Home BRAF-activated non-protein coding RNA (BANCR) advances the development of esophageal squamous cell carcinoma via cell cycle
Article Open Access

BRAF-activated non-protein coding RNA (BANCR) advances the development of esophageal squamous cell carcinoma via cell cycle

  • Chunxia Yang , Yue Wang , Fangjun Chen , Yongzhong Hou , Jianhua Jin and Qian Liu EMAIL logo
Published/Copyright: April 30, 2017
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 12 Issue 1

Abstract

Esophageal carcinoma is one of the important lethal tumors in the world, but the mechanism of esophageal cancer progression is still unclear. The long non-coding RNAs are known to regulate tumor progression. Here we report that BRAF-activated nonprotein coding RNA (BANCR) is associated with the development of esophageal squamous cell carcinoma (ESCC). The expression levels of BANCR in 132 ESCC tumor tissues detected by quantitative real-time PCR were significantly higher than that in the adjacent normal tissues. The expression level of BANCR was down-regulated by transfecting small interrupting RNA against BANCR (BANCR siRNA) in Eca109 cells. Eca109 and TE-1 cells transfected with BANCR siRNA led to the delayed cell cycles compared to the cells transfected with negative control siRNA. Moreover, MTT assays demonstrated that Eca109 cells transfected with BANCR siRNA resulted in the inhibition of cell proliferation. These results suggested that BANCR advances the development and progression of ESCC cells through regulating their cell cycles.

Keywords: BANCR; Cell Cycle; ESCC

1 Introduction

Esophageal cancer is one of the main causes of death with higher incidence rates found in Eastern Asia [1]. Esophageal cancer is classified into two main types according to occurring at different parts of the body: one is squamous cell carcinoma and the other is adenocarcinoma. In the majority of cases (90%), most are squamous cell carcinomas [2, 3]. Currently, there are limited clinical approaches for the early diagnosis and treatment of ESCC, leading to a 10 % five-year survival rate for the patients [4-6].

Long non-coding RNAs (lncRNAs) usually contain more than 200 nucleotides and are involved in cancer cell proliferation and metastasis [7-9]. For example, lncRNA BCAR4 promotes breast cancer cell migration through binding SNIP1 and PNUTS [10]. Also, the up-regulation of lncRNA HNF1A-AS1 promotes tumor proliferation and metastasis in lung adenocarcinoma by regulating the expression of cyclin D1, E-cadherin and β-catenin [11].

BRAF-activated non-protein coding RNA (BANCR) was first identified by Flockhart RJ et al. via RNA sequencing in 2012. This RNA sequence is a 693bp long transcript on chromosome 9, which inhibits the progression of bladder cancer [12], and reduces the proliferation of papillary thyroid carcinoma cells [13]. Besides the tumor suppressing role, BANCR can also act as an oncogene, which promotes the proliferation of gastric cancer via regulating NF-kappaB [14, 15]. A recent study reported that the up-regulation of BANCR correlates with tumor progression and poor prognosis in ESCC cells [16].

In the present study, we analyzed the correlation between BANCR expression and ESCC progression. Flow cytometry results suggested that BANCR was involved in the regulation of cell cycles of the ESCC cells. Moreover, MTT data demonstrated that the inhibition of BANCR expression blocked the proliferation of ESCC cells. These results demonstrated that BANCR was involved in promoting ESCC cell proliferation.

2 Materials and methods

2.1 Clinical specimen collection

A total of 132 pairs of ESCC tumor and adjacent normal tissues were obtained from patients who underwent surgical resection at the affiliated Wujin People’s Hospital of Jiangsu University and the affiliated Nanjing Drum Tower Hospital of Nanjing University. The documented clinicopathological characteristics were: age, gender, tumor size, differentiation, lymph node metastasis and TNM stage.

Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies and in accordance the tenets of the Helsinki Declaration, and has been approved by Human Ethics Committee board of Jiangsu University and Nanjing University.

Informed consent: Informed consent has been obtained from all individuals included in this study prior to the research commencing with no patients receiving preoperative treatments.

2.2 Cell culture and treatment

Eca109 cell and TE-1 cell lines were cultured in RPMI 1640 (Gibco) supplemented with 10% fetal bovine serum (Gibco), 100 U/ml penicillin and 100 mg/ml streptomycin (Invitrogen, Carlsbad, CA, USA) at 37°C in a 5% CO2 incubator. The cells were transfected with BANCR siRNA-1 (UAGCAACCACAUAUCAGCUUGGUUU), BANCR siRNA-2 (UAUAUACAACGUUUGCCAUGGAGUC) and NC siRNA (the negative control) 100 pM respectively, according to manufacturer’s protocol.

2.3 RNA extraction and quantitative real-time PCR

Total RNA was extracted from tissues (Tumor and Adjacent normal tissues) and we cultured cells using TRIzol Reagent (Invitrogen) according to the manufacturer’s protocol. About 1 μg RNA was reverse-transcribed using Primescript RT reagent kit (Takara), qRT-PCR was performed by using SYBR green premix following the manufacturer’s instructions. BANCR expression levels were normalized against GAPDH expression in three independent experiments. The primers used for qRT-PCR include the following: BANCR forward primers:

CTTCTTGTAGGGTCTGGATTGG; BANCR reversed primers: TAGGGTCAGGGGTC TCTTCAGT; GAPDH forward: GAAGGTGAAGGTCGGAGTC; GAPDH reverse: GAAGATGGT GATGGGATTTC.

2.4 Analysis of cell cycle by flow cytometry

Eca109 and TE-1 cells were harvested and approximately 1x106 cells per treatment were re-suspended in 400 μl cold phosphate-buffer saline (PBS) in polystyrene tubes. Cells were then fixed by incubating the cell suspension with an equal volume of 75% ice cold ethanol for 1 hour on ice. Cells were then spun down and washed twice with ice cold PBS, and the cell pellets re-suspended with 500 μl PBS with added 0.1% RNase A (type I-A, Sigma Chemicals) for 30 min at 37°C. Cells were then stained with 10 μg/ml propidium iodide PI (Sigma Chemicals) for 30 min in the dark at room temperature. PI fluorescence measurements were then taken immediately using a flow cytometer as described in a previous publication [17]. Experiments were performed in triplicates.

2.5 MTT Assays

Eca109 cells were transfected with BANCR siRNA and NC siRNA for 48h and cells were then harvested and inoculated in 96 well plates. 20 μl MTT was then added to one group (5 wells per group) at different time intervals: 6h, 24h, 48h and 72h and incubated for 4 hours. Medium was then discarded and 150 μl DMSO was added and samples were then shaken for 15 min. The absorbance was tested using a Microplate reader at 490 nm absorbance [18]. The inhibition rate was calculated using the following formula: the percentage of the MTT inhibition = (NC group OD490 value - BANCR siRNA group OD490 value)/ NC group OD490 value. Experiments were performed in triplicates.

2.6 Statistical analysis

All of the statistical analysis was performed using GraphPad Prism 5.1. The results are presented as the mean ± the standard error of the mean. All the experiments were performed at least three times. Correlation analysis was assessed by the Pearson correlation coefficient. The statistical significance of inter-group differences was calculated by the Student’s t-test.

3 Results

3.1 The expression of BANCR is positive correlated with ESCC

To investigate the interaction of BANCR expression with ESCC tumor progression, quantitative real-time PCR (qRT-PCR) was performed using 132 pairs of ESCC tumor and adjacent normal tissues. The results showed that expression levels of BANCR were significantly up-regulated in the ESCC tissues compared to adjacent normal ones (Figure 1). The results demonstrated that BANCR expression was significantly correlated with the progression of ESCC, which suggested that BANCR expression was associated with the development and progression of ESCC.

Figure 1 BANCR expression is positively correlated with the progression of ESCC. The total RNA of fresh ESCC and adjacent normal tissues were extracted using Spin Column Animal total RNA purification Kit and performed according to the Manufacturer’s Manual, and the total RNA was then reverse-transcribed into cDNA. The mRNA levels of BANCR were detected by quantitative real-time PCR (*p<0.05, **p<0.01, ***p<0.001, Pearson’s correlation, n=132).
Figure 1

BANCR expression is positively correlated with the progression of ESCC. The total RNA of fresh ESCC and adjacent normal tissues were extracted using Spin Column Animal total RNA purification Kit and performed according to the Manufacturer’s Manual, and the total RNA was then reverse-transcribed into cDNA. The mRNA levels of BANCR were detected by quantitative real-time PCR (*p<0.05, **p<0.01, ***p<0.001, Pearson’s correlation, n=132).

3.2 Association between BANCR and clinicopathological characteristics

We further wondered whether the expression levels of BANCR were associated with specific clinicopathological parameters in ESCC patients. We separated equally the 132 patients into two groups according to the expression levels of BANCR. We found that BANCR expression levels were strongly associated with tumor size and an advanced TNM stage (Table 1). The analyzed clinicopathologic parameters showed that the tumor size of ESCC tissue with high BANCR expression were usually bigger than 3 centimeters. Whereas tumor size in patients with low BANCR expression showed no significant changes (Table 1). For patients with BANCR high expression, tumors were mostly at I and II TNM stages, which is equivalent to 69.4% (50 out of 72). However, there were no statistically significant associations between BANCR expression and other clinicopathological data, including age, gender, differentiation, invasion and lymph node metastasis (All p>0.05, Table 1).

Table 1

The relationship between BANCR expression and clinicopathologic parameters in ESCC patients

Clinicopathologic parametersBANCR expressionP-value
High (%)Low (%)
Age(years)0.563
≤6317(45.9)20(54.1)
>6350(52.6)45(47.4)
Gender0.217
Male37(46.3)43(53.7)
Female30(57.7)22(42.3)
Tumor Size (cm)0.016[*]
<311(40.7)16(59.3)
≥370(66.7)35(33.3)
Differentiation1.000
High/Medium32(60.4)21(39.6)
Low48(60.8)31(39.2)
Invasion0.703
T1-T220(51.3)19(48.7)
T3-T443(46.2)50(53.8)
Lymph node metastasis1.000
Negative22(46.8)25(53.2)
Positive41(48.2)44(51.8)
TNM Stage0.008[**]
I, II50(64.9)27(35.1)
III, IV22(40.0)33(60.0)

***P<0.001, Chi-squared test P-value

3.3 BANCR expression regulates the cell cycle of ESCC cells

In order to investigate whether there was correlation between BANCR expression and the growth or apoptosis of ESCC cells, we wondered whether BANCR expression could change the cell cycle of ESCC cells. Two BANCR siRNA fragments were designed and their interrupting efficiency was tested. The quantitative real-time PCR (qRT-PCR) results showed that the expression levels of BANCR in the Eca109 cells transfected with BANCR siRNA were notably decreased compared to the ones transfected with NC siRNA (Figure 2). Next, the two BANCR siRNA fragments were used to transfect the Eca109 cells, the cell cycles were tested after the transfection for 48 hours, and the cells transfected with NC siRNA worked as the negative control group. Results of Flow Cytometry analysis indicated that more cells transfected with BANCR siRNA arrested at G0/G1 phase compared to the cells transfected with NC siRNA, and the numbers of cells transfected with BANCR siRNA decreased significantly in the S phase relative to the negative control (Figure 3). In addition, TE-1 cells of ESCC cell lines were transfected respectively with the two BANCR siRNAs and the cell cycles were then detected and the data analyzed. The results obtained were similar to that of Eca109 cells, that is the numbers of cells transfected with BANCR siRNA reduced at the S phase (Figure 4). These results indicated that low expression levels of BANCR could significantly decrease the cell numbers arrested at S phage relative to the negative control, which suggested that BANCR expression might regulate the proliferation of ESCC cells via modulating their cell cycles.

Figure 2 The relative mRNA levels of BANCR detected by quantitative real-time PCR in Eca109 cells transfected with Negative Control siRNA (NC siRNA), BANCR siRNA-1or BANCR siRNA-2 respectively as indicated.
Figure 2

The relative mRNA levels of BANCR detected by quantitative real-time PCR in Eca109 cells transfected with Negative Control siRNA (NC siRNA), BANCR siRNA-1or BANCR siRNA-2 respectively as indicated.

Figure 3 BANCR regulates the cell cycles of Eca109 cells. (Α-C). The cell cycles of Eca109 cells transfected with NC siRNA or BANCR siRNA were measured using a Flow Cytometer. D. The number of cells transfected with BANCR siRNA (100 nM) or NC siRNA (100 nM) at different cell cycle phages were assayed.
Figure 3

BANCR regulates the cell cycles of Eca109 cells. (Α-C). The cell cycles of Eca109 cells transfected with NC siRNA or BANCR siRNA were measured using a Flow Cytometer. D. The number of cells transfected with BANCR siRNA (100 nM) or NC siRNA (100 nM) at different cell cycle phages were assayed.

Figure 4 BANCR regulates the cell cycles of TE-1 cells. TE-1 cells were transfected with BANCR siRNA-1(100 nM), ΒANCR siRNA-2 (100 nM) or NC siRNA (100 nM) respectively, and the cell cycles of these cells were detected by Flow Cytometry.
Figure 4

BANCR regulates the cell cycles of TE-1 cells. TE-1 cells were transfected with BANCR siRNA-1(100 nM), ΒANCR siRNA-2 (100 nM) or NC siRNA (100 nM) respectively, and the cell cycles of these cells were detected by Flow Cytometry.

3.4 BANCR expression affects the growth of ESCC cells

In order to further confirm the results above, which showed that BANCR expression could regulate the ESCC cell proliferation, MTT assays were performed. The results of these assays showed that the growth of cells transfected with BANCR siRNA were significantly decreased after transfection for 72 hours compared to the cells transfected with the negative control siRNA (Figure 5A). Moreover, we found that the cell proliferation ratio (BANCR siRNA OD490 / NC siRNA OD490) was negatively correlated with the percentage of the MTT inhibition (Figure 5B). These results indicated that reduction of BANCR expression resulted in the decreased proliferation of ESCC cells, which suggested that BANCR could promote the development and progression of ESCC.

Figure 5 BANCR promotes the proliferation of Eca109 cells. A. Eca109 cells were transiently transfected with BANCR siRNA (100 nM) or NC siRNA(100 nM), then the proliferation of Eca109 cells was measured by MTT assays. B. The percentage of the MTT inhibition was calculated according to the absorbance of the cells, which was negatively correlated with the cell proliferation rate.
Figure 5

BANCR promotes the proliferation of Eca109 cells. A. Eca109 cells were transiently transfected with BANCR siRNA (100 nM) or NC siRNA(100 nM), then the proliferation of Eca109 cells was measured by MTT assays. B. The percentage of the MTT inhibition was calculated according to the absorbance of the cells, which was negatively correlated with the cell proliferation rate.

4 Discussion

Esophageal cancer is the main cause of cancer related deaths in China and ESCC is the main form of Esophageal cancer. Unfortunately, the average 5-year survival rate of ESCC remains lower than 10% [19, 20]. Recently, a greater number of studies have focused on the underlying mechanisms for how the development and progression of ESCC cells occurred [21-23].

Emerging evidence has reported that long non-coding RNA (lncRNA) plays an important role in the development and progression of cancer [24, 25]. BRAF-activated nonprotein coding RNA (BANCR) is a 693 bp long transcript, which could promote the proliferation of gastric cancer cells via regulating NF-кB [14]. Recent studies indicate that up-regulation of BANCR correlates with tumor progression in ESCC [15, 16, 26], which is consistent with our results (Figure 1) that demonstrated that BANCR expression was positively correlated with the progression of ESCC. According to the association between BANCR and clinicopathological characteristics, BANCR expression is positively correlated with Tumor size and TNM stages (Table 1), which suggests that BANCR could be a potential biomarker for analyzing TNM stages of ESCC patients.

Recent studies have demonstrated that the proliferation of cancer is closely correlated to the altered regulation of cell cycles, which might cause uncontrolled growth and contribute to the development and progression of tumor cells [27]. In the present study, our data illustrated that fewer ESCC cells transfected with BANCR siRNA were arrested in the S phage compared to that transfected with NC siRNA (Figure 3 and Figure 4). All of this data implies that BANCR expression was associated with the progression of ESCC through its ability to regulate cell cycles.

In summary, we found that BANCR expression is positively correlated with development of ESCC, and up-regulation of BANCR expression would advance the proliferation of ESCC cells via regulating cell cycles. Therefore, our findings provide new insights into the mechanism of BANCR in the development and progression of ESCC. BANCR may function as a potential biomarker for diagnosis and treatment for ESCC patients.

#These authors contributed equally to this work

Acknowledgements

The authors would like to thank all the members of Department of Oncology of the affiliated Nanjing Drum Tower Hospital of Nanjing University.

  1. Conflict of interest: Authors state no conflict of interest.

Fundings

This work was supported by the funds of Changzhou Sci & Tech Program, Grant No. CJ20140002 and CJ20160003, and funds by Wujin Sci & Tech Program, Grant No. W S201505 and W S201601; Innovative and Entrepreneurial Ph.D of Jiangsu Province.

References

[1] Jemal A., Bray F., Center MM., Ferlay J., Ward E., Forman D., Global cancer statistics. CA: a cancer journal for clinicians 2011; 61: 69-9010.3322/caac.20107Search in Google Scholar PubMed

[2] Gholipour C., Shalchi RA., Abbasi M., A histopathological study of esophageal cancer on the western side of the Caspian littoral from 1994 to 2003. Diseases of the esophagus : official journal of the International Society for Diseases of the Esophagus / ISDE 2008; 21: 322-710.1111/j.1442-2050.2007.00776.xSearch in Google Scholar PubMed

[3] Tran GD., Sun XD., Abnet CC., et al. Prospective study of risk factors for esophageal and gastric cancers in the Linxian general population trial cohort in China. International journal of cancer 2005; 113: 456-6310.1002/ijc.20616Search in Google Scholar PubMed

[4] Song Y., Li L., Ou Y., et al. Identification of genomic alterations in oesophageal squamous cell cancer. Nature 2014; 509: 91-510.1038/nature13176Search in Google Scholar PubMed

[5] Liu H., Ren G., Zhu L., Liu X., He X., The upregulation of miRNA-146a inhibited biological behaviors of ESCC through inhibition of IRS2. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine 2016; 37: 4641-710.1007/s13277-015-4274-5Search in Google Scholar PubMed

[6] Xu Y., Zheng Y., Sun X., et al. Concurrent radiotherapy with gefitinib in elderly patients with esophageal squamous cell carcinoma: Preliminary results of a phase II study. Oncotarget 2015;6:38429-3910.18632/oncotarget.5193Search in Google Scholar PubMed PubMed Central

[7] Iyer MK., Niknafs YS., Malik R., et al. The landscape of long noncoding RNAs in the human transcriptome. Nature genetics 2015;47:199-20810.1038/ng.3192Search in Google Scholar PubMed PubMed Central

[8] Wang Y., Wu P., Lin R., Rong L., Xue Y., Fang Y., LncRNA NALT interaction with NOTCH1 promoted cell proliferation in pediatric Τ cell acute lymphoblastic leukemia. Scientific reports 2015; 5: 1374910.1038/srep13749Search in Google Scholar PubMed PubMed Central

[9] Xia H., Chen Q., Chen X., et al. The lncRNA MALAT1 is a novel biomarker for gastric cancer metastasis. Oncotarget 201610.18632/oncotarget.10941Search in Google Scholar PubMed PubMed Central

[10] Xing Z., Lin A., Li C., et al. lncRNA directs cooperative epigenetic regulation downstream of chemokine signals. Cell 2014; 159: 1110-2510.1016/j.cell.2014.10.013Search in Google Scholar PubMed PubMed Central

[11] Wu X., Liu H., Shi X., Yao X., Yang W., Song Y., The long non-coding RNA HNF1A-AS1 regulates proliferation and metastasis in lung adenocarcinoma. Oncotarget 2015; 6: 9160-7210.18632/oncotarget.3247Search in Google Scholar PubMed PubMed Central

[12] He A., Liu Y., Chen Z., et al. Over-expression of long noncoding RNA BANCR inhibits malignant phenotypes of human bladder cancer. Journal of experimental & clinical cancer research : CR 2016; 35:12510.1186/s13046-016-0397-9Search in Google Scholar PubMed PubMed Central

[13] LIao T., Qu N., Shi Rl., et al. BRAF-activated LncRNA functions as a tumor suppressor in papillary thyroid cancer. Oncotarget 201610.18632/oncotarget.10825Search in Google Scholar PubMed PubMed Central

[14] Zhang ZX., Liu ZQ., Jiang B., et al. BRAF activated non-coding RNA (BANCR) promoting gastric cancer cells proliferation via regulation of NF-kappaB1. Biochemical and biophysical research communications 2015; 465: 225-3110.1016/j.bbrc.2015.07.158Search in Google Scholar PubMed

[15] Li R., Zhang L., Jia L., et al. Long non-coding RNA BANCR promotes proliferation in malignant melanoma by regulating MAPK pathway activation. PloS one 2014; 9: e10089310.1371/journal.pone.0100893Search in Google Scholar PubMed PubMed Central

[16] LIu Z., Yang T., Xu Z., Cao X., Upregulation of the long non-coding RNA BANCR correlates with tumor progression and poor prognosis in esophageal squamous cell carcinoma. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 2016; 82: 406-1210.1016/j.biopha.2016.05.014Search in Google Scholar PubMed

[17] Vuletic A., Konjevic G., Milanovic D., Ruzdijic S., Jurisic V., Antiproliferative effect of 13-cis-retinoic acid is associated with granulocyte differentiation and decrease in cyclin B1 and Bcl-2 protein levels in G0/G1 arrested HL-60 cells. Pathology oncology research : POR 2010; 16: 393-40110.1007/s12253-009-9241-2Search in Google Scholar PubMed

[18] Jurisic V., Bogdanovic G., Kojic V., Jakimov D., Srdic T., Effect Of TNF-Alpha On Raji cells at different cellular levels estimated by various methods. Annals of hematology 2006; 85: 86-9410.1007/s00277-005-0010-3Search in Google Scholar PubMed

[19] Yu C., Chen K., Zheng H., et al. Overexpression of astrocyte elevated gene-1 (AEG-1) is associated with esophageal squamous cell carcinoma (ESCC) progression and pathogenesis. Carcinogenesis 2009; 30: 894-90110.1093/carcin/bgp064Search in Google Scholar PubMed

[20] Ni S., Zhu J., Zhang J., et al. Expression and clinical role of NF45 as a novel cell cycle protein in esophageal squamous cell carcinoma (ESCC). Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine 2015; 36: 747-5610.1007/s13277-014-2683-5Search in Google Scholar PubMed

[21] Ng HX., Ko JM., Yu VZ., et al. DESC1, a novel tumor suppressor, sensitizes cells to apoptosis by downregulating the EGFR/AKT pathway in esophageal squamous cell carcinoma. International journal of cancer 2016; 138: 2940-5110.1002/ijc.30034Search in Google Scholar PubMed

[22] Fang MZ., Jin Z., Wang Y., et al. Promoter hypermethylation and inactivation of 0(6)-methylguanine-DNA methyltransferase in esophageal squamous cell carcinomas and its reactivation in cell lines. International journal of oncology 2005; 26: 615-2210.3892/ijo.26.3.615Search in Google Scholar

[23] Yao J., Huang JX., Lin M., et al. Microarray expression profile analysis of aberrant long non-coding RNAs in esophageal squamous cell carcinoma. International journal of oncology 2016; 48: 2543-5710.3892/ijo.2016.3457Search in Google Scholar PubMed

[24] Fatica A., Bozzoni I., Long non-coding RNAs: new players in cell differentiation and development. Nature reviews Genetics 2014;15:7-2110.1038/nrg3606Search in Google Scholar PubMed

[25] Wang R., Shi X., Chen L., et al. The ratio of FoxA1 to FoxA2 in lung adenocarcinoma is regulated by LncRNA HOTAIR and chromatin remodeling factor LSH. Scientific reports 2015; 5:1782610.1038/srep17826Search in Google Scholar PubMed PubMed Central

[26] Peng ZQ., Lu RB., Xiao DM., Xiao ZM., Increased expression of the lncRNA BANCR and its prognostic significance in human osteosarcoma. Genetics and molecular research : GMR 2016; 1510.4238/gmr.15017480Search in Google Scholar PubMed

[27] Uchida F., Uzawa K., Kasamatsu A., et al. Overexpression of cell cycle regulator CDCA3 promotes oral cancer progression by enhancing cell proliferation with prevention of G1 phase arrest. BMC cancer 2012; 12: 32110.1186/1471-2407-12-321Search in Google Scholar PubMed PubMed Central

Abbreviations

lncRNA

long non-coding RNA

BANCR

BRAF-activated non-protein coding RNA

ESCC

esophageal squamous cell carcinoma

TNM

tumor node metastasis

siRNA

small interrupting RNA

NC

negative control

PI

propidium iodide

Received: 2017-1-22
Accepted: 2017-3-27
Published Online: 2017-4-30

© 2017 Chunxia Yang et al.

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Articles in the same Issue

  1. Research Articles
  2. Field Performance and Genetic Fidelity of Micropropagated Plants of Coffea canephora (Pierre ex A. Froehner)
  3. Research Articles
  4. Foliage maturity of Quercus ilex affects the larval development of a Croatian coastal population of Lymantria dispar (Lepidoptera: Erebidae)
  5. Research Articles
  6. Structural and functional impact of SNPs in P-selectin gene: A comprehensive in silico analysis
  7. Research Articles
  8. High embryogenic ability and regeneration from floral axis of Amorphophallus konjac (Araceae)
  9. Research Articles
  10. Terpene content of wine from the aromatic grape variety ‘Irsai Oliver’ (Vitis vinifera L.) depends on maceration time
  11. Research Articles
  12. Light and smell stimulus protocol reduced negative frontal EEG asymmetry and improved mood
  13. Research Articles
  14. Swailing affects seed germination of plants of European bio-and agricenosis in a different way
  15. Research Articles
  16. Survey analysis of soil physicochemical factors that influence the distribution of Cordyceps in the Xiahe Region of Gansu Province
  17. Research Articles
  18. Production of biogas: relationship between methanogenic and sulfate-reducing microorganisms
  19. Research Articles
  20. Pentraxin 3 and atherosclerosis among type 2 diabetic patients
  21. Research Articles
  22. Evaluation of ribosomal P0 peptide as a vaccine candidate against Argulus siamensis in Labeo rohita
  23. Research Articles
  24. Variation of autosomes and X chromosome STR in breast cancer and gynecological cancer tissues
  25. Research Articles
  26. Response of antioxidant enzymes to cadmium-induced cytotoxicity in rat cerebellar granule neurons
  27. Research Articles
  28. Cardiac hypertrophy and IGF-1 response to testosterone propionate treatment in trained male rats
  29. Research Articles
  30. BRAF-activated non-protein coding RNA (BANCR) advances the development of esophageal squamous cell carcinoma via cell cycle
  31. Research Articles
  32. The influence of soil salinity on volatile organic compounds emission and photosynthetic parameters of Solanum lycopersicum L. varieties
  33. Research Articles
  34. Simple Protocol for immunoglobulin G Purification from Camel “Camelus dromedarius” Serum
  35. Research Articles
  36. Expression of psbA1 gene in Synechocystis sp. PCC 6803 is influenced by CO2
  37. Research Articles
  38. Frequency of Thrombophilic Gene Mutations in Patients with Deep Vein Thrombosis and in Women with Recurrent Pregnancy Loss
  39. Research Articles
  40. Evaluation of anticancer properties of a new α-methylene-δ-lactone DL-249 on two cancer cell lines
  41. Research Articles
  42. Impact of heated waters on water quality and macroinvertebrate community in the Narew River (Poland)
  43. Research Articles
  44. Effects of Some Additives on In Vitro True Digestibility of Wheat and Soybean Straw Pellets
  45. Research Articles
  46. RNAi-mediated gene silencing in Rhynchophorus ferrugineus (Oliver) (Coleoptera: Curculionidae)
  47. Research Articles
  48. New pathway of icariin-induced MSC osteogenesis: transcriptional activation of TAZ/Runx2 by PI3K/Akt
  49. Research Articles
  50. Tudor-SN protein expression in colorectal cancer and its association with clinical characteristics
  51. Research Articles
  52. Proteomic and bioinformatics analysis of human saliva for the dental-risk assessment
  53. Research Articles
  54. Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis
  55. Research Articles
  56. Strain Stimulations with Different Intensities on Fibroblast Viability and Protein Expression
  57. Research Articles
  58. miR-539 mediates osteoblast mineralization by regulating Distal-less genes 2 in MC3T3-E1 cell line
  59. Research Articles
  60. Diversity of Intestinal Microbiota in Coilia ectenes from Lake Taihu, China
  61. Research Articles
  62. The production of arabitol by a novel plant yeast isolate Candida parapsilosis 27RL-4
  63. Research Articles
  64. Effectiveness of Azospirillum brasilense Sp245 on young plants of Vitis vinifera L.
  65. Research Articles
  66. Changes of photochemical efficiency and epidermal polyphenols content of Prosopis glandulosa and Prosopis juliflora leaves exposed to cadmium and copper
  67. Research Articles
  68. Ultraweak photon emission in strawberry fruit during ripening and aging is related to energy level
  69. Research Articles
  70. Molecular cloning, characterization and evolutionary analysis of leptin gene in Chinese giant salamander, Andrias davidianus
  71. Research Articles
  72. Longevity and stress resistance are affected by activation of TOR/Myc in progenitor cells of Drosophila gut
  73. Research Articles
  74. Curcumin attenuates oxidative stress in liver in Type 1 diabetic rats
  75. Research Articles
  76. Risk factors of long-term postoperative renal function after partial nephrectomy in a solitary kidney
  77. Research Articles
  78. Developmental anomalies of the right hepatic lobe: systematic comparative analysis of radiological features
  79. Review articles
  80. Genetic Defects Underlie the Non-syndromic Autosomal Recessive Intellectual Disability (NS-ARID)
  81. Review articles
  82. Research Progress on Tissue Culture and Genetic Transformation of Kenaf (Hibiscus cannabinus)
  83. Topical Issue On Precision Medicine
  84. MiR-107 inhibits proliferation of lung cancer cells through regulating TP53 regulated inhibitor of apoptosis 1 (TRIAP1)
  85. Topical Issue On Precision Medicine
  86. The functional role of exosome microRNAs in lung cancer
  87. Topical Issue On Precision Medicine
  88. The diagnostic value of serum microRNA-183 and TK1 as biomarkers for colorectal cancer diagnosis
  89. Topical Issue On Precision Medicine
  90. Screening feature modules and pathways in glioma using EgoNet
  91. Topical Issue On Precision Medicine
  92. Isoliquiritigenin inhibits colorectal cancer cells HCT-116 growth by suppressing the PI3K/AKT pathway
  93. Topical Issue On Precision Medicine
  94. Association between Caveolin-1 expression and pathophysiological progression of femoral nerves in diabetic foot amputation patients
  95. Topical Issue On Precision Medicine
  96. Biomarkers in patients with myocardial fibrosis
  97. Topical Issue On Precision Medicine
  98. Dysregulated pathways for off-pump coronary artery bypass grafting
  99. Topical Issue On Precision Medicine
  100. Individualized identification of disturbed pathways in sickle cell disease
  101. Topical Issue On Precision Medicine
  102. The prognostic value of serum PCT, hs-CRP, and IL-6 in patients with sepsis
  103. Topical Issue On Precision Medicine
  104. Sevoflurane-medicated the pathway of chemokine receptors bind chemokines in patients undergoing CABG
  105. Topical Issue On Precision Medicine
  106. The functional role of microRNAs in laryngeal carcinoma
  107. Topical Issue On Precision Medicine
  108. Revealing pathway cross-talk related to diabetes mellitus by Monte Carlo Cross-Validation analysis
  109. Topical Issue On Precision Medicine
  110. Correlation between CDKAL1 rs10946398C>A single nucleotide polymorphism and type 2 diabetes mellitus susceptibility: A meta-analysis
  111. Special Issue on Agricultural and Biological Sciences
  112. Effects of environmental variables on seedling distribution of rare and endangered Dacrydium pierrei
  113. Special Issue on Agricultural and Biological Sciences
  114. Study on synthesis and properties of nanoparticles loaded with amaryllidaceous alkaloids
  115. Special Issue on Agricultural and Biological Sciences
  116. Bacterial Infection Potato Tuber Soft Rot Disease Detection Based on Electronic Nose
  117. Special Issue on Agricultural and Biological Sciences
  118. Effects of subsoiling on maize yield and water-use efficiency in a semiarid area
https://doi.org/10.1515/biol-2017-0015
Keywords for this article
BANCR; Cell Cycle; ESCC
Creative Commons
BY-NC-ND 3.0

Articles in the same Issue

  1. Research Articles
  2. Field Performance and Genetic Fidelity of Micropropagated Plants of Coffea canephora (Pierre ex A. Froehner)
  3. Research Articles
  4. Foliage maturity of Quercus ilex affects the larval development of a Croatian coastal population of Lymantria dispar (Lepidoptera: Erebidae)
  5. Research Articles
  6. Structural and functional impact of SNPs in P-selectin gene: A comprehensive in silico analysis
  7. Research Articles
  8. High embryogenic ability and regeneration from floral axis of Amorphophallus konjac (Araceae)
  9. Research Articles
  10. Terpene content of wine from the aromatic grape variety ‘Irsai Oliver’ (Vitis vinifera L.) depends on maceration time
  11. Research Articles
  12. Light and smell stimulus protocol reduced negative frontal EEG asymmetry and improved mood
  13. Research Articles
  14. Swailing affects seed germination of plants of European bio-and agricenosis in a different way
  15. Research Articles
  16. Survey analysis of soil physicochemical factors that influence the distribution of Cordyceps in the Xiahe Region of Gansu Province
  17. Research Articles
  18. Production of biogas: relationship between methanogenic and sulfate-reducing microorganisms
  19. Research Articles
  20. Pentraxin 3 and atherosclerosis among type 2 diabetic patients
  21. Research Articles
  22. Evaluation of ribosomal P0 peptide as a vaccine candidate against Argulus siamensis in Labeo rohita
  23. Research Articles
  24. Variation of autosomes and X chromosome STR in breast cancer and gynecological cancer tissues
  25. Research Articles
  26. Response of antioxidant enzymes to cadmium-induced cytotoxicity in rat cerebellar granule neurons
  27. Research Articles
  28. Cardiac hypertrophy and IGF-1 response to testosterone propionate treatment in trained male rats
  29. Research Articles
  30. BRAF-activated non-protein coding RNA (BANCR) advances the development of esophageal squamous cell carcinoma via cell cycle
  31. Research Articles
  32. The influence of soil salinity on volatile organic compounds emission and photosynthetic parameters of Solanum lycopersicum L. varieties
  33. Research Articles
  34. Simple Protocol for immunoglobulin G Purification from Camel “Camelus dromedarius” Serum
  35. Research Articles
  36. Expression of psbA1 gene in Synechocystis sp. PCC 6803 is influenced by CO2
  37. Research Articles
  38. Frequency of Thrombophilic Gene Mutations in Patients with Deep Vein Thrombosis and in Women with Recurrent Pregnancy Loss
  39. Research Articles
  40. Evaluation of anticancer properties of a new α-methylene-δ-lactone DL-249 on two cancer cell lines
  41. Research Articles
  42. Impact of heated waters on water quality and macroinvertebrate community in the Narew River (Poland)
  43. Research Articles
  44. Effects of Some Additives on In Vitro True Digestibility of Wheat and Soybean Straw Pellets
  45. Research Articles
  46. RNAi-mediated gene silencing in Rhynchophorus ferrugineus (Oliver) (Coleoptera: Curculionidae)
  47. Research Articles
  48. New pathway of icariin-induced MSC osteogenesis: transcriptional activation of TAZ/Runx2 by PI3K/Akt
  49. Research Articles
  50. Tudor-SN protein expression in colorectal cancer and its association with clinical characteristics
  51. Research Articles
  52. Proteomic and bioinformatics analysis of human saliva for the dental-risk assessment
  53. Research Articles
  54. Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis
  55. Research Articles
  56. Strain Stimulations with Different Intensities on Fibroblast Viability and Protein Expression
  57. Research Articles
  58. miR-539 mediates osteoblast mineralization by regulating Distal-less genes 2 in MC3T3-E1 cell line
  59. Research Articles
  60. Diversity of Intestinal Microbiota in Coilia ectenes from Lake Taihu, China
  61. Research Articles
  62. The production of arabitol by a novel plant yeast isolate Candida parapsilosis 27RL-4
  63. Research Articles
  64. Effectiveness of Azospirillum brasilense Sp245 on young plants of Vitis vinifera L.
  65. Research Articles
  66. Changes of photochemical efficiency and epidermal polyphenols content of Prosopis glandulosa and Prosopis juliflora leaves exposed to cadmium and copper
  67. Research Articles
  68. Ultraweak photon emission in strawberry fruit during ripening and aging is related to energy level
  69. Research Articles
  70. Molecular cloning, characterization and evolutionary analysis of leptin gene in Chinese giant salamander, Andrias davidianus
  71. Research Articles
  72. Longevity and stress resistance are affected by activation of TOR/Myc in progenitor cells of Drosophila gut
  73. Research Articles
  74. Curcumin attenuates oxidative stress in liver in Type 1 diabetic rats
  75. Research Articles
  76. Risk factors of long-term postoperative renal function after partial nephrectomy in a solitary kidney
  77. Research Articles
  78. Developmental anomalies of the right hepatic lobe: systematic comparative analysis of radiological features
  79. Review articles
  80. Genetic Defects Underlie the Non-syndromic Autosomal Recessive Intellectual Disability (NS-ARID)
  81. Review articles
  82. Research Progress on Tissue Culture and Genetic Transformation of Kenaf (Hibiscus cannabinus)
  83. Topical Issue On Precision Medicine
  84. MiR-107 inhibits proliferation of lung cancer cells through regulating TP53 regulated inhibitor of apoptosis 1 (TRIAP1)
  85. Topical Issue On Precision Medicine
  86. The functional role of exosome microRNAs in lung cancer
  87. Topical Issue On Precision Medicine
  88. The diagnostic value of serum microRNA-183 and TK1 as biomarkers for colorectal cancer diagnosis
  89. Topical Issue On Precision Medicine
  90. Screening feature modules and pathways in glioma using EgoNet
  91. Topical Issue On Precision Medicine
  92. Isoliquiritigenin inhibits colorectal cancer cells HCT-116 growth by suppressing the PI3K/AKT pathway
  93. Topical Issue On Precision Medicine
  94. Association between Caveolin-1 expression and pathophysiological progression of femoral nerves in diabetic foot amputation patients
  95. Topical Issue On Precision Medicine
  96. Biomarkers in patients with myocardial fibrosis
  97. Topical Issue On Precision Medicine
  98. Dysregulated pathways for off-pump coronary artery bypass grafting
  99. Topical Issue On Precision Medicine
  100. Individualized identification of disturbed pathways in sickle cell disease
  101. Topical Issue On Precision Medicine
  102. The prognostic value of serum PCT, hs-CRP, and IL-6 in patients with sepsis
  103. Topical Issue On Precision Medicine
  104. Sevoflurane-medicated the pathway of chemokine receptors bind chemokines in patients undergoing CABG
  105. Topical Issue On Precision Medicine
  106. The functional role of microRNAs in laryngeal carcinoma
  107. Topical Issue On Precision Medicine
  108. Revealing pathway cross-talk related to diabetes mellitus by Monte Carlo Cross-Validation analysis
  109. Topical Issue On Precision Medicine
  110. Correlation between CDKAL1 rs10946398C>A single nucleotide polymorphism and type 2 diabetes mellitus susceptibility: A meta-analysis
  111. Special Issue on Agricultural and Biological Sciences
  112. Effects of environmental variables on seedling distribution of rare and endangered Dacrydium pierrei
  113. Special Issue on Agricultural and Biological Sciences
  114. Study on synthesis and properties of nanoparticles loaded with amaryllidaceous alkaloids
  115. Special Issue on Agricultural and Biological Sciences
  116. Bacterial Infection Potato Tuber Soft Rot Disease Detection Based on Electronic Nose
  117. Special Issue on Agricultural and Biological Sciences
  118. Effects of subsoiling on maize yield and water-use efficiency in a semiarid area
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 18.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2017-0015/html
Scroll to top button