Skip to main content
Article Open Access

Molecular cloning, characterization and evolutionary analysis of leptin gene in Chinese giant salamander, Andrias davidianus

  • , , and EMAIL logo
Published/Copyright: November 23, 2017

Abstract

Leptin is an important hormone possessing diverse physiological roles in mammals and teleosts. However, it has been characterized only in a few amphibian species, and its evolutions are still under debate. Here, the full length of the leptin (Adlep) cDNA of Chinese giant salamander (Andrias davidianus), an early diverging amphibian species, is characterized and according to the results of the primary sequence analysis, tertiary structure reconstruction and phylogenetic analysis is confirmed to be an ortholog of mammalian leptin. An intron was identified between the coding exons of A. davidianus leptin, which indicated that the leptin is present in the salamander genome and contains a conserved gene structure in vertebrates. Adlep is widely distributed but expression levels vary among different tissues, with highest expression levels in the muscle. Additionally, the leptin receptor and other genes were mapped to three known leptin signaling pathways, suggesting that the leptin signaling pathways are present in A. davidianus. Phylogenetic topology of leptins are consistent with the generally accepted evolutionary relationships of vertebrates, and multiple leptin members found in teleosts seem to be obtained through a Cluopeocephala-specific gene duplication event. Our results will lay a foundation for further investigations into the physiological roles of leptin in A. davidianus.

1 Introduction

Leptin, the protein product of the obese (ob or Lep) gene, was first cloned in ob/ob mice [1], and then was identified in human and other mammals (reviewed in [2]). Leptins also were identified in non-mammalians, including birds [3,4,5], reptiles [2], amphibians [6,7,8], and teleosts, the later generally possess duplicated leptins [8,9,10,11,12,13,14,15]. Leptin has been found to be responsible for the regulation of body weight and energy homeostasis [16,17], and it also is involved in regulating appetite, reproduction [18], the immune system [19], bone formation [20], angiogenesis [21], and stress response [22,23].

The primary amino acid sequences of leptins show low conservation among vertebrates. The identity of the leptin protein in Xenopus to that of pufferfish, human, and tiger salamander (Ambystoma tigrinum) is 13%, 35%, and 60%, respectively [6,7,9]. Although, positive selections of leptins are revealed in several mammal lineages, for example, pikas (Ochotona curzoniae), Cetacea and Pinnipedia, and heterothermic bats [24,25,26], the conserved gene structure (three exons separated by two introns) and secondary and tertiary structures of leptins were found from teleosts to mammals [2,3,6,11,27,28]. Phylogeny reconstruction of vertebrate leptins showed that most vertebrates form distinct clades with topology consistent with the generally accepted vertebrate topology except that the relationships among teleosts remain inconsistent [2,11,29].

Leptin is mainly expressed in adipose tissue, stomach and liver in mammals [2], however, expression of leptins in non-mammalians is variable. For example, leptin mRNA is widely distributed in brain, pituitary and heart tissue in frogs [6], different individuals show different tissue distributions in tiger salamander [7], and different tissue expressions among taxa in teleosts, such as mainly expressed in liver in most fish species [29], weakly and transiently expressed in adipose of rainbow trout (Oncorhynchus mykiss) [30], and widely expressed in tilapia [31]. Interestingly, leptins seem to exert pleiotropic effects in both mammals and non-mammalians [2,3,6,29,32,33,34]. For example, leptins possess roles in food intake and energy metabolism in mammals [35,36], growth and reproduction in birds [3], growth and development of the hind limb in X. laevis [6], and food intake and reproduction in teleosts [37,38]. Generally, more diverse physiological roles have been characterized in teleosts in contrast to those found in mammals [39]. Hence, the evolution of multiple functional leptins becomes an interesting question. However, due to the inconsistency of the phylogenetic analysis of leptins, especially for those teleostean homologs [2,29,40,41], identifying more leptins and characterizing their physiological roles in non-mammals, especially in amphibians, would help to address this question. To our knowledge, leptin had only been characterized in two amphibian species, in which they are involved in regulating food intake, growth rate, and bone and lung development [6,7,42,43].

The Chinese giant salamander (A. davidianus) belongs to the family Cryptobranchidae, which is thought to be a primitive group within the Caudata based on molecular and fossil evidence [44,45,46]. Moreover, a rapidly growing industry to farm this species has been developed throughout China during past two decades [47], which is mainly based on controlled artificial propagation [48] and ecological breeding methods [49]. Noticeably, significant weight differences (5- to 15-fold) have been found in one- and two-year-old artificial propagated populations (unpublished data), which led us to identify and characterize leptin in A. davidianus. Therefore, the objectives of the present study were: (1) to clone and analyze the characteristics of leptin genes in A. davidianus; (2) to examine the tissue distribution of the genes in A. davidianus; and (3) to investigate the evolution of the leptin gene in vertebrates.

2 Materials and Methods

2.1 Sample collection

The individuals of A. davidianus used in this study were cultured in Yangtze River Fisheries Research Institute, Chinese Academy of Fisheries Science. Three one-year-old male salamanders were anesthetized according to the standards of the Chinese Council on Animal Care. Organ tissues, including kidney, spleen, lung, stomach, skin, muscle, intestine, gonad, heart, liver, brain, and pituitary gland, were collected and preserved in RNA Lock Stabilizer Reagent (E.Z.N.A.® RNA-Lock Reagent; Omega Bio-Tek Inc.) for RNA extraction.

2.2 Cloning the full-length cDNA and intronic DNA of Adlep

Total RNA of 12 tissues were isolated using TRIZOL (Takara, Dalian, China) based on the manufacturer’s protocol, and then tissues were treated with DNase I (THERMO SCIENTIFIC) to remove genomic DNA and used as templates for the following experiments. The first stand of cDNA was obtained by using SuperScript III transcriptase (Invitrogene, Carlsbad, CA, USA) following the manufacturer’s instructions. One annotated leptin gene sequence (m.112490) was found in the transcriptome of A. davidianus in our previous work [50]. Here, the internal region of leptin in A. davidianus was obtained by using one pair of primers designed according to the partial sequence of leptin in A. davidianus mentioned above (Table 1). Then, based on the obtained sequence, primers were designed (Table 1) and the 5’- and 3’- terminus were obtained by using 5’- and 3’- RACE System (Clontech, Palo Alto, CA, USA) according to the manufacturer’s recommendations. PCR amplification products were examined by electrophoresis using 1% agarose gel with the DL2000 marker (Takara, Dalian, China). The purified sequence fragments were cloned into a pMD-18 T vector and sequenced. All obtained sequence data were assembled using the LasergeneSeqMan program (DNAStar, Madison, WI, USA). Prediction of Open Reading Frames (ORF) was carried out using the EditSeq program (DNASTAR). The sequence of the signal peptide was predicted using the program SignalP 4.1 (http://www.cbs.dtu.dk/services/SignalP/) [51]. The domains were predicted on the Pfam server (http://pfam.xfam.org/).

Table 1

Primers used in this study

ExperimentsPrimer Names5’-3’ sequence
Internal region 1Adlep_f: :GGAAAGCCAGGGAACCCAA
Adlep_r:TGCTCCAGATGTTTGACGATGTTAT
5’RACEAdlep5’-1:ATCTCCAGGGTCTCAT
Adlep5’-2:TGCTCTCCTGGGATGAAGTC
Adlep5’-3:AAGGAACTGGCAGGGGTG
3’RACEAdlep 3’ -1:AGGAGTACGCCAAGTCCCCATACA
Adlep 3’ -2:CCATAACATCGTCAAACATCCG
qPCRAdlep-F2AGAACCTCCGAAGCCTTCTC
Adlep-R2CCCAAAAGCCAACCGAGAAA
Controlβ-actin-F1CCCAAAAGCCAACCGAGAAA
β-actin-R1GACACCATCACCAGAGTCCA
Intron-cloningF1:AAAATGCGCTACCCTGGT
R1:CAGGGGTGGTCCTGTAGTC
F2:GCCAGACTACAGGACCAC
R2:ATCTCCAGGGTCTCAT
F3:TGGACTCTGTGGATGAGAC
R3:AGCTCAGGGTCTTCCGTGTC
F4:CTGCTCGGCTGTACGACAC
R4:TCCTCAGCAGCTCGTAGC

For the quantitative real-time PCR (qPCR) analysis, total RNA from 12 different tissues were extracted, and their first-strand cDNAs were synthesized as mentioned above. The qPCR was performed on a BIO-RAD Connect™ CFX using Power SYBR® Green PCR Master Mix. The specific primers for qPCR are listed in Table 1. The reaction contained: 10 μL of 2× PCR Master Mix, 1 μL of forward primer, 1 μL of reverse primer, 1 μL of cDNA template, and 7 μL of H2O. The PCR protocols were as follows: initial denaturation at 95°C for 2 min, 40 cycles of 95°C for 10 s, 55°C for 20 s, 72°C for 20 s. The melting curves were analyzed at 65–95°C after 40 cycles. Each PCR analysis was performed in triplicate. Relative expression analysis is normalized against the β-actin. The values were expressed as mean ± standard error of the mean (SEM). The expression difference was analyzed by one-way ANOVA with Tukey adjustment using GraphPad Prism Software (GraphPad Software Inc., San Diego, CA, USA). Significance was set at P < 0.05.

In order to obtain the genomic sequence of the leptin in A. davidianus, genomic DNA of muscle was isolated using the Blood & Cell Culture DNA Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s recommendations. Primers for PCR amplification of the leptin gene intron are listed in Table 1. The obtained PCR products were sequenced and then assembled by using DNASTAR. The intron was characterized by using sequence alignment of the obtained genomic region with the full length cDNA.

2.3 Tertiary structural analysis

The predicted amino acid sequence of Adlep gene was used as query to Blast search against the Protein Data Bank (PDB)to obtain the template protein based on sequence homology. The X-ray structure of the Crystal structure of the human obesity protein, leptin (Chain A) was the best mold found (PDBID: 1AX8) [1]. Thus, the human obesity protein leptin (Chain A) was used as template to analyze the structural model of the enzyme Adlep in A. davidianus.

The template and target sequences were aligned using the align2d script available in comparative protein modeling program MODELLER9v14 [52,53,54]. After alignment, a bundle of 20 models from random generation of the starting structure was calculated, and the best one was selected according to the lowest molpdf and DOPE score implemented within Modeller [52,53,54]. The selected best model was further subjected to loop refinement in Modeller. To gain better relaxation and a more correct arrangement of the atoms, the best model after loop refinement was further subjected to energy minimization by GROMOS96 force field provided by Swiss-Pdb Viewer V4.1.0 [55] using the steepest descent method of 200 steps. The predicted model also was subjected to energy minimization using the steepest descent technique to check for non-compatible contacts within the protein. Computations were carried out in vacuo with the GROSMOS96 43B1 parameters set, implemented through Swiss-pdb Viewer [56] with default settings. The obtained model was then validated using Ramachandran plot with the PROCHECK program [57] (a Windows version prepared by Bernhard Rupp, http://www.ruppweb.org/ftp_warning.html) and the overall quality factor with Errat on the Structural Analysis and Verification Server (http://nihserver.mbi.ucla.edu/SAVES/).

2.4 Phylogeny analysis

The full-length Adlep gene sequence was used as a query to search against the NCBI Refseq protein database to obtain leptin homologs in other species, and then they were extracted along with corresponding nucleotide sequences. Amino-acid sequences were aligned using MUSCLE (version 3.8.31) [58] and ambiguous regions were removed manually. Phylogenetic analyses were conducted using Bayesian inference and Maximum-Likelihood (ML) methods. Bayesian inference was carried out in MrBAYES v3.2.2 [59] using the Metropolis-coupled Markov chain Monte Carlo (MCMCMC) algorithm, with four incrementally heated Markov chains, sampled every 1,000 generations with the temperature set to 0.5. Amino acid site substitution rate heterogeneity was corrected with an invariable and eight Γ-distributed substitution rate categories and the Whelan and Goldman (WAG) model for amino acid substitutions, abbreviated herein as WAG+I+8G. Two separate runs were performed to confirm the convergence of the chains. The average standard deviation of split frequencies and the potential scale reduction factor convergence diagnostic were used to assess the convergence of the two runs. Trees below the observed stationarity level were discarded, resulting in a ‘burnin’ that comprising of 25% of the posterior distribution of trees. The 50% majority-rule consensus tree was determined to calculate the posterior probabilities for each node. The ML tree was inferred with FastTree 2.1.3 [60], with default Jones-Taylor-Thornton (JTT) amino acid substitution matrix and the “CAT” approximation model to account for rate across sites; parameters recommended by the authors were used to improve the effectiveness of the tree search at a slight cost of increased running time (flags: -spr 4 -mlacc 2 -slownni) as described by Beiko et al. [61].

2.5 Mining the leptin signaling pathway in A. davidianus

Leptin (http://www.kegg.jp/dbget-bin/www_bget?K05424) mediates its effects by binding to its receptor (leptin receptor or LEPR), which activates the following signaling pathways within the cell, such as the Janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway (ko04630), AMP-activated protein kinase (AMPK) signaling pathway (ko04152), adipocytokine signaling pathway (ko04920). In order to investigate whether the leptin signaling pathways are present in A. davidianus, our previously assembled transcriptome was subjected to analysis against the Kyoto Encyclopedia of Genes and Genomes (KEGG) to assign their functions to the known biological pathways.

3 Results

3.1 Cloning and sequence analysis of the leptin in A. davidianus

One full length coding sequences (CDS) of leptin named as Adlep was obtained in A. davidianus and deposited into GenBank under the accession number KX241573. The one leptin sequence segment found in the transcriptomic sequences of A. davidianus in our previous work was confirmed to be the internal region of the Adlep. The obtained Adlep is composed of a 169 bp 5’UTR sequence, a 1,232 bp 3’ UTR sequence, and a 510 bp CDS sequence encoding a protein of 169 amino acids with a calculated molecular mass of 19.33 kDa and an estimated isoelectric point of 5.88. Typical polyadenylation signal (AATAAA) and poly (A) stretch signal are found (Fig. 1). The predicted Adlep protein sequence contains a signal peptide composed of 21 amino acid N-terminal residues (Fig. 1). One leptin domain (PF02024) was characterized using the Pfam server.

Fig. 1 Nucleotide and deduced amino acid sequences of the Adlep in A. davidianus. The intron sequence is shown in lowercase and exon sequence in uppercase. Start codon (ATG) and putative stop codon (TGA) are shown in red. The predicted signal peptides are shown in bold. The termination codon is marked with an asterisks. Two cysteine residues are marked in circle. The GenBank accession number is KX241573. PolyA signals are indicated by underline.
Fig. 1

Nucleotide and deduced amino acid sequences of the Adlep in A. davidianus. The intron sequence is shown in lowercase and exon sequence in uppercase. Start codon (ATG) and putative stop codon (TGA) are shown in red. The predicted signal peptides are shown in bold. The termination codon is marked with an asterisks. Two cysteine residues are marked in circle. The GenBank accession number is KX241573. PolyA signals are indicated by underline.

Using four intron primer pairs, the genomic sequence of Adlep gene was obtained and sequenced to be 1,415 bp (Fig. 2). Sequence alignment revealed that two exons were present in the genomic sequence of the Adlep gene, which corresponds to exon 2 and 3 in other vertebrates. Additionally, one intron with 906 bp was found in the genomic sequence of Adlep gene (Fig. 2). The intron of the Adlep gene started as GT and ended as AG (Fig. 1), and its length was shorter than that of the second intron in other tetrapods while longer than that of teleosts (Fig. 2).

Fig. 2 Leptin gene structure of A. davidianus. Exons are shown in dark shading, introns are shown as lines with length marked above, and undetermined genomic regions are shown with a dashed line.
Fig. 2

Leptin gene structure of A. davidianus. Exons are shown in dark shading, introns are shown as lines with length marked above, and undetermined genomic regions are shown with a dashed line.

Two conserved cysteine residues in positions from 119 aa to 169 aa forming a disulfide bond, which is revealed to be present in all the leptin sequences of tetrapods, including Adlep (Fig. 1 & Fig. 3). Furthermore, the most highly conserved regions among tetrapod leptins also were present (Fig. 3).

Fig. 3 Multiple amino acid sequence alignment of leptins from the mouse (Accession No. P41160), rat (P50596), cow (P50595), pig (Q29406), dog (O02720), human (P41159), fat-tailed dunnart (Sminthopsis crassicaudata, a marsupial) (Q9XSW9), Xenopus laevis (AY884210), tiger salamander (Ambysto matigrinum) (AAY68394.1), Japanese fire belly newt (Cynops pyrrhogaster) (comp395199_c0_seq1), and Chinese giant salamander (A. davidianus) (KX241573). Alignment was performed by Clustal X 1.83 with default parameters. Note that all amphibian leptins comprise of 169 amino acids and all mammalian sequences comprises of 167 amino acids. Two conserved cysteine residues (positions 119 and 169 of the salamander sequence) forming a lasso knot are indicated by arrowheads. The mature peptide begins at position 22 of all these tetrapod sequences as indicated by a vertical line. Boxed regions are the most highly conserved sequences among tetrapod leptins.
Fig. 3

Multiple amino acid sequence alignment of leptins from the mouse (Accession No. P41160), rat (P50596), cow (P50595), pig (Q29406), dog (O02720), human (P41159), fat-tailed dunnart (Sminthopsis crassicaudata, a marsupial) (Q9XSW9), Xenopus laevis (AY884210), tiger salamander (Ambysto matigrinum) (AAY68394.1), Japanese fire belly newt (Cynops pyrrhogaster) (comp395199_c0_seq1), and Chinese giant salamander (A. davidianus) (KX241573). Alignment was performed by Clustal X 1.83 with default parameters. Note that all amphibian leptins comprise of 169 amino acids and all mammalian sequences comprises of 167 amino acids. Two conserved cysteine residues (positions 119 and 169 of the salamander sequence) forming a lasso knot are indicated by arrowheads. The mature peptide begins at position 22 of all these tetrapod sequences as indicated by a vertical line. Boxed regions are the most highly conserved sequences among tetrapod leptins.

The identity between the 1AX8 protein sequence in human and Adlep protein sequence in A. davidianus is 35.62%, which is sufficient to use the 1AX8 protein model as a template to yield a reliable model. One model (Adleptin.B99990017.pdb) of the twenty models generated by Modeller9v14 was selected based on the lowest DOPE score (-15826.54688 KJ/mol), and then it was further subjected to loop refinement with loop.py. The best model was selected and subjected to energy minimization. The Procheck analysis showed 90.2% amino acids in core, 9.1% amino acids in allow, 0.0% in gener, and 0.8% in disallowed in the Ramachandran plot, and the Errat analysis showed that the overall quality factor of the model rose to 86.466 from the original 77.206. These results supported the reliability of the modelled Adlep protein in A. davidianus. Superposition of the α-carbon skeleton of the template human leptin models (1AX8) and the theoretical model of Adlep showed that the root mean square deviation (rms deviation) is 0.51 Å, indicating a remarkable similarity of the structural conformation between the Adlep theoretical model with the previous experimental model, and that Adlep does not have major conformational differences with the initial model. The predicted structure of Adlep in A. davidianus showed a tertiary structure of a bundle of four main helices (Fig. 4).

Fig. 4 (a)The predicted three-dimensional model of the Adlep protein; and (b) superimposition of Adlep protein with the leptin of human (1AX8).
Fig. 4

(a)The predicted three-dimensional model of the Adlep protein; and (b) superimposition of Adlep protein with the leptin of human (1AX8).

3.2 Expression of Adlep in A. davidianus tissues

The distribution of salamander leptin expression was studied by qPCR on mRNA isolated from a variety of tissues in three one-year-old male individuals. As shown in Figure 5, expression levels differed significantly among different tissues, with high expression in muscle, moderate expression in skin, and weak expression in other tissues (i.e. heart, pituitary, liver, intestine, lung, spleen, kidney, stomach, and gonad). The tissue expression profiles shows light difference from our preliminary expression analysis using one female individual (Supplementary Fig. 1).

Fig. 5 Expressions of Adlep in tissues of A. davidianus by using qPCR. I= intestine; P= pituitary; Lu= lung; Li= liver; M = muscle; B = brain; Sk = skin; Sp = spleen; K = kidney; St = stomach; H = heart; and G = gonad. Expression levels were normalized to the expression of the β-actin gene (β-actin). Data were analyzed by one-way ANOVA with Tukey adjustment using GraphPad Prism Software (GraphPad Software Inc., San Diego, CA, USA). Values expressed as mean ± SEM. Different letters indicate significant differences (P<0.05).
Fig. 5

Expressions of Adlep in tissues of A. davidianus by using qPCR. I= intestine; P= pituitary; Lu= lung; Li= liver; M = muscle; B = brain; Sk = skin; Sp = spleen; K = kidney; St = stomach; H = heart; and G = gonad. Expression levels were normalized to the expression of the β-actin gene (β-actin). Data were analyzed by one-way ANOVA with Tukey adjustment using GraphPad Prism Software (GraphPad Software Inc., San Diego, CA, USA). Values expressed as mean ± SEM. Different letters indicate significant differences (P<0.05).

3.3 Phylogenetic analysis of leptin

Both the Bayesian inference and Maximum Likelihood (ML) trees showed similar topologies, therefore, we chose to display the Bayesian tree as a representative with the support values of ML tree also on the tree. Phylogenetic reconstruction revealed that the topologies of vertebrate leptins are consistent with the general understanding of the evolution of vertebrates, corresponding to clades of mammals, birds, reptiles, amphibians and fishes, and that Adlep is recovered from the amphibian clade consisting of homologs of other amphibians (Fig. 6). Except for the basal position of leptins in Latimeria chalumnae, Lepisosteus oculatus, and Anguilla anguilla, all other leptins of Teleostei were recovered into two high-supporting clades, corresponding to leptin A and leptin B respectively (Fig. 6 and Supplementary Fig. 2).

Figure 6 Phylogenetic tree of 78 vertebrate leptins, which was reconstructed using MrBayes 3.2.2 with 202 aligned amino acid sites. The Geninfo Identifier (GI) number of each sequence is given after species name (A. davidianus: KX241573; A. tigrinum: AAY68394.1; C. pyrrhogaster: comp395199_c0_seq1). Numbers at the nodes correspond to the bootstrap value of the ML tree (on the right of slashes) and the Bayesian posterior probabilities more than 0.50 (on the left of slashes). Scale bar, substitutions per position.
Figure 6

Phylogenetic tree of 78 vertebrate leptins, which was reconstructed using MrBayes 3.2.2 with 202 aligned amino acid sites. The Geninfo Identifier (GI) number of each sequence is given after species name (A. davidianus: KX241573; A. tigrinum: AAY68394.1; C. pyrrhogaster: comp395199_c0_seq1). Numbers at the nodes correspond to the bootstrap value of the ML tree (on the right of slashes) and the Bayesian posterior probabilities more than 0.50 (on the left of slashes). Scale bar, substitutions per position.

3.4 Leptin signaling pathways in A. davidianus

Through the KEGG annotation of our transcriptome, a total of 577 unigenes are assigned to 184 KEGG orthology (KO) identifiers, and the leptin receptor and other genes belong to subsequent signaling pathways were found. The three leptin signaling pathways were reconstructed as shown in Figure 7 (and Supplementary Fig. 2).

Fig. 7 The reconstructed Adipocytokine signaling pathway (ko04920) in A. davidianus (the presence of corresponding genes is shown in red).
Fig. 7

The reconstructed Adipocytokine signaling pathway (ko04920) in A. davidianus (the presence of corresponding genes is shown in red).

4 Discussion

Leptins have been characterized and demonstrated to possess pleiotropic roles in many vertebrates over the past two decades [62]. Interestingly, leptins have been shown to be involved in early development [63] and innate immune response [64], and to be associated with growth rate [65,66,67,68,69] in different vertebrates. The JAK/STAT pathway is found to be conserved between frogs and mammals [70], suggesting conservation of the leptin signaling mechanism across vertebrate groups. More diverse physiological roles have been characterized in teleosts than those found in mammals [39]. However, further studies are needed to clarify the conservation and evolution of the physiological roles of leptin in diverse vertebrate groups. Here, one full length cDNA of Adlep was obtained in A. davidianus (Fig. 1). The gene organization of Adlep in A. davidianus is similar to that of human, X. laevis and Takifugu [6,9,28], which suggested that the leptin present in the salamander genome though the length of the second intron is between those of other tetrapods and those of teleosts (Fig. 2). Further homolog searching, domain and tertiary structure analysis, and phylogenetic analysis showed that the identified Adlep is the ortholog of mammalian leptins. Furthermore, the characterization of two cysteine residues and conserved regions and determination of the 3D structure suggests that Adlep could bind to the leptin receptor and trigger the subsequent signaling pathways. Interestingly, we found broad tissue expression of Adlep in muscle, skin, heart, testis, pituitary, liver, kidney, spleen, and stomach, and the muscle and skin showed the highest expression levels (Fig. 5), which is similar in X. laveis, A. tigrinum and teleosts [2,6,7,15] and different from the restricted expression in mammals [16,71,72]. Noticeably, the expression patterns of Adlep in these three male individuals also differed from that of our preliminary work with one female individual (one-year-old), with high expression in skin, kidney, stomach, liver, and ovary (Supplementary Fig. 1).The expression level variation among individuals might be explained by different nutritional state among individuals or caused by seasonal variation as the samples in these two different expression analyses were collected at different times. This phenomenon also has been reported in A. tigrinum [7]. Altogether, the wide tissue distribution of Adlep seems different from the relatively restricted expression distribution of mammalian leptins. The different expression pattern of leptins among different vertebrate groups remains to be clarified in future. The presence of leptin receptor and the subsequent leptin signaling pathways (i.e. JAK/STAT, AMPK, and adipocytokine) in A. davidianus suggests that the conservation of the leptin signaling pathway could be traced back to the ancestor of Tetrapoda, and that Adlep might be correlated with homeostasis, energy status, and lipid regulating. Hence it would be interesting to investigate the potential physiological roles of Adlep in future studies, such as identification and association analyses of polymorphisms in Adlep with growth traits among different individuals in farmed populations of A. davidianus because significant growth rate differences among different individuals of different ages have been found.

The evolution of leptin is still under debate considering the presence of multiple copies in teleost fish [2,62,73]. Here, the overall topology of the leptins in vertebrates is consistent with the general accepted evolutionary relationships of vertebrates (Fig. 5). Noticeably, two leptins in Anolis carolinensis are clustered together as reported previously [2], indicating that they are obtained through species specific gene duplication. Moreover, leptins in Lepisosteus oculatus and Anguilla anguilla are branched first, and then leptins of other teleosts are generally recovered into two subclades, leptin A and leptin B, which are generally consistent with another research reported previously [41], indicating that the multiple leptins in teleost are obtained through gene duplication that occurred in the ancestor of Cluopeocephala. Given the conserved tertiary structures from teleosts to mammals [2,34], the diverse physiological roles of leptins in different vertebrates characterized to date [74], and the common intracellular signaling pathways presented in all Tetrapoda as suggested by this research, the phylogenetic topology of vertebrate leptins obtained in this research suggest that it would be very interesting to detect whether there are different regulation mechanisms for pleiotropic roles or expressions of leptins throughout evolution.

Acknowledgement

This work was supported by the Central Public-interest Scientific Institution Basal Research Fund, CAFS (NO. 2016JBF0305). The authors also would like to thank anonymous reviewers who gave valuable suggestion that has helped to improve the quality of the manuscript.

  1. Conflict of interest: Authors state no conflict of interest.

  2. Ethical approval: The research related to animals use has been complied with all the relevant national regulations and institutional policies for the care and use of animals.

Reference

[1] Zhang Y., Proenca R., Maffei M., Barone M., Leopold L., Friedman J.M., Positional cloning of the mouse obese gene and its human homologue, Nature, 1994, 372, 425-43210.1038/372425a0Search in Google Scholar PubMed

[2] Denver R.J., Bonett R.M., Boorse G.C., Evolution of leptin structure and function, Neuroendocrinology, 2011, 94, 21-3810.1159/000328435Search in Google Scholar PubMed

[3] Friedman-Eina M., Cogburn L.A., Yosefi S., Hen G., Shinder D., Shirak A., et al., Discovery and characterization of the first genuine avian leptin gene in the rock dove (Columba livia), Endocrinology, 2014, 155, 3376-338410.1210/en.2014-1273Search in Google Scholar PubMed

[4] Seroussi E., Cinnamon Y., Yosefi S., Genin O., Smith J.G., Rafati N., et al., Identification of the long-sought leptin in chicken and duck: Expression pattern of the highly GC-rich avian leptin fits an autocrine/paracrine rather than endocrine function, Endocrinology, 2016, 157, 737-75110.1210/en.2015-1634Search in Google Scholar PubMed

[5] Prokop J.W., Duff R.J., Ball H.C., Copeland D.L., Londraville R.L., Leptin and leptin receptor: analysis of a structure to function relationship in interaction and evolution from humans to fish, Peptides, 2012, 38, 326-33610.1016/j.peptides.2012.10.002Search in Google Scholar PubMed PubMed Central

[6] Crespi E.J., Denver R.J., Leptin (ob gene) of the South African clawed frog Xenopus laevis, Proc. Natl. Acad. Sci. U. S. A., 2006, 103, 10092-1009710.1073/pnas.0507519103Search in Google Scholar PubMed PubMed Central

[7] Boswell T., Dunn I.C., Wilson P.W., Joseph N., Burt D.W., Sharp P.J., Identification of a non-mammalian leptin-like gene: characterization and expression in the tiger salamander (Ambystoma tigrinum), Gen. Comp. Endocrinol., 2006, 146, 157-16610.1016/j.ygcen.2005.08.001Search in Google Scholar PubMed

[8] Froiland E., Murashita K., Jorgensen E.H., Kurokawa T., Leptin and ghrelin in anadromous Arctic charr: cloning and change in expressions during a seasonal feeding cycle, Gen. Comp. Endocrinol., 2010, 165, 136-14310.1016/j.ygcen.2009.06.010Search in Google Scholar PubMed

[9] Kurokawa T., Uji S., Suzuki T., Identification of cDNA coding for a homologue to mammalian leptin from pufferfish, Takifugu rubripes, Peptides, 2005, 26, 745-75010.1016/j.peptides.2004.12.017Search in Google Scholar PubMed

[10] Angotzi A.R., Stefansson S.O., Nilsen T.O., Rathore R.M., Ronnestad I., Molecular cloning and genomic characterization of novel leptin-like genes in salmonids provide new insight into the evolution of the Leptin gene family, Gen. Comp. Endocrinol., 2013, 187, 48-5910.1016/j.ygcen.2013.03.022Search in Google Scholar PubMed

[11] Gorissen M., Bernier N.J., Nabuurs S.B., Flik G., Huising M.O., Two divergent leptin paralogues in zebrafish (Danio rerio) that originate early in teleostean evolution, J. Endocrinol., 2009, 201, 329-33910.1677/JOE-09-0034Search in Google Scholar

[12] Kurokawa T., Murashita K., Genomic characterization of multiple leptin genes and a leptin receptor gene in the Japanese medaka, Oryzias latipes, Gen. Comp. Endocrinol., 2009, 161, 229-23710.1016/j.ygcen.2009.01.008Search in Google Scholar

[13] Murashita K., Uji S., Yamamoto T., Ronnestad I., Kurokawa T., Production of recombinant leptin and its effects on food intake in rainbow trout (Oncorhynchus mykiss), Comp. Biochem. Physiol. B. Biochem. Mol. Biol., 2008, 150, 377-38410.1016/j.cbpb.2008.04.007Search in Google Scholar

[14] Li G.G., Liang X.F., Xie Q., Li G., Yu Y., Lai K., Gene structure, recombinant expression and functional characterization of grass carp leptin, Gen. Comp. Endocrinol., 2010, 166, 117-12710.1016/j.ygcen.2009.10.009Search in Google Scholar

[15] Ronnestad I., Nilsen T.O., Murashita K., Angotzi A.R., Gamst Moen A.G., Stefansson S.O., et al., Leptin and leptin receptor genes in Atlantic salmon: Cloning, phylogeny, tissue distribution and expression correlated to long-term feeding status, Gen. Comp. Endocrinol., 2010, 168, 55-7010.1016/j.ygcen.2010.04.010Search in Google Scholar

[16] Friedman J.M., Halaas J.L., Leptin and the regulation of body weight in mammals, Nature, 1998, 395, 763-77010.1038/27376Search in Google Scholar

[17] Pelleymounter M.A., Cullen M.J., Baker M.B., Hecht R., Winters D., Boone T., et al., Effects of the obese gene product on body weight regulation in ob/ob mice, Science, 1995, 269, 540-54310.1126/science.7624776Search in Google Scholar

[18] Zieba D.A., Szczesna M., Klocek-Gorka B., Williams G.L., Leptin as a nutritional signal regulating appetite and reproductive processes in seasonally-breeding ruminants, J. Physio. Pharmacol., 2008, 59, 7-18Search in Google Scholar

[19] De Rosa V., Procaccini C., Cali G., Pirozzi G. Fontana S., Zappacosta S., et al., A key role of leptin in the control of regulatory T cell proliferation, Immunity 2007, 26, 241-25510.1016/j.immuni.2007.01.011Search in Google Scholar

[20] Fu L., Patel M.S., Karsenty G., The circadian modulation of leptin-controlled bone formation, Prog. Brain. Res., 2006, 153, 177-18810.1016/S0079-6123(06)53010-9Search in Google Scholar

[21] Anagnostoulis S., Karayiannakis A.J., Lambropoulou M., Efthimiadou A., Polychronidis A., Simopoulos C., Human leptin induces angiogenesis in vivo, Cytokine, 2008, 42, 353-35710.1016/j.cyto.2008.03.009Search in Google Scholar PubMed

[22] Malendowicz L.K., Rucinski M., Belloni A.S., Ziolkowska A., Nussdorfer G.G., Leptin and the regulation of the hypothalamic-pituitary-adrenal axis, Int. Rev. Cytol. 2007, 263, 63-10210.1016/S0074-7696(07)63002-2Search in Google Scholar

[23] Roubos E.W., Dahmen M., Kozicz T., Xu L., Leptin and the hypothalamo-pituitary-adrenal stress axis, Gen. Comp. Endocrinol., 2012, 177, 28-3610.1016/j.ygcen.2012.01.009Search in Google Scholar PubMed

[24] Yang J., Wang Z.L., Zhao X.Q., Wang D.P., Qi D.L., Xu B.H., et al., Natural selection and adaptive evolution of leptin in the ochotona family driven by the cold environmental stress, PloS One, 2008, 3, e147210.1371/journal.pone.0001472Search in Google Scholar PubMed PubMed Central

[25] Yu L., Jin W., Zhang X., Wang D., Zheng J.S., Yang G., et al., Evidence for positive selection on the leptin gene in Cetacea and Pinnipedia, PLoS One, 2011, 6, e2657910.1371/journal.pone.0026579Search in Google Scholar PubMed PubMed Central

[26] Yuan L., Zhao X., Lin B., Rossiter S.J., He L., Zuo X., et al., Adaptive evolution of Leptin in heterothermic bats, PloS One, 2011, 6, e2718910.1371/journal.pone.0027189Search in Google Scholar PubMed PubMed Central

[27] Zhang F., Basinski M.B., Beals J.M., Briggs S.L., Churgay L.M., Clawson D.K., et al., Crystal structure of the obese protein leptin-E100, Nature, 1997, 387, 206-20910.1038/387206a0Search in Google Scholar PubMed

[28] Isse N., Ogawa Y., Tamura N., Masuzaki H., Mori K., Okazaki T., et al., Structural organization and chromosomal assignment of the human obese gene, J. Biol. Chem., 1995, 270, 27728-2773310.1074/jbc.270.46.27728Search in Google Scholar PubMed

[29] Copeland D.L., Duff R.J., Liu Q., Prokop J., Londraville R.L., Leptin in teleost fishes: an argument for comparative study, Front. Physiol., 2011, 2, 2610.3389/fphys.2011.00026Search in Google Scholar PubMed PubMed Central

[30] Pfundt B., Sauerwein H., Mielenz M., Leptin mRNA and protein immunoreactivity in adipose tissue and liver of rainbow trout (Oncorhynchus mykiss) and immunohistochemical localization in liver, Anat. Histol. Embryol., 2009, 38, 406-41010.1111/j.1439-0264.2009.00951.xSearch in Google Scholar PubMed

[31] Shpilman M., Hollander-Cohen L., Ventura T., Gertler A., Levavi-Sivan B., Production, gene structure and characterization of two orthologs of leptin and a leptin receptor in tilapia, Gen. Comp. Endocrinol., 2014, 207, 74-8510.1016/j.ygcen.2014.05.006Search in Google Scholar PubMed

[32] Huising M.O., Geven E.J., Kruiswijk C.P., Nabuurs S.B., Stolte E. H., Spanings F.A., et al., Increased leptin expression in common Carp (Cyprinus carpio) after food intake but not after fasting or feeding to satiation, Endocrinology, 2006, 147, 5786-579710.1210/en.2006-0824Search in Google Scholar PubMed

[33] Baltzegar D.A., Reading B.J., Douros J.D., Borski R.J., Role for leptin in promoting glucose mobilization during acute hyperosmotic stress in teleost fishes, J.Endocrinol., 2014, 220, 61-7210.1530/JOE-13-0292Search in Google Scholar PubMed

[34] Gorissen M., Flik G., Leptin in teleostean fish, towards the origins of leptin physiology, J. Chem. Neuroanat., 2014, 61-62, 200-20610.1016/j.jchemneu.2014.06.005Search in Google Scholar PubMed

[35] Ahima R.S., Saper C.B., FlierJ.S., Elmquist J.K., Leptin regulation of neuroendocrine systems, Front. Neuroendocrinol., 2000, 21, 263-30710.1006/frne.2000.0197Search in Google Scholar PubMed

[36] Elmquist J.K., Coppari R., Balthasar N., Ichinose M., Lowell B.B., Identifying hypothalamic pathways controlling food intake, body weight, and glucose homeostasis, J. Comp. Neurol., 2005, 493, 63-7110.1002/cne.20786Search in Google Scholar PubMed

[37] Trombley S., Mustafa A., Schmitz M., Regulation of the seasonal leptin and leptin receptor expression profile during early sexual maturation and feed restriction in male Atlantic salmon, Salmo salar L., parr, Gen. Comp. Endocrinol., 2014, 204, 60-7010.1016/j.ygcen.2014.04.033Search in Google Scholar PubMed

[38] Trombley S., Schmitz M., Leptin in fish: possible role in sexual maturation in male Atlantic salmon, Fish. Physiol. Biochem., 2013, 39, 103-10610.1007/s10695-012-9731-0Search in Google Scholar PubMed

[39] Deck C.A., Honeycutt J.L., Cheung E., Reynolds H.M., Borski R.J., Assessing the functional role of leptin in energy homeostasis and the stress response in vertebrates, Front. Endocrinol. (Lausanne), 2017, 8, 6310.3389/fendo.2017.00063Search in Google Scholar PubMed PubMed Central

[40] Zhao H., Zeng C., Yi S., Wan S., Chen B., Gao Z., Leptin genes in blunt snout bream: cloning, phylogeny and expression correlated to gonads development, Int. J. Mol. Sci., 2015, 16, 27609-2762410.3390/ijms161126044Search in Google Scholar PubMed PubMed Central

[41] Morini M., Pasquier J., Dirks R., van den Thillart G., Tomkiewicz J., Rousseau K., et al., Duplicated leptin receptors in two species of eel bring new insights into the evolution of the leptin system in vertebrates, PloS One, 2015, 10, e012600810.1371/journal.pone.0126008Search in Google Scholar PubMed PubMed Central

[42] Crespi E.J., Denver R.J., Roles of stress hormones in food intake regulation in anuran amphibians throughout the life cycle, Comp. Biochem. Physiol. A. Mol. Integr. Physiol., 2005, 141, 381-39010.1016/j.cbpb.2004.12.007Search in Google Scholar

[43] Torday J.S., Ihida-Stansbury K., Rehan V.K., Leptin stimulates Xenopus lung development: evolution in a dish, Evol. Dev., 2009, 11, 219-22410.1111/j.1525-142X.2009.00321.xSearch in Google Scholar

[44] Pyron R.A., Wiens J.J., A large-scale phylogeny of Amphibia including over 2800 species, and a revised classification of extant frogs, salamanders, and caecilians, Mol. Phylogenet. Evol., 2011, 61, 543-58310.1016/j.ympev.2011.06.012Search in Google Scholar

[45] Zhang P., Chen Y.Q., Liu Y.F., Zhou H., Qu L.H., The complete mitochondrial genome of the Chinese giant salamander, Andrias davidianus (Amphibia: Caudata), Gene, 2003, 311, 93-9810.1016/S0378-1119(03)00560-2Search in Google Scholar

[46] Gao K.Q., Shubin N.H., Earliest known crown-group salamanders, Nature, 2003, 422, 424-42810.1038/nature01491Search in Google Scholar

[47] Cunningham A.A., Turvey S.T., Zhou F., Meredith H.M.R., Guan W., Liu X., et al., Development of the Chinese giant salamander Andrias davidianus farming industry in Shaanxi Province, China: conservation threats and opportunities, Oryx, 2015, 50, 265-27310.1017/S0030605314000842Search in Google Scholar

[48] Xiao H.B., Liu J.Y., Yang Y.Q., Lin X.Z., Artificial propagation of tank-cultured Chinese giant salamander (Andrias davidianus), Acta. Hydrobiologica Sinica, 2006, 30, 530-534 (In Chinese)Search in Google Scholar

[49] Yu H.H., Liang G., Liu Q.Q., Xu W.G., Relation between environmental factors and nocturnal active rhythm during the pre-reproductive period of the Chinese giant salamander, Journal of Shaanxi Normal University (Natural Science Edition), 2006, 41, 70-75 (In Chinese)Search in Google Scholar

[50] Tian H.F., Meng Y., Hu Q.M., Xiao H.B., Molecular cloning, characterization and evolutionary analysis of vitellogenin in Chinese giant salamander Andrias davidianus, Biologia, 2015, 70, 1254-126210.1515/biolog-2015-0143Search in Google Scholar

[51] Petersen T.N., Brunak S., von Heijne G., Nielsen H., SignalP 4.0: discriminating signal peptides from transmembrane regions, Nat. Methods., 2011, 8, 785-78610.1038/nmeth.1701Search in Google Scholar

[52] Fiser A., Sali A., Modeller: generation and refinement of homology-based protein structure models, Methods Enzymol., 2003, 374, 461-49110.1016/S0076-6879(03)74020-8Search in Google Scholar

[53] Marti-Renom M.A., Stuart A.C., Fiser A., Sanchez R., Melo F., Sali A., Comparative protein structure modeling of genes and genomes, Annu. Rev. Biophys. Biomol. Struct., 2000, 29, 291-32510.1146/annurev.biophys.29.1.291Search in Google Scholar PubMed

[54] Sali A., Comparative protein modeling by satisfaction of spatial restraints, Mol. Med. Today, 1995, 1, 270-27710.1107/S0108767396095578Search in Google Scholar

[55] Guex N., Peitsch M.C., SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling, Electrophoresis, 1997, 18, 2714-272310.1002/elps.1150181505Search in Google Scholar PubMed

[56] Guex N., Peitsch M.C., Schwede T., Automated comparative protein structure modeling with SWISS-MODEL and Swiss-PdbViewer: a historical perspective, Electrophoresis, 2009, 30, S162-17310.1002/elps.200900140Search in Google Scholar PubMed

[57] Laskowski R.A., Rullmannn J.A., MacArthur M.W., Kaptein R., Thornton J.M., AQUA and PROCHECK-NMR: programs for checking the quality of protein structures solved by NMR, J. Biomol. NMR., 1996, 8, 477-48610.1007/BF00228148Search in Google Scholar PubMed

[58] Edgar, R.C., MUSCLE: multiple sequence alignment with high accuracy and high throughput, NucleicAcidsRes., 2004, 32, 1792-179710.1093/nar/gkh340Search in Google Scholar PubMed PubMed Central

[59] Ronquist F., Huelsenbeck J.P., MrBayes 3: Bayesian phylogenetic inference under mixed models, Bioinformatics, 2003, 19, 1572-157410.1093/bioinformatics/btg180Search in Google Scholar PubMed

[60] Price M.N., Dehal P.S., Arkin A.P., FastTree 2–approximately maximum-likelihood trees for large alignments, PloSOne, 2010, 5, e949010.1371/journal.pone.0009490Search in Google Scholar PubMed PubMed Central

[61] Beiko R.G., Telling the whole story in a 10,000-genome world, Biol. Direct., 2011, 6, 3410.1186/1745-6150-6-34Search in Google Scholar PubMed PubMed Central

[62] Londraville R.L., Macotela Y., Duff R.J., Easterling M.R., Liu Q., and Crespi E.J., Comparative endocrinology of leptin: assessing function in a phylogenetic context, Gen. Comp. Endocrinol., 2014, 203, 146-15710.1016/j.ygcen.2014.02.002Search in Google Scholar PubMed PubMed Central

[63] Liu Q., Dalman M., Chen Y., Akhter M., Brahmandam S., Patel Y., et al., Knockdown of leptin A expression dramatically alters zebrafish development, Gen. Comp. Endocrinol., 2012, 178, 562-57210.1016/j.ygcen.2012.07.011Search in Google Scholar PubMed PubMed Central

[64] Dalman M.R., Mustafa A., Liu Q., Londraville R.L., Leptin knockdown reduces innate immune function in zebrafish, FASEB J., 2013, 27, 937-92010.1096/fasebj.27.1_supplement.937.20Search in Google Scholar

[65] Huang H., Wei Y., Meng Z., Zhang Y., Liu X., Guo L., et al., Polymorphisms of leptin-b gene associated with growth traits in orange-spotted grouper (Epinephelus coioides), Int. J. Mol. Sci., 2014, 15, 11996-1200610.3390/ijms150711996Search in Google Scholar PubMed PubMed Central

[66] Clempson A.M., Pollott G.E., Brickell J.S., Bourne N.E., Munce N., Wathes D.C., Evidence that leptin genotype is associated with fertility, growth, and milk production in Holstein cows, J. Dairy Sci., 2011, 94, 3618-362810.3168/jds.2010-3626Search in Google Scholar PubMed

[67] Sun J., Shan H.E., Liang X.F., Ling L.I., Wen Z., Zhu T., et al., Identification of SNPs in NPY and LEP and the association with food habit domestication traits in mandarin fish, J. Genet., 2014, 93, 1-510.1007/s12041-014-0442-4Search in Google Scholar

[68] Wei Y., Huang H., Meng Z., Zhang Y., Luo J., Chen G., et al., Single nucleotide polymorphisms in the leptin-a gene and associations with growth traits in the orange-spotted grouper (Epinephelus coioides), Int. J. Mol. Sci., 2013, 14, 8625-863710.3390/ijms14048625Search in Google Scholar PubMed PubMed Central

[69] Wu C., Wu G., Zhang G., Wang Q., Luo J., Chen G., Single nucleotide polymorphisms in the leptin-a gene and associations with growth traits in the golden pompano, Trachinotus blochii, Journal of the World Aquaculture Society, 2016, 47, 414-42310.1111/jwas.12272Search in Google Scholar

[70] Cui M.Y., Hu C.K., Pelletier C., Dziuba A., Slupski R.H., Li C., et al., Ancient origins and evolutionary conservation of intracellular and neural signaling pathways engaged by the leptin receptor, Endocrinology, 2014, 155, 4202-421410.1210/en.2014-1301Search in Google Scholar PubMed

[71] Ikejima K., Takei Y., Honda H., Hirose M., Yoshikawa M., Zhang Y.J., et al., Leptin receptor-mediated signaling regulates hepatic fibrogenesis and remodeling of extracellular matrix in the rat, Gastroenterology, 2002, 122, 1399-141010.1053/gast.2002.32995Search in Google Scholar PubMed

[72] Potter J.J., Womack L., Mezey E., Anania F.A., Transdifferentiation of rat hepatic stellate cells results in leptin expression, Biochem. Biophys. Res. Commun., 1998, 244, 178-18210.1006/bbrc.1997.8193Search in Google Scholar PubMed

[73] He S., Liang X.F., Li L., Huang W., Shen D., Tao Y.X., Gene structure and expression of leptin in Chinese perch, Gen. Comp. Endocrinol., 2013, 194, 183-18810.1016/j.ygcen.2013.09.008Search in Google Scholar PubMed

[74] Londraville R.L., Prokop J.W., Duff R.J., Liu Q., Tuttle M., On the molecular evolution of leptin, leptin receptor, and endospanin, Front. Endocrinol. (Lausanne), 2017, 8, 5810.3389/fendo.2017.00058Search in Google Scholar PubMed PubMed Central

Received: 2017-3-30
Accepted: 2017-5-15
Published Online: 2017-11-23

© 2017 Hai-feng Tian et al.

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Articles in the same Issue

  1. Research Articles
  2. Field Performance and Genetic Fidelity of Micropropagated Plants of Coffea canephora (Pierre ex A. Froehner)
  3. Research Articles
  4. Foliage maturity of Quercus ilex affects the larval development of a Croatian coastal population of Lymantria dispar (Lepidoptera: Erebidae)
  5. Research Articles
  6. Structural and functional impact of SNPs in P-selectin gene: A comprehensive in silico analysis
  7. Research Articles
  8. High embryogenic ability and regeneration from floral axis of Amorphophallus konjac (Araceae)
  9. Research Articles
  10. Terpene content of wine from the aromatic grape variety ‘Irsai Oliver’ (Vitis vinifera L.) depends on maceration time
  11. Research Articles
  12. Light and smell stimulus protocol reduced negative frontal EEG asymmetry and improved mood
  13. Research Articles
  14. Swailing affects seed germination of plants of European bio-and agricenosis in a different way
  15. Research Articles
  16. Survey analysis of soil physicochemical factors that influence the distribution of Cordyceps in the Xiahe Region of Gansu Province
  17. Research Articles
  18. Production of biogas: relationship between methanogenic and sulfate-reducing microorganisms
  19. Research Articles
  20. Pentraxin 3 and atherosclerosis among type 2 diabetic patients
  21. Research Articles
  22. Evaluation of ribosomal P0 peptide as a vaccine candidate against Argulus siamensis in Labeo rohita
  23. Research Articles
  24. Variation of autosomes and X chromosome STR in breast cancer and gynecological cancer tissues
  25. Research Articles
  26. Response of antioxidant enzymes to cadmium-induced cytotoxicity in rat cerebellar granule neurons
  27. Research Articles
  28. Cardiac hypertrophy and IGF-1 response to testosterone propionate treatment in trained male rats
  29. Research Articles
  30. BRAF-activated non-protein coding RNA (BANCR) advances the development of esophageal squamous cell carcinoma via cell cycle
  31. Research Articles
  32. The influence of soil salinity on volatile organic compounds emission and photosynthetic parameters of Solanum lycopersicum L. varieties
  33. Research Articles
  34. Simple Protocol for immunoglobulin G Purification from Camel “Camelus dromedarius” Serum
  35. Research Articles
  36. Expression of psbA1 gene in Synechocystis sp. PCC 6803 is influenced by CO2
  37. Research Articles
  38. Frequency of Thrombophilic Gene Mutations in Patients with Deep Vein Thrombosis and in Women with Recurrent Pregnancy Loss
  39. Research Articles
  40. Evaluation of anticancer properties of a new α-methylene-δ-lactone DL-249 on two cancer cell lines
  41. Research Articles
  42. Impact of heated waters on water quality and macroinvertebrate community in the Narew River (Poland)
  43. Research Articles
  44. Effects of Some Additives on In Vitro True Digestibility of Wheat and Soybean Straw Pellets
  45. Research Articles
  46. RNAi-mediated gene silencing in Rhynchophorus ferrugineus (Oliver) (Coleoptera: Curculionidae)
  47. Research Articles
  48. New pathway of icariin-induced MSC osteogenesis: transcriptional activation of TAZ/Runx2 by PI3K/Akt
  49. Research Articles
  50. Tudor-SN protein expression in colorectal cancer and its association with clinical characteristics
  51. Research Articles
  52. Proteomic and bioinformatics analysis of human saliva for the dental-risk assessment
  53. Research Articles
  54. Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis
  55. Research Articles
  56. Strain Stimulations with Different Intensities on Fibroblast Viability and Protein Expression
  57. Research Articles
  58. miR-539 mediates osteoblast mineralization by regulating Distal-less genes 2 in MC3T3-E1 cell line
  59. Research Articles
  60. Diversity of Intestinal Microbiota in Coilia ectenes from Lake Taihu, China
  61. Research Articles
  62. The production of arabitol by a novel plant yeast isolate Candida parapsilosis 27RL-4
  63. Research Articles
  64. Effectiveness of Azospirillum brasilense Sp245 on young plants of Vitis vinifera L.
  65. Research Articles
  66. Changes of photochemical efficiency and epidermal polyphenols content of Prosopis glandulosa and Prosopis juliflora leaves exposed to cadmium and copper
  67. Research Articles
  68. Ultraweak photon emission in strawberry fruit during ripening and aging is related to energy level
  69. Research Articles
  70. Molecular cloning, characterization and evolutionary analysis of leptin gene in Chinese giant salamander, Andrias davidianus
  71. Research Articles
  72. Longevity and stress resistance are affected by activation of TOR/Myc in progenitor cells of Drosophila gut
  73. Research Articles
  74. Curcumin attenuates oxidative stress in liver in Type 1 diabetic rats
  75. Research Articles
  76. Risk factors of long-term postoperative renal function after partial nephrectomy in a solitary kidney
  77. Research Articles
  78. Developmental anomalies of the right hepatic lobe: systematic comparative analysis of radiological features
  79. Review articles
  80. Genetic Defects Underlie the Non-syndromic Autosomal Recessive Intellectual Disability (NS-ARID)
  81. Review articles
  82. Research Progress on Tissue Culture and Genetic Transformation of Kenaf (Hibiscus cannabinus)
  83. Topical Issue On Precision Medicine
  84. MiR-107 inhibits proliferation of lung cancer cells through regulating TP53 regulated inhibitor of apoptosis 1 (TRIAP1)
  85. Topical Issue On Precision Medicine
  86. The functional role of exosome microRNAs in lung cancer
  87. Topical Issue On Precision Medicine
  88. The diagnostic value of serum microRNA-183 and TK1 as biomarkers for colorectal cancer diagnosis
  89. Topical Issue On Precision Medicine
  90. Screening feature modules and pathways in glioma using EgoNet
  91. Topical Issue On Precision Medicine
  92. Isoliquiritigenin inhibits colorectal cancer cells HCT-116 growth by suppressing the PI3K/AKT pathway
  93. Topical Issue On Precision Medicine
  94. Association between Caveolin-1 expression and pathophysiological progression of femoral nerves in diabetic foot amputation patients
  95. Topical Issue On Precision Medicine
  96. Biomarkers in patients with myocardial fibrosis
  97. Topical Issue On Precision Medicine
  98. Dysregulated pathways for off-pump coronary artery bypass grafting
  99. Topical Issue On Precision Medicine
  100. Individualized identification of disturbed pathways in sickle cell disease
  101. Topical Issue On Precision Medicine
  102. The prognostic value of serum PCT, hs-CRP, and IL-6 in patients with sepsis
  103. Topical Issue On Precision Medicine
  104. Sevoflurane-medicated the pathway of chemokine receptors bind chemokines in patients undergoing CABG
  105. Topical Issue On Precision Medicine
  106. The functional role of microRNAs in laryngeal carcinoma
  107. Topical Issue On Precision Medicine
  108. Revealing pathway cross-talk related to diabetes mellitus by Monte Carlo Cross-Validation analysis
  109. Topical Issue On Precision Medicine
  110. Correlation between CDKAL1 rs10946398C>A single nucleotide polymorphism and type 2 diabetes mellitus susceptibility: A meta-analysis
  111. Special Issue on Agricultural and Biological Sciences
  112. Effects of environmental variables on seedling distribution of rare and endangered Dacrydium pierrei
  113. Special Issue on Agricultural and Biological Sciences
  114. Study on synthesis and properties of nanoparticles loaded with amaryllidaceous alkaloids
  115. Special Issue on Agricultural and Biological Sciences
  116. Bacterial Infection Potato Tuber Soft Rot Disease Detection Based on Electronic Nose
  117. Special Issue on Agricultural and Biological Sciences
  118. Effects of subsoiling on maize yield and water-use efficiency in a semiarid area
Downloaded on 25.4.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2017-0048/html?lang=en
Scroll to top button