R Biol. 2009;332:393–403.10.1016/j.crvi.2008.11.007Search in Google Scholar PubMed

[43] Senthilvel S, Mahalakshmi V, Sathish Kumar P, Reddy AR, Markandeya G, Reddy MK, et al. Markers for pearl millet from data mining of Expressed Sequence Tags. Conference: Fourth International Crop Science Congress; 2004.Search in Google Scholar

[44] Yadav OP, Mitchell SE, Fulton TM. Transferring molecular markers from sorghum, rice and other cereals to pearl millet and identifying polymorphic markers. SAT eJournal. 2008;6:1–4.Search in Google Scholar

[45] Biswas MK, Xu Q, Mayer C, Deng X. Genome wide characterization of short tandem repeat markers in sweet orange (Citrus sinensis). PLoS One. 2014;9:e104182.10.1371/journal.pone.0104182Search in Google Scholar PubMed PubMed Central

[46] Hamza S, Ben Hmida W, Rebai A, Harrabi M. SSR based genetic diversity assessment among Tunisian Winter Barley and relationship with morphological traits. Euphytica. 2004;135:107–18.10.1023/B:EUPH.0000009547.65808.bfSearch in Google Scholar

[47] Marone D, Russo MA, Mores A, Ficco DBM, Laidò G, Mastrangelo AM, et al. Importance of landraces in cereal breeding for stress tolerance. Plants. 2021;10:1267.10.3390/plants10071267Search in Google Scholar PubMed PubMed Central

[48] Abdel-Ghani AH, Parzies HK, Omary A, Geiger HH. Estimating the out crossing rate of barley landraces and wild barley populations collected from ecologically different regions of Jordan. Theor Appl Genet. 2004;109:588–95.10.1007/s00122-004-1657-1Search in Google Scholar PubMed

[49] Samberg LH, Fishman L, Allendorf FW. Population genetic structure in a social landscape: barley in a traditional Ethiopian agricultural system. Evol Appl. 2013;6:1133–45.10.1111/eva.12091Search in Google Scholar PubMed PubMed Central

[50] Jensen HR, Belqadi L, De Santis P, Sadiki M, Jarvis DI, Schoen DJ. A case study of seed exchange networks and gene flow for barley (Hordeum vulgare subsp. vulgare) in Morocco. Genet Resour Crop Evol. 2013;60:1119–38.10.1007/s10722-012-9909-4Search in Google Scholar

[51] Dido AA, Krishna MSR, Assefa E, Degefu DT, Singh BJK, Tesfaye K. Genetic diversity, population structure and relationship of Ethiopian barley (Hordeum vulgare L.) landraces as revealed by SSR markers. J Genet. 2022;101:9.10.1007/s12041-021-01346-7Search in Google Scholar

[52] Mohammadi SA, Sisi NA, Sadeghzadeh B. The infuence of breeding history, origin and growth type on population structure of barley as revealed by SSR markers. Sci Rep. 2020;10:19165.10.1038/s41598-020-75339-4Search in Google Scholar PubMed PubMed Central

[53] Bougma LA, Ouédraogo MH, Ouoba A, Zouré AA, Sawadogo N, Sawadogo M. Genetic differentiation for gene diversity among pearl millet (Pennisetum glaucum (L.) R. Br.) landraces as revealed by SSR markers. Int J Agron. 2021;2021:6160903.10.1155/2021/6160903Search in Google Scholar

[54] Naino Jika AK, Dussert Y, Raimond C, Garine E, Luxereau A, Takvorian N, et al. Unexpected pattern of pearl millet genetic diversity among ethno-linguistic groups in the Lake Chad Basin. Heredity. 2017;118:491–502.10.1038/hdy.2016.128Search in Google Scholar PubMed PubMed Central

[55] Mariac C, Luong V, Kapran I, Mamadou A, Sagnard F, Deu M, et al. Diversity of wild and cultivated pearl millet accessions (Pennisetum glaucum [L.] R. Br.) in Niger assessed by microsatellite markers. Theor Appl Genet. 2006;114:49–58.10.1007/s00122-006-0409-9Search in Google Scholar PubMed

[56] Adeoti K, Djedatin G, Ewedje E, Beule T, Santoni S, Rival A, et al. Assessment of genetic diversity among cultivated Pearl millet (Pennisetum glaucum, Poaceae) accessions from Benin, West Africa. Afr J Biotechnol. 2017;16:782–90.10.5897/AJB2017.15898Search in Google Scholar

[57] Diack O, Kane NA, Berthouly-Salazar C, Gueye MC, Diop BM, Fofana A, et al. New genetic insights into pearl millet diversity as revealed by characterization of early and late-flowering landraces from Senegal. Front Plant Sci. 2017;8:818.10.3389/fpls.2017.00818Search in Google Scholar PubMed PubMed Central

[58] Castillo A, Dorado G, Feuillet C, Sourdille P, Hernandez P. Genetic structure and ecogeographical adaptation in wild barley (Hordeum chilense Roemer et Schultes) as revealed by microsatellite markers. BMC Plant Biol. 2010;10:266.10.1186/1471-2229-10-266Search in Google Scholar PubMed PubMed Central

Received: 2021-12-15
Revised: 2022-07-31
Accepted: 2022-08-15
Published Online: 2022-09-01

© 2022 Mériam Ben Romdhane et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Regular Articles
  2. Foliar application of boron positively affects the growth, yield, and oil content of sesame (Sesamum indicum L.)
  3. Impacts of adopting specialized agricultural programs relying on “good practice” – Empirical evidence from fruit growers in Vietnam
  4. Evaluation of 11 potential trap crops for root-knot nematode (RKN) control under glasshouse conditions
  5. Technical efficiency of resource-poor maize farmers in northern Ghana
  6. Bulk density: An index for measuring critical soil compaction levels for groundnut cultivation
  7. Efficiency of the European Union farm types: Scenarios with and without the 2013 CAP measures
  8. Participatory validation and optimization of the Triple S method for sweetpotato planting material conservation in southern Ethiopia
  9. Selection of high-yield maize hybrid under different cropping systems based on stability and adaptability parameters
  10. Soil test-based phosphorus fertilizer recommendation for malting barley production on Nitisols
  11. Effects of domestication and temperature on the growth and survival of the giant freshwater prawn (Macrobrachium rosenbergii) postlarvae
  12. Influence of irrigation regime on gas exchange, growth, and oil quality of field grown, Texas (USA) olive trees
  13. Present status and prospects of value addition industry for agricultural produce – A review
  14. Competitiveness and impact of government policy on chili in Indonesia
  15. Growth of Rucola on Mars soil simulant under the influence of pig slurry and earthworms
  16. Effect of potassium fertilizer application in teff yield and nutrient uptake on Vertisols in the central highlands of Ethiopia
  17. Dissection of social interaction and community engagement of smallholder oil palm in reducing conflict using soft system methodology
  18. Farmers’ perception, awareness, and constraints of organic rice farming in Indonesia
  19. Improving the capacity of local food network through local food hubs’ development
  20. Quality evaluation of gluten-free biscuits prepared with algarrobo flour as a partial sugar replacer
  21. Effect of pre-slaughter weight on morphological composition of pig carcasses
  22. Study of the impact of increasing the highest retail price of subsidized fertilizer on rice production in Indonesia
  23. Agrobiodiversity and perceived climatic change effect on family farming systems in semiarid tropics of Kenya
  24. Influences of inter- and intra-row spacing on the growth and head yield of cabbage (Brassica oleracea var. capitata) in western Amhara, Ethiopia
  25. The supply chain and its development concept of fresh mulberry fruit in Thailand: Observations in Nan Province, the largest production area
  26. Toward achieving sustainable development agenda: Nexus between agriculture, trade openness, and oil rents in Nigeria
  27. Phenotyping cowpea accessions at the seedling stage for drought tolerance in controlled environments
  28. Apparent nutrient utilization and metabolic growth rate of Nile tilapia, Oreochromis niloticus, cultured in recirculating aquaculture and biofloc systems
  29. Influence of season and rangeland-type on serum biochemistry of indigenous Zulu sheep
  30. Meta-analysis of responses of broiler chickens to Bacillus supplementation: Intestinal histomorphometry and blood immunoglobulin
  31. Weed composition and maize yield in a former tin-mining area: A case study in Malim Nawar, Malaysia
  32. Strategies for overcoming farmers’ lives in volcano-prone areas: A case study in Mount Semeru, Indonesia
  33. Principal component and cluster analyses based characterization of maize fields in southern central Rift Valley of Ethiopia
  34. Profitability and financial performance of European Union farms: An analysis at both regional and national levels
  35. Analysis of trends and variability of climatic parameters in Teff growing belts of Ethiopia
  36. Farmers’ food security in the volcanic area: A case in Mount Merapi, Indonesia
  37. Strategy to improve the sustainability of “porang” (Amorphophallus muelleri Blume) farming in support of the triple export movement policy in Indonesia
  38. Agrarian contracts, relations between agents, and perception on energy crops in the sugarcane supply chain: The Peruvian case
  39. Factors influencing the adoption of conservation agriculture by smallholder farmers in KwaZulu-Natal, South Africa
  40. Meta-analysis of zinc feed additive on enhancement of semen quality, fertility and hatchability performance in breeder chickens
  41. Meta-analysis of the potential of dietary Bacillus spp. in improving growth performance traits in broiler chickens
  42. Biocomposites from agricultural wastes and mycelia of a local mushroom, Lentinus squarrosulus (Mont.) Singer
  43. Cross transferability of barley nuclear SSRs to pearl millet genome provides new molecular tools for genetic analyses and marker assisted selection
  44. Detection of encapsulant addition in butterfly-pea (Clitoria ternatea L.) extract powder using visible–near-infrared spectroscopy and chemometrics analysis
  45. The willingness of farmers to preserve sustainable food agricultural land in Yogyakarta, Indonesia
  46. Transparent conductive far-infrared radiative film based on polyvinyl alcohol with carbon fiber apply in agriculture greenhouse
  47. Grain yield stability of black soybean lines across three agroecosystems in West Java, Indonesia
  48. Forms of land access in the sugarcane agroindustry: A comparison of Brazilian and Peruvian cases
  49. Assessment of the factors contributing to the lack of agricultural mechanization in Jiroft, Iran
  50. Do poor farmers have entrepreneurship skill, intention, and competence? Lessons from transmigration program in rural Gorontalo Province, Indonesia
  51. Communication networks used by smallholder livestock farmers during disease outbreaks: Case study in the Free State, South Africa
  52. Sustainability of Arabica coffee business in West Java, Indonesia: A multidimensional scaling approach
  53. Farmers’ perspectives on the adoption of smart farming technology to support food farming in Aceh Province, Indonesia
  54. Rice yield grown in different fertilizer combination and planting methods: Case study in Buru Island, Indonesia
  55. Paclobutrazol and benzylaminopurine improve potato yield grown under high temperatures in lowland and medium land
  56. Agricultural sciences publication activity in Russia and the impact of the national project “Science.” A bibliometric analysis
  57. Storage conditions and postharvest practices lead to aflatoxin contamination in maize in two counties (Makueni and Baringo) in Kenya
  58. Relationship of potato yield and factors of influence on the background of herbological protection
  59. Biology and life cycle Of Diatraea busckella (Lepidoptera: Crambidae) under simulated altitudinal profile in controlled conditions
  60. Evaluation of combustion characteristics performances and emissions of a diesel engine using diesel and biodiesel fuel blends containing graphene oxide nanoparticles
  61. Effect of various varieties and dosage of potassium fertilizer on growth, yield, and quality of red chili (Capsicum annuum L.)
  62. Review Articles
  63. Germination ecology of three Asteraceae annuals Arctotis hirsuta, Oncosiphon suffruticosum, and Cotula duckittiae in the winter-rainfall region of South Africa: A review
  64. Animal waste antibiotic residues and resistance genes: A review
  65. A brief and comprehensive history of the development and use of feed analysis: A review
  66. The evolving state of food security in Nigeria amidst the COVID-19 pandemic – A review
  67. Short Communication
  68. Response of cannabidiol hemp (Cannabis sativa L.) varieties grown in the southeastern United States to nitrogen fertilization
  69. Special Issue on the International Conference on Multidisciplinary Research – Agrarian Sciences
  70. Special issue on the International Conference on Multidisciplinary Research – Agrarian Sciences: Message from the editor
  71. Maritime pine land use environmental impact evolution in the context of life cycle assessment
  72. Influence of different parameters on the characteristics of hazelnut (var. Grada de Viseu) grown in Portugal
  73. Organic food consumption and eating habit in Morocco, Algeria, and Tunisia during the COVID-19 pandemic lockdown
  74. Customer knowledge and behavior on the use of food refrigerated display cabinets: A Portuguese case
  75. Perceptions and knowledge regarding quality and safety of plastic materials used for food packaging
  76. Understanding the role of media and food labels to disseminate food related information in Lebanon
  77. Liquefaction and chemical composition of walnut shells
  78. Validation of an analytical methodology to determine humic substances using low-volume toxic reagents
  79. Special Issue on the International Conference on Agribusiness and Rural Development – IConARD 2020
  80. Behavioral response of breeder toward development program of Ongole crossbred cattle in Yogyakarta Special Region, Indonesia
  81. Special Issue on the 2nd ICSARD 2020
  82. Perceived attributes driving the adoption of system of rice intensification: The Indonesian farmers’ view
  83. Value-added analysis of Lactobacillus acidophilus cell encapsulation using Eucheuma cottonii by freeze-drying and spray-drying
  84. Investigating the elicited emotion of single-origin chocolate towards sustainable chocolate production in Indonesia
  85. Temperature and duration of vernalization effect on the vegetative growth of garlic (Allium sativum L.) clones in Indonesia
  86. Special Issue on Agriculture, Climate Change, Information Technology, Food and Animal (ACIFAS 2020)
  87. Prediction model for agro-tourism development using adaptive neuro-fuzzy inference system method
  88. Special Issue of International Web Conference on Food Choice and Eating Motivation
  89. Can ingredients and information interventions affect the hedonic level and (emo-sensory) perceptions of the milk chocolate and cocoa drink’s consumers?
https://doi.org/10.1515/opag-2022-0132
Keywords for this article
Hordeum vulgare L.; Pennisetum glaucum L.; landraces; nSSR; transferability; genetic analyses
Creative Commons
BY 4.0

Articles in the same Issue

  1. Regular Articles
  2. Foliar application of boron positively affects the growth, yield, and oil content of sesame (Sesamum indicum L.)
  3. Impacts of adopting specialized agricultural programs relying on “good practice” – Empirical evidence from fruit growers in Vietnam
  4. Evaluation of 11 potential trap crops for root-knot nematode (RKN) control under glasshouse conditions
  5. Technical efficiency of resource-poor maize farmers in northern Ghana
  6. Bulk density: An index for measuring critical soil compaction levels for groundnut cultivation
  7. Efficiency of the European Union farm types: Scenarios with and without the 2013 CAP measures
  8. Participatory validation and optimization of the Triple S method for sweetpotato planting material conservation in southern Ethiopia
  9. Selection of high-yield maize hybrid under different cropping systems based on stability and adaptability parameters
  10. Soil test-based phosphorus fertilizer recommendation for malting barley production on Nitisols
  11. Effects of domestication and temperature on the growth and survival of the giant freshwater prawn (Macrobrachium rosenbergii) postlarvae
  12. Influence of irrigation regime on gas exchange, growth, and oil quality of field grown, Texas (USA) olive trees
  13. Present status and prospects of value addition industry for agricultural produce – A review
  14. Competitiveness and impact of government policy on chili in Indonesia
  15. Growth of Rucola on Mars soil simulant under the influence of pig slurry and earthworms
  16. Effect of potassium fertilizer application in teff yield and nutrient uptake on Vertisols in the central highlands of Ethiopia
  17. Dissection of social interaction and community engagement of smallholder oil palm in reducing conflict using soft system methodology
  18. Farmers’ perception, awareness, and constraints of organic rice farming in Indonesia
  19. Improving the capacity of local food network through local food hubs’ development
  20. Quality evaluation of gluten-free biscuits prepared with algarrobo flour as a partial sugar replacer
  21. Effect of pre-slaughter weight on morphological composition of pig carcasses
  22. Study of the impact of increasing the highest retail price of subsidized fertilizer on rice production in Indonesia
  23. Agrobiodiversity and perceived climatic change effect on family farming systems in semiarid tropics of Kenya
  24. Influences of inter- and intra-row spacing on the growth and head yield of cabbage (Brassica oleracea var. capitata) in western Amhara, Ethiopia
  25. The supply chain and its development concept of fresh mulberry fruit in Thailand: Observations in Nan Province, the largest production area
  26. Toward achieving sustainable development agenda: Nexus between agriculture, trade openness, and oil rents in Nigeria
  27. Phenotyping cowpea accessions at the seedling stage for drought tolerance in controlled environments
  28. Apparent nutrient utilization and metabolic growth rate of Nile tilapia, Oreochromis niloticus, cultured in recirculating aquaculture and biofloc systems
  29. Influence of season and rangeland-type on serum biochemistry of indigenous Zulu sheep
  30. Meta-analysis of responses of broiler chickens to Bacillus supplementation: Intestinal histomorphometry and blood immunoglobulin
  31. Weed composition and maize yield in a former tin-mining area: A case study in Malim Nawar, Malaysia
  32. Strategies for overcoming farmers’ lives in volcano-prone areas: A case study in Mount Semeru, Indonesia
  33. Principal component and cluster analyses based characterization of maize fields in southern central Rift Valley of Ethiopia
  34. Profitability and financial performance of European Union farms: An analysis at both regional and national levels
  35. Analysis of trends and variability of climatic parameters in Teff growing belts of Ethiopia
  36. Farmers’ food security in the volcanic area: A case in Mount Merapi, Indonesia
  37. Strategy to improve the sustainability of “porang” (Amorphophallus muelleri Blume) farming in support of the triple export movement policy in Indonesia
  38. Agrarian contracts, relations between agents, and perception on energy crops in the sugarcane supply chain: The Peruvian case
  39. Factors influencing the adoption of conservation agriculture by smallholder farmers in KwaZulu-Natal, South Africa
  40. Meta-analysis of zinc feed additive on enhancement of semen quality, fertility and hatchability performance in breeder chickens
  41. Meta-analysis of the potential of dietary Bacillus spp. in improving growth performance traits in broiler chickens
  42. Biocomposites from agricultural wastes and mycelia of a local mushroom, Lentinus squarrosulus (Mont.) Singer
  43. Cross transferability of barley nuclear SSRs to pearl millet genome provides new molecular tools for genetic analyses and marker assisted selection
  44. Detection of encapsulant addition in butterfly-pea (Clitoria ternatea L.) extract powder using visible–near-infrared spectroscopy and chemometrics analysis
  45. The willingness of farmers to preserve sustainable food agricultural land in Yogyakarta, Indonesia
  46. Transparent conductive far-infrared radiative film based on polyvinyl alcohol with carbon fiber apply in agriculture greenhouse
  47. Grain yield stability of black soybean lines across three agroecosystems in West Java, Indonesia
  48. Forms of land access in the sugarcane agroindustry: A comparison of Brazilian and Peruvian cases
  49. Assessment of the factors contributing to the lack of agricultural mechanization in Jiroft, Iran
  50. Do poor farmers have entrepreneurship skill, intention, and competence? Lessons from transmigration program in rural Gorontalo Province, Indonesia
  51. Communication networks used by smallholder livestock farmers during disease outbreaks: Case study in the Free State, South Africa
  52. Sustainability of Arabica coffee business in West Java, Indonesia: A multidimensional scaling approach
  53. Farmers’ perspectives on the adoption of smart farming technology to support food farming in Aceh Province, Indonesia
  54. Rice yield grown in different fertilizer combination and planting methods: Case study in Buru Island, Indonesia
  55. Paclobutrazol and benzylaminopurine improve potato yield grown under high temperatures in lowland and medium land
  56. Agricultural sciences publication activity in Russia and the impact of the national project “Science.” A bibliometric analysis
  57. Storage conditions and postharvest practices lead to aflatoxin contamination in maize in two counties (Makueni and Baringo) in Kenya
  58. Relationship of potato yield and factors of influence on the background of herbological protection
  59. Biology and life cycle Of Diatraea busckella (Lepidoptera: Crambidae) under simulated altitudinal profile in controlled conditions
  60. Evaluation of combustion characteristics performances and emissions of a diesel engine using diesel and biodiesel fuel blends containing graphene oxide nanoparticles
  61. Effect of various varieties and dosage of potassium fertilizer on growth, yield, and quality of red chili (Capsicum annuum L.)
  62. Review Articles
  63. Germination ecology of three Asteraceae annuals Arctotis hirsuta, Oncosiphon suffruticosum, and Cotula duckittiae in the winter-rainfall region of South Africa: A review
  64. Animal waste antibiotic residues and resistance genes: A review
  65. A brief and comprehensive history of the development and use of feed analysis: A review
  66. The evolving state of food security in Nigeria amidst the COVID-19 pandemic – A review
  67. Short Communication
  68. Response of cannabidiol hemp (Cannabis sativa L.) varieties grown in the southeastern United States to nitrogen fertilization
  69. Special Issue on the International Conference on Multidisciplinary Research – Agrarian Sciences
  70. Special issue on the International Conference on Multidisciplinary Research – Agrarian Sciences: Message from the editor
  71. Maritime pine land use environmental impact evolution in the context of life cycle assessment
  72. Influence of different parameters on the characteristics of hazelnut (var. Grada de Viseu) grown in Portugal
  73. Organic food consumption and eating habit in Morocco, Algeria, and Tunisia during the COVID-19 pandemic lockdown
  74. Customer knowledge and behavior on the use of food refrigerated display cabinets: A Portuguese case
  75. Perceptions and knowledge regarding quality and safety of plastic materials used for food packaging
  76. Understanding the role of media and food labels to disseminate food related information in Lebanon
  77. Liquefaction and chemical composition of walnut shells
  78. Validation of an analytical methodology to determine humic substances using low-volume toxic reagents
  79. Special Issue on the International Conference on Agribusiness and Rural Development – IConARD 2020
  80. Behavioral response of breeder toward development program of Ongole crossbred cattle in Yogyakarta Special Region, Indonesia
  81. Special Issue on the 2nd ICSARD 2020
  82. Perceived attributes driving the adoption of system of rice intensification: The Indonesian farmers’ view
  83. Value-added analysis of Lactobacillus acidophilus cell encapsulation using Eucheuma cottonii by freeze-drying and spray-drying
  84. Investigating the elicited emotion of single-origin chocolate towards sustainable chocolate production in Indonesia
  85. Temperature and duration of vernalization effect on the vegetative growth of garlic (Allium sativum L.) clones in Indonesia
  86. Special Issue on Agriculture, Climate Change, Information Technology, Food and Animal (ACIFAS 2020)
  87. Prediction model for agro-tourism development using adaptive neuro-fuzzy inference system method
  88. Special Issue of International Web Conference on Food Choice and Eating Motivation
  89. Can ingredients and information interventions affect the hedonic level and (emo-sensory) perceptions of the milk chocolate and cocoa drink’s consumers?
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 15.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/opag-2022-0132/html
Scroll to top button