Home CST3 alleviates bilirubin-induced neurocytes’ damage by promoting autophagy
Article Open Access

CST3 alleviates bilirubin-induced neurocytes’ damage by promoting autophagy

  • Zhenkun Li EMAIL logo and Yating Du EMAIL logo
Published/Copyright: October 16, 2023
Become an author with De Gruyter Brill

Abstract

High concentrations of unconjugated bilirubin (UCB) have toxic effects. The aim of our study was to find a way to elevate UCB tolerance or inhibit its toxicity in neurocytes. It has been reported that cystatin C (CST3) concentrations have a significant positive correlation with total bilirubin (TB) levels and a negative correlation with albumin levels. In addition, CST3 can directly bind UCB, decrease human umbilical vein endothelial cells’ permeability, improve blood–brain barrier integrity after ischemic brain injury in mice, and induce autophagy. We hypothesized that CST3 could increase the solubility of UCB, decrease permeability of neurocytes, induce autophagy of neurocytes, and alleviate bilirubin-induced damage. To verify our hypothesis, we measured TB and conjugated bilirubin levels, and the permeability and autophagy of neurocytes treated with UCB and CST3. Our findings suggest that CST3 can protect against UCB-induced damage in neurocytes and that autophagy played an important role in this process.

1 Introduction

Hyperbilirubinemia, presenting as jaundice, refers high serum bilirubin levels caused by various conditions [1]. Total bilirubin (TB) includes unconjugated bilirubin (UCB) and conjugated bilirubin (CB) [2]. UCB combines with albumin in the blood and is transported to the liver, where it is conjugated into glucuronic acid bilirubin by UDP-glucuronosyltransferase 1A1 (UGT1A1) and becomes CB [3]. CB can be excreted through feces or urine and has minor effect on the body. Therefore, current research on injuries caused by bilirubin has mainly focused on UCB.

Sustained higher UCB levels can damage various organs [4]. Studies have shown that UCB can induce neurotoxicity [5], which is a serious consequence of neonatal hyperbilirubinemia and a major cause of neonatal brain injury worldwide [6].

Cystatin C (CST3) is a low molecular weight (≈13.3 kDa) protein produced by nucleated cells [7], and is the most important extracellular inhibitor of cysteine proteinases [8]. It has been reported that CST3 has protective effects in neurodegenerative diseases [9,10], but the role of CST3 on UCB-induced neurotoxicity has not been elaborated. Studies have shown that UCB could bind with cystatin [11,12]. Besides, human umbilical vein endothelial cells’ permeability decreases significantly after treatment with CST3 [13] and can improve blood–brain barrier integrity after ischemic brain injury in mice [14]. In addition, it has been reported that CST3 induced autophagy through the AMPK-mTOR pathway and plays a neuroprotective role [15]. In addition, CST3 knockout led to disordered autophagy in macrophages and ApoE-knockout mice [16]. We hypothesized that CST3 could reduce UCB toxicity via binding with UCB, decreasing the permeability of cells, or promoting autophagy.

2 Materials and methods

2.1 Hyperbilirubinemic mice

A total of 15 male C57BL/6 mice (6–8 weeks) were used in this study. Ten mice injected intravenously with 150 μg/g of UCB (total volume 100 μL). They then were evenly divided into two groups and injected intravenously with 5 μg/g of CST3 (total volume 100 μL) or PBS (total volume 100 μL). The animals were maintained under controlled conditions with a temperature of 24 ± 2°C, humidity of 55–65%, a 12 h light/dark cycle, and ad libitum access to standard laboratory diet and water. They were euthanized after 3 days and the tissues were fixed in 4% formalin or 2.5% glutaraldehyde.

2.2 Morris water maze

The mice need to find and stand on a platform submerged under 5 mm of water in a circular pool by observing four visual cues in different locations around the pool. On the training days, the mice were given a maximum of 60 s to find the platform, and recording was stopped when the mice remained on the platform for 5 s. Mice that did not find the platform within 60 s were guided to the platform and allowed to remain on it for 10 s. The training phase lasted for 4 days, during which the mice were placed in the pool four times every day. On the fifth day, the test was performed by placing the mice in the pool from which the platform had been removed and allowing them to explore for 60 s. The time and distance they swam in the platform quadrant or in the other three quadrants were measured.

2.3 Masson’s staining

For Masson’s staining, the brain samples were treated with hematoxylin for 5 min, with deionized water for 30 s three times, and with Masson’s dye (HT15, Sigma, USA) for 7 min. Then, the brain sections were treated with 2% glacial acetic acid solution and 10% molybdic acid for 5 min. After aniline blue staining for 5 min and gradient alcohol washing, neutral gum was used to seal the slide, and the section was observed under a microscope.

2.4 Bilirubin measurement

TB and CB were measured using TB assay kit (C019-1-1, Njjcbio, China) and a direct bilirubin assay kit (C019-2-1, Njjcbio, China), respectively. UCB content was defined by TB minus CB levels (µmol/L).

2.5 Cell culture

HT22 cells were cultured in RPMI-1640 medium (Sigma, USA). The medium was changed every 2–3 days. CST3 proteins were obtained from ProSpec and blocking peptides for CST3 were purchased from Abgent. The proteins were dissolved in double distilled water. UCB of 100 µg/mL was added to the cells to establish high UCB cell model.

2.6 Quantitative polymerase chain reaction (qPCR)

Total RNA was extracted from HT22 cells using TRIzol reagent (Tiangen, China). We synthesized cDNA using the FastQuant RT Kit (Tiangen, China) following the manufacturer’s instructions. qPCR was performed on an IQ5 thermal cycler (Bio-Rad, USA) using the following cycling conditions: predenaturation at 95°C for 15 min, 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 15 s, extension at 72°C for 20 s, and 71 cycles of melt curve analysis at 60°C for 10 s. The following primers were used in reactions:

CST3 primer sequences: F CAACAAAGCCAGCAACGACA, R TCTTGGTACACGTGGTTCGG and β-actin primer sequences: F AGAGGGAAATCGTGCGTGAC, R CAATAGTGATGACCTGGCCGT.

2.7 Western blots

Proteins were extracted from the brain samples using a Proteins Extraction Kit (CWBIO, China) and quantified with BCA-Reagents (CWBIO, China). Proteins were separated by SDS–PAGE at 160 V on a 12% gel (CWBIO, China) for 1 h and then transferred to a 0.22 μm nitrocellulose filter membrane at 200 mA for 3 h. The membranes were incubated with autophagy related primary antibodies diluted as follows: anti-CST3 antibody (ab24327; Abcam, UK), anti-mTOR antibody (ab32028; Abcam, UK), anti-mTOR (phospho S2448) antibody (ab109268; Abcam, UK), anti-LC3 antibody (ab192890; Abcam, UK), anti-Beclin-1 antibody (3495, CST, USA) diluted 1:1,000, and anti-GAPDH antibody (ab181602; Abcam, UK) diluted 1:2,000. Membranes were then incubated with secondary antibodies diluted at 1:5,000. The membranes were washed and bands were visualized with enhanced chemiluminescence immunoblotting detection reagents (Thermo Fisher Scientific, USA). For autophagic protein, bafilomycin A1 was used at a final concentration of 200 nM and added during the last 3 h. Images were gotten by Image Lab Software (BIO-RAD, USA), and semiquantitative analysis was performed by normalizing the protein bands to the internal control GAPDH.

2.8 Cytotoxicity assay

We performed MTT (Solarbio, China) assays to examine the viability of HT22 cells treated with CST3 (100 pg/μL), UCB (170 µM), or bafilomycin A1 (200 nM and added during the last 3 h of treatment). Cells treated with solvent were used as the negative control. HT22 cells were plated at a density of 2,000 cells/well and allowed to adhere for 6 h, followed by treatment with CST3 protein and UCB. Wells containing 100 μL medium alone (without cells) were used as blank controls. MTT assays were performed after treatment for 48 h. The blank control served as baseline. Each experiment was repeated three times, and the results are presented as a percentage of viable cells calculated by the following equation: (mean absorbance of experimental well/mean absorbance of control well) × 100 = percentage of viable cells.

2.9 Enzyme-linked immunosorbent assay (ELISA)

The activity of P450 was determined using a P450 activity ELISA kit (Cyagen, USA) in accordance with the manufacturer’s instructions.

2.10 Cell permeability

HT22 cells (2 × 105) were seeded onto polycarbonate cell culture inserts of a 2-well Transwell system (Costar) until they formed a complete monolayer. Then FITC–BSA was added to the upper chamber and the fluorescence was evaluated in the lower chamber after adding FITC–BSA for 24 h (excitation wavelength, 488 nm; emission wavelength, 525 nm).

2.11 UCB permeability

HT22 cells (2 × 105) were seeded onto polycarbonate cell culture inserts of a 24-well Transwell system (Costar) until they formed a complete monolayer. Then 100 µg/mL UCB was added to the upper chamber and concentration of UCB in lower chamber was evaluated after 6 h.

2.12 Statistical analyses

Statistical analyses were performed using SPSS 22.0 (SPSS Inc., USA). After the normality test and variance homogeneity test of measured data, comparisons between different groups were performed using Student’s t-test or one-way ANOVA. Data are shown as mean ± SD. A p-value ≤0.05 indicated statistical significance.

  1. Ethical approval: The research related to animals’ use has been complied with all the relevant national regulations and institutional policies for the care and use of animals. All animal experiments were approved by the Animal Experiments and Experimental Animal Welfare Committee of Beijing friendship hospital, Capital Medical University (21-2036).

3 Results

3.1 CST3 protects against UCB-induced injury in neurocytes

To investigate the role of CST3 on UCB toxicity, we established CST3 overexpression and knockdown HT22 cells (Figure 1a and b), which were treated with UCB. We found that the viability of HT22 cells overexpressing CT3 increased, while the viability of CST3 knockdown HT22 cells decreased (Figure 1c). We then established a hyperbilirubinemic mouse model (Figure 1d) and found the decrease of frequency swimming across the platform and increase the mean distance to platform in hyperbilirubinemic mouse, while CST3 could reverse this phenomenon (Figure 1e and f). Besides, it showed anesis of hippocampus neurocytic injury induced by UCB in the CST3-treated group compared to that in the PBS-treated group (Figure 1g).

Figure 1 
                  CST3 alleviates injury to neurocytes in the high-dose UCB group: (a) CST3 mRNA expression levels, (b) CST3 protein expression levels, (c) viability of HT22 cells treated with UCB and CST3, (d) serum bilirubin contents of hyperbilirubinemic mice, (e) frequency swimming across the platform, (f) mean distance to platform, and (g) Masson staining in the brains of hyperbilirubinemic mice treated with CST3. CTL: control group; HBR: high-dose UCB group; DB: direct bilirubin; IB: indirect bilirubin. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001.
Figure 1

CST3 alleviates injury to neurocytes in the high-dose UCB group: (a) CST3 mRNA expression levels, (b) CST3 protein expression levels, (c) viability of HT22 cells treated with UCB and CST3, (d) serum bilirubin contents of hyperbilirubinemic mice, (e) frequency swimming across the platform, (f) mean distance to platform, and (g) Masson staining in the brains of hyperbilirubinemic mice treated with CST3. CTL: control group; HBR: high-dose UCB group; DB: direct bilirubin; IB: indirect bilirubin. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001.

3.2 Effects of CST3 on the solubility of UCB solubleness in a cell-free system and permeability in HT22 cells

To investigate the mechanism of the protective effect of CST3 on hyperbilirubinemia, we measured the solubility of UCB, and found that CST3 could increase the solubility of UCB in a cell-free system (Figure 2a), but it did not have significant difference compared with CTL (CST3 solvent, PBS). In addition, we found that CST3 decreases the permeability of HT22 cells (Figure 2b), but UCB permeability of HT22 cells did not change (Figure 2c). In addition, we found that UCB did not change the expression level of UGT1A1 (Figure 2d) and the activity of cytochrome P450 (Figure 2e).

Figure 2 
                  Effects of CST3 on UCB solubility in cell-free systems and permeability in HT22 cells: (a) UCB content in CTL and CST3 groups, (b) macromolecule permeability of HT22 cells of HBR and HBR + CST3 group, (c) UCB permeability in HT22 cells of HBR and HBR + CST3 groups, (d) expression level of UGT1A1, and (e) activity of cytochrome P450. CST3: adding CST3 protein; CST3+: CST3 overexpression; CST3−: CST3 knockdown. *p ≤ 0.05.
Figure 2

Effects of CST3 on UCB solubility in cell-free systems and permeability in HT22 cells: (a) UCB content in CTL and CST3 groups, (b) macromolecule permeability of HT22 cells of HBR and HBR + CST3 group, (c) UCB permeability in HT22 cells of HBR and HBR + CST3 groups, (d) expression level of UGT1A1, and (e) activity of cytochrome P450. CST3: adding CST3 protein; CST3+: CST3 overexpression; CST3−: CST3 knockdown. *p ≤ 0.05.

3.3 CST3 protects cells from UCB-induced damage by promoting autophagy

To further explore the mechanism of the protective effect of CST3 on hyperbilirubinemia, we studied the autophagy pathway and found that CST3 could enhance autophagy flux in HT22 cells (Figure 3a–e) and the protective effect could be inhibited by autophagy inhibitor bafilomycin A1 (Figure 3f). In addition, the effects of CST3 overexpression and knockdown vanished in the presence of autophagy activator rapamycin (Figure 3g).

Figure 3 
                  CST3 protects HT22 cells from UCB damage via promoting autophagy: (a) CST3 promotes HT22 cells autophagy, (b) mTOR, (c) pmTOR, (d) Beclin1, (e) LC3II/LC3I, (f) viability of HT22 cells treated with CST3 and autophagy inhibitor Bafilomycin A1, and (g) viability of HT22 cells treated with CST3 and autophagy activator rapamycin. HBR: high-dose UCB group; +: adding or overexpression; -: not adding; --: knockdown. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001.
Figure 3

CST3 protects HT22 cells from UCB damage via promoting autophagy: (a) CST3 promotes HT22 cells autophagy, (b) mTOR, (c) pmTOR, (d) Beclin1, (e) LC3II/LC3I, (f) viability of HT22 cells treated with CST3 and autophagy inhibitor Bafilomycin A1, and (g) viability of HT22 cells treated with CST3 and autophagy activator rapamycin. HBR: high-dose UCB group; +: adding or overexpression; -: not adding; --: knockdown. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001.

3.4 CST3 alleviates UCB-induced injury in neurocytes by promoting autophagy

We found enhanced autophagy in the neurocytes of CST3-treated high concentration bilirubin (HBR) mice by transmission electron microscopy (Figure 4).

Figure 4 
                  CST3 alleviates UCB-induced damage to neurocytes by promoting autophagy. Arrows: autophagosomes; triangle: mitochondria.
Figure 4

CST3 alleviates UCB-induced damage to neurocytes by promoting autophagy. Arrows: autophagosomes; triangle: mitochondria.

4 Discussion

We found that CST3 could reduce UCB toxicity by increasing the solubility of UCB, decreasing the permeability of HT22 cells, and promoting autophagy of HT22 cells. However, the effects of increasing solubility and decreasing permeability are intriguing. It might be because noncovalent binding between UCB and CST3 [11,12], which lead to the instability of the binding, and the permeability of UCB was almost unaffected by CST3. In addition, we found that UCB did not change the expression level of UGT1A1 and the activity of cytochrome P450. Autophagy played the most important role in CST3 inhibiting UCB neurotoxicity.

Effects of exogenous CST3 to enhance viability and autophagy of neurocytes suggest that CST3 might serve as a potential drug for the treatment of hyperbilirubinemia. In addition, CST3 is an endogenous protein and should have few side effects. Excessive CST3 is also excreted through urine.

In conclusion, we demonstrated that CST3 could alleviate UCB-induced damage to neurocytes by increasing UCB solubility, decreasing the permeability of neurocytes, and promoting autophagy, and that autophagy played the most important role in this process.

Acknowledgements

The authors thank Gabrielle White Wolf, PhD, from Liwen Bianji, Edanz Editing China (www.liwenbianji.cn/ac), for editing the English text of the draft of this manuscript.

  1. Funding information: This study was supported by Seed Foundation of Beijing Friendship Hospital (YYZZ202015) and the Natural Science Foundation of Capital Medical University (PYZ22062).

  2. Author contributions: Conceptualization, Yating Du; methodology, Zhenkun Li; software, Zhenkun Li; validation, Zhenkun Li and Yating Du; formal analysis, Zhenkun Li; investigation, Yating Du; resources, Zhenkun Li and Yating Du; data curation, Yating Du; writing – original draft preparation, Zhenkun Li; writing – review and editing, Yating Du; visualization, Yating Du. All authors have read and agreed to the published version of the manuscript.

  3. Conflict of interest: Authors state no conflict of interest

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Sullivan JI, Rockey DC. Diagnosis and evaluation of hyperbilirubinemia. Curr Opin Gastroenterol. 2017;33(3):164–70.10.1097/MOG.0000000000000354Search in Google Scholar PubMed

[2] França de Souza D, Alonso MA, Brito MM, Meirelles MG, Francischini MCP, Nichi M, et al. Oxidative state in equine neonates: anti- and pro-oxidants. Equine Vet J. 2021;53(2):379–84.10.1111/evj.13297Search in Google Scholar PubMed

[3] Tátrai P, Krajcsi P. Prediction of drug-induced hyperbilirubinemia by in vitro testing. Pharmaceutics. 2020;12(8):755.10.3390/pharmaceutics12080755Search in Google Scholar PubMed PubMed Central

[4] Hansen TWR, Wong RJ, Stevenson DK. Molecular physiology and pathophysiology of bilirubin handling by the blood, liver, intestine, and brain in the newborn. Physiol Rev. 2020;100(3):1291–1346.10.1152/physrev.00004.2019Search in Google Scholar PubMed

[5] Li S, Huang H, Zhang Y, Li L, Hua Z. Bilirubin induces A1-like reactivity of astrocyte. Neurochem Res. 2023;48(3):804–15.10.1007/s11064-022-03810-xSearch in Google Scholar PubMed

[6] Jain L. Why the premature brain is more prone to bilirubin-induced injury. Clin Perinatol. 2016;43(2):xv–xvi.10.1016/j.clp.2016.03.002Search in Google Scholar PubMed

[7] Lamb EJ. Cystatin C: why clinical laboratories should be measuring it. Ann Clin Biochem. 2015;52(Pt 6):709–11.10.1177/0004563215597012Search in Google Scholar PubMed

[8] Onopiuk A, Tokarzewicz A, Gorodkiewicz E. Cystatin C: a kidney function biomarker. Adv Clin Chem. 2015;68:57–69.10.1016/bs.acc.2014.11.007Search in Google Scholar PubMed

[9] Gauthier S, Kaur G, Mi W, Tizon B, Levy E. Protective mechanisms by cystatin C in neurodegenerative diseases. Front Biosci (Schol Ed). 2011;3(2):541–54.10.2741/s170Search in Google Scholar PubMed PubMed Central

[10] Xu L, Sheng J, Tang Z, Wu X, Yu Y, Guo H, et al. Cystatin C prevents degeneration of rat nigral dopaminergic neurons: in vitro and in vivo studies. Neurobiol Dis. 2005;18(1):152–65.10.1016/j.nbd.2004.08.012Search in Google Scholar PubMed

[11] Mustafa MF, Bano B. Bilirubin binding with liver cystatin induced structural and functional changes. J Fluoresc. 2014;24(3):967–74.10.1007/s10895-014-1381-4Search in Google Scholar PubMed

[12] Shah A, Bano B. Spectroscopic studies on the interaction of bilirubin with liver cystatin. Eur Biophys J. 2011;40(2):175–80.10.1007/s00249-010-0637-4Search in Google Scholar PubMed

[13] Li Z, Wang S, Huo X, Yu H, Lu J, Zhang S, et al. Cystatin C expression is promoted by VEGFA blocking, with inhibitory effects on endothelial cell angiogenic functions including proliferation, migration, and chorioallantoic membrane angiogenesis. J Am Heart Assoc. 2018;7(21):e009167.10.1161/JAHA.118.009167Search in Google Scholar PubMed PubMed Central

[14] Yang B, Xu J, Chang L, Miao Z, Heang D, Pu Y, et al. Cystatin C improves blood–brain barrier integrity after ischemic brain injury in mice. J Neurochem. 2020;153(3):413–25.10.1111/jnc.14894Search in Google Scholar PubMed

[15] Watanabe S, Hayakawa T, Wakasugi K, Yamanaka K. Cystatin C protects neuronal cells against mutant copper–zinc superoxide dismutase-mediated toxicity. Cell Death Dis. 2014;5(10):e1497.10.1038/cddis.2014.459Search in Google Scholar PubMed PubMed Central

[16] Li W, Sultana N, Siraj N, Ward LJ, Pawlik M, Levy E, et al. Autophagy dysfunction and regulatory cystatin C in macrophage death of atherosclerosis. J Cell Mol Med. 2016;20(9):1664–72.10.1111/jcmm.12859Search in Google Scholar PubMed PubMed Central

Received: 2023-04-12
Revised: 2023-09-05
Accepted: 2023-09-13
Published Online: 2023-10-16

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. HIF-1α participates in secondary brain injury through regulating neuroinflammation
  3. Omega-3 polyunsaturated fatty acids alleviate early brain injury after traumatic brain injury by inhibiting neuroinflammation and necroptosis
  4. The correlation between non-arteritic anterior ischemic optic neuropathy and cerebral infarction
  5. Enriched environment can reverse chronic sleep deprivation-induced damage to cellular plasticity in the dentate gyrus of the hippocampus
  6. Middle cerebral artery dynamic cerebral autoregulation is impaired by infarctions in the anterior but not the posterior cerebral artery territory in patients with mild strokes
  7. Leptin ameliorates Aβ1-42-induced Alzheimer’s disease by suppressing inflammation via activating p-Akt signaling pathway
  8. TIPE2 knockdown exacerbates isoflurane-induced postoperative cognitive impairment in mice by inducing activation of STAT3 and NF-κB signaling pathways
  9. Does the patellar tendon reflex affect the postural stability in stroke patients with blocked vision?
  10. Inactivation of CACNA1H induces cell apoptosis by initiating endoplasmic reticulum stress in glioma
  11. miR-101-3p improves neuronal morphology and attenuates neuronal apoptosis in ischemic stroke in young mice by downregulating HDAC9
  12. A custom-made weight-drop impactor to produce consistent spinal cord injury outcomes in a rat model
  13. Arterial spin labeling for moyamoya angiopathy: A preoperative and postoperative evaluation method
  14. Thyroid hormone levels paradox in acute ischemic stroke
  15. Geniposide protected against cerebral ischemic injury through the anti-inflammatory effect via the NF-κB signaling pathway
  16. The clinical characteristics of acute cerebral infarction patients with thalassemia in a tropic area in China
  17. Comprehensive behavioral study of C57BL/6.KOR-ApoEshl mice
  18. Incomplete circle of Willis as a risk factor for intraoperative ischemic events during carotid endarterectomies performed under regional anesthesia – A prospective case-series
  19. HOTAIRM1 knockdown reduces MPP+-induced oxidative stress injury of SH-SY5Y cells by activating the Nrf2/HO-1 pathway
  20. Esmolol inhibits cognitive impairment and neuronal inflammation in mice with sepsis-induced brain injury
  21. EHMT2 affects microglia polarization and aggravates neuronal damage and inflammatory response via regulating HMOX1
  22. Hematoma evacuation based on active strategies versus conservative treatment in the management of moderate basal ganglia hemorrhage: A retrospective study
  23. Knockdown of circEXOC6 inhibits cell progression and glycolysis by sponging miR-433-3p and mediating FZD6 in glioma
  24. CircYIPF6 regulates glioma cell proliferation, apoptosis, and glycolysis through targeting miR-760 to modulate PTBP1 expression
  25. Relationship between serum HIF-1α and VEGF levels and prognosis in patients with acute cerebral infarction combined with cerebral-cardiac syndrome
  26. The promoting effect of modified Dioscorea pills on vascular remodeling in chronic cerebral hypoperfusion via the Ang/Tie signaling pathway
  27. Effects of enriched environment on the expression of β-amyloid and transport-related proteins LRP1 and RAGE in chronic sleep-deprived mice
  28. An interventional study of baicalin on neuronal pentraxin-1, neuronal pentraxin-2, and C-reactive protein in Alzheimer’s disease rat model
  29. PD98059 protects SH-SY5Y cells against oxidative stress in oxygen–glucose deprivation/reperfusion
  30. TPVB and general anesthesia affects postoperative functional recovery in elderly patients with thoracoscopic pulmonary resections based on ERAS pathway
  31. Brain functional connectivity and network characteristics changes after vagus nerve stimulation in patients with refractory epilepsy
  32. Association between RS3763040 polymorphism of the AQP4 and idiopathic intracranial hypertension in a Spanish Caucasian population
  33. Effects of γ-oryzanol on motor function in a spinal cord injury model
  34. Electroacupuncture inhibits the expression of HMGB1/RAGE and alleviates injury to the primary motor cortex in rats with cerebral ischemia
  35. Effects of edaravone dexborneol on neurological function and serum inflammatory factor levels in patients with acute anterior circulation large vessel occlusion stroke
  36. CST3 alleviates bilirubin-induced neurocytes’ damage by promoting autophagy
  37. Excessive MALAT1 promotes the immunologic process of neuromyelitis optica spectrum disorder by upregulating BAFF expression
  38. Evaluation of cholinergic enzymes and selected biochemical parameters in the serum of patients with a diagnosis of acute subarachnoid hemorrhage
  39. 7-Day National Institutes of Health Stroke Scale as a surrogate marker predicting ischemic stroke patients’ outcome following endovascular therapy
  40. Cdk5 activation promotes Cos-7 cells transition towards neuronal-like cells
  41. 10.1515/tnsci-2022-0313
  42. PPARα agonist fenofibrate prevents postoperative cognitive dysfunction by enhancing fatty acid oxidation in mice
  43. Predicting functional outcome in acute ischemic stroke patients after endovascular treatment by machine learning
  44. EGCG promotes the sensory function recovery in rats after dorsal root crush injury by upregulating KAT6A and inhibiting pyroptosis
  45. Preoperatively administered single dose of dexketoprofen decreases pain intensity on the first 5 days after craniotomy: A single-centre placebo-controlled, randomized trial
  46. Myeloarchitectonic maps of the human cerebral cortex registered to surface and sections of a standard atlas brain
  47. The BET inhibitor apabetalone decreases neuroendothelial proinflammatory activation in vitro and in a mouse model of systemic inflammation
  48. Carthamin yellow attenuates brain injury in a neonatal rat model of ischemic–hypoxic encephalopathy by inhibiting neuronal ferroptosis in the hippocampus
  49. Functional connectivity in ADHD children doing Go/No-Go tasks: An fMRI systematic review and meta-analysis
  50. Review Articles
  51. Human prion diseases and the prion protein – what is the current state of knowledge?
  52. Nanopharmacology as a new approach to treat neuroinflammatory disorders
  53. Case Report
  54. Deletion as novel variants in VPS13B gene in Cohen syndrome: Case series
  55. Commentary
  56. Translation of surface electromyography to clinical and motor rehabilitation applications: The need for new clinical figures
  57. Revealing key role of T cells in neurodegenerative diseases, with potential to develop new targeted therapies
  58. Retraction
  59. Retraction of “Eriodictyol corrects functional recovery and myelin loss in SCI rats”
  60. Special Issue “Advances in multimedia-based emerging technologies...”
  61. Evaluation of the improvement of walking ability in patients with spinal cord injury using lower limb rehabilitation robots based on data science
Downloaded on 28.10.2025 from https://www.degruyterbrill.com/document/doi/10.1515/tnsci-2022-0314/html
Scroll to top button