Home Prostate Cancer-Specific of DD3-driven oncolytic virus-harboring mK5 gene
Article Open Access

Prostate Cancer-Specific of DD3-driven oncolytic virus-harboring mK5 gene

  • Jiali Hao , Wenjie Xie , Hui Li and Runsheng Li EMAIL logo
Published/Copyright: December 24, 2018
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 14 Issue 1

Abstract

Prostate cancer (PCa) is the second most diagnosed cancer in Western male population. In this study, we insert mK5 (the mutational kringle5 of human plasminogen) into a DD3-promoted (differential display code 3) oncolytic adenovirus to construct OncoAd.mK5.DD3. E1A.dE1B, briefly, OAd.DD3.mK5. DD3 is one of the most prostate cancer specific promoters which can transcriptionally control adenoviral replication. mK5 has been proved to be able to inhibit the tumor angiogenesis and inhibit cell proliferation. Our results suggested that targeting PCa with OAd.DD3.mK5 elicited strong antitumor effect.

Keywords: Oncolytic adenovirus; mK5; Prostate cancer; Angiogenesis

1 Introduction

Prostate cancer is the most major cause of morbidity and mortality rates for males in Western Societies [1,2]. Now, the rate of prostate cancer is gradually increasing in China. The traditional therapy for patients with the early-stage PCa is androgen deprivation therapy or chemotherapy. However, clinical improvement and tumor regression are temporary, and inevitably some of these patients progresses to androgen-independent and metastatic PCa. Right now, there is no curative treatment for patients with androgen-independent and advanced PCa.

In recent years, the oncology virus has gradually become one of the hotspots for anti-tumor research. The oncolytic adenovirus has been used as a most effective transfer vector with inserted therapeutic gene for tumor cells. It provides a promising treatment to PCa patients. Thus, in this study, we used replicating oncolytic adenovirus vector to express mK5 gene.

mK5, is the mutated K5 (the kringle5 of human plasminogen). Plasminogen is one of the key proenzyme precursors in the process of fibrin and thrombus were dissolved. Plasminogen contains 5 kringles. It has been discovered that kringle5 has more potent antiangiogenic effect [3, 4, 5]. Angiogenesis plays a key role in the development of a wide variety of malignant tumors. When the tumor grows, it needs to provide nutrition, oxygenation and should be metabolized by blood vessels. Angiogenesis is a rate-limiting step in tumor progression, so this strategy of targeting antiangiogenesis by inhibiting the formation of new blood vessels is rational [6,7]. On this basis, scientists mutated the kringle5, which replace Leu71 by arginine led to highly enhanced affinity of the ω-amino acid ligands for the LBS of K5 [8]. It showed that mK5 embraced stronger inhibition on angiogenesis [5]. We constructed a DD3-promoted oncolytic adenovirus expressing mK5 (OAd.DD3.mK5). DD3 promoter to control E1A gene expression shows specific antitumor effect on PCa. The OAd.DD3.mK5 was constructed to delete E1B containing E1B55KD and E1B19KD. E1B55KD protein facilitates prior transport of late stages viral RNA in tumor cells. Conversely, reduced replication of OAd.DD3.mK5 in normal cells results from defective exports of late viral RNA. In this paper, we researched the anti-tumor effect of OAd.DD3.mK5 both in vitro and vivo. And, our results showed that OAd. DD3. mK5 can powerfully eliminate prostate cancer cell line-LNCaP xenograft tumor in nude mice.

2 Materials and methods

2.1 Cells and cell cultures

These cell lines Hela, A549, LNCaP, 22RV1, WPMY-1 were purchased from the Cell Bank of the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). The HEK-293 cell line was obtained from Microbix Biosystems Inc (Toronto, Canada). The human primary prostatic fibroblast and human primary liver fibroblast cell lines were purchased from the iCell Bioscience Inc (Shanghai, China). All cell lines were cultured in manufacturer’s instructed medium supplemented with 10% foetal bovine serum (FBS, GIBCO, California, USA).

2.2 Adenovirus construction

The mK5 expression cassette was inserted into a deleted-E1B gene region of plasmid vector (pShuttle-DD3-E1A-dE1B). Oncolytic adenovirus plasmids were generated by shuttle vector and the adenoviral backbone plasmid in E.coli BJ5183 cells [9]. Oncolytic adenoviruses were packaged and amplified in HEK-293 cells, and viruses purified by gradient CsCl centrifugation. The viruses titer was measured using the Quick Titer Adenovirus Titer Immunoassay Kit (Cell Biolabs, San Diego, CA, USA).

2.3 Adenovirus identification

Viral genomic DNA was extracted for viral identification using the Blood Genome Extract Kit according to the manufacturer’s instructions (Generay, Shanghai, China). The mK5 gene expression cassette was identified by PCR using mK5 expression cassette primers (forward: GGTACCGCGGCCGCCTCGAG and reverse: CTCGAGATTGCATCGTCGAC). The existence of wild-type contaminants was identified by PCR using E1A-promoter primers (forward: GCGTAATATTTGTCTAGGG and reverse: CGGGTATAAATACACTACAC) and E1B primers (forward: CGTGTAGTGTATTTATACC and reverse: GTGGCAGATAATATGTCT).

2.4 Western blot analysis

Cells were seeded in 6-well plates and infected with OAd. DD3.mK5 at 5 MOI. After 48h, the cells were harvested. The protein concentration levels were measured by the Lowry assay (BioRad, Hercules, CA, USA) using manufacturer’s instructions. Western blot was performed according to standard protocols [10]. Antibodies information as follows: anti-GAPDH (CWBIO, Beijing, China); anti-E1A (Santa Cruz biotechnology, Santa Cruz, CA, USA).

2.5 Quantitative RT-PCR

Total RNA was extracted after 48h being infected with OAd.DD3.mK5 at 5 MOI using TRIzol (CWBIO, Beijing, China). Single-strand cDNA was synthesized using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan). RNA expression was analyzed using SuperReal Premix Plus (TIANGEN, Beijing, China) according to the manufacturer’s protocols. Each date was performed in triplicate assay. The sequences of all primers as follows: q-E1A primers (forward: GTGATAGAGTGGTGGGTTTGG and reverse: TCAGGCTCAGGTTCAGACA); q-GAPDH primers (forward: ACCCAGAAGACTGTGGATGG and reverse: TCTAGACGGCAGGTCAGGTC); q-mK5 primers (forward: GTTACGACTACTGTGATG and reverse: CGATCCAGACATGATAAG).

2.6 Proliferation assays

MTT (Amresco, USA) was used to measure cell proliferation. A total of 3000 cells were seeded in 96-well plates and infected with OAd.DD3.mK5 at a series of MOIs. Cells were cultured appointed times. After 4h of incubation with MTT solution, the medium of 96-well plates was removed and the cells were stained with150 μl DMSO. The absorbance was determined using microplate reader at 595 and 630 nm [11].

2.7 Animal experiments

All animal experiments were performed according to protocols approved by the US Public Health Service Policy on Humane Care and Use of Laboratory Animals. Three or four-week-old female BALB/c nude mice were purchased from the Animal Core Facility (Shanghai, China).

In tumorigenicity assay, 5 × 106 LNCaP cells were mixed with Matrigel (BD, Biosciences) at a 2:1 ratio and subcutaneously injected into the subaxillary regions of each mouse. When the tumors size reached about 80 mm3, the animals were randomly divided into PBS or OAd.DD3. mK5 (six mice per group). OAd.DD3.mK5(2.5 × 108 PFU per mouse) or PBS was intratumorally injected every other day for four times. The tumor volume of the six mice in each group was measured every three days and estimated using the following equation: (length × width2)/2 [12,13]. At the end of the experiment, mice were killed and the tumors were resected for H&E staining and immunofluorescence staining analyses [14, 15, 16].

2.8 Histopathology, IHC and TUNEL assay

Tumor tissues were harvested at the end of experiment and tissues were fixed in 4% paraformaldehyde (PFA) overnight, embedded in paraffin, sliced into 5 μm sections and stained with hematoxylin and eosin (H&E) for histological examination. Tumor tissues were OTC- embedded and sliced into 8μm sections. Frozen tumor sections were fixed in 4% PFA 30-60min, washed with PBS and incubated with 0.5%TritonX-100 to eliminate endogenous peroxidase activity. Then cryosections were blocked with the BSA (5%) and were stained with an anti-CD31 antibody (BD, USA) diluted to 1:400. The TUNEL assays were performed according to the manufacturer’s instructions (Beyotime, china) [17,18].

2.9 Statistical analysis

All data are presented as the mean ± standard deviation (S.D). Comparisons between two groups were performed with Student’s t-tests and the GraphPad Prism 6.0 software (GraphPad Software, LaJolla, CA, USA).

3 Result

3.1 Construction and identification of OAd. DD3.mK5

We constructed an oncolytic adenovirus that carried the mK5 gene, whose expression was driven by the differential display code 3 (DD3), one of the most prostate cancer specific promoters. (Figure 1A). PCR analysis of the E1B region and E1A-promoter region were free of wild-type adenovirus contaminations. Similarly, mK5 is proved to be inserted into the designated position by correct primers (Figure 1B-D).

Figure 1 Construction and characterization of OAd.DD3.mK5. A. Schematic diagram of the OAd.DD3.mK5. The mK5 expression cassette was inserted into OAd to construct OAd.DD3.mK5. ITR, inverted terminal repeats. B-D. Detection of oncolytic adenoviruses by PCR using the E1A-promoter primers (B), E1B primers (C) and mK5 expression cassette primers (D). HEK293, WT and Pshuttle-mK5 were used as positive control. H2O was used as negative control.
Figure 1

Construction and characterization of OAd.DD3.mK5. A. Schematic diagram of the OAd.DD3.mK5. The mK5 expression cassette was inserted into OAd to construct OAd.DD3.mK5. ITR, inverted terminal repeats. B-D. Detection of oncolytic adenoviruses by PCR using the E1A-promoter primers (B), E1B primers (C) and mK5 expression cassette primers (D). HEK293, WT and Pshuttle-mK5 were used as positive control. H2O was used as negative control.

The above results showed that we succeeded in packaging the oncolytic adenovirus OAd.DD3.mK5. In the subsequent experiments, we will do an in-depth study on its cancer inhibition.

3.2 OAd.DD3.mK5 exhibits enhanced replication in PCa cell lines

To research the characterization of OAd.DD3.mK5 in PCa, we compared the abilities of the OAd.DD3.mK5 to replicate in PCa cell lines and non-PCa cell lines. LNCaP, 22RV1, A549 and Hela cell lines were infected with OAd.DD3.mK5 at an MOI of 5. The replication efficacy of the adenovirus was estimated by qRT-PCR of adenovirus gene E1A cDNA. We measured more expression of E1A in LNCaP and 22RV1 cells. These results showed that OAd.DD3.mK5 replicated further effectively in PCa cell lines (Figure 2A-B). It is exhibited that OAd.DD3.mK5 selectively replicated in PCa cell lines. To further characterize them, the expressions of E1A also was examined in LNCaP, 22RV1, A549 and Hela infected with OAd.DD3.mK5 (5MOI, 48h) by Western blot. As shown in Figure 2C, the expression of E1A in LNCaP and 22RV1 treated with OAd.DD3.mK5 were higher than A549 and Hela cell lines. Likewise, the expression of the mK5 gene was measured in LNCaP, 22RV1, A549 and Hela (with OAd.DD3.mK5 at 5MOI for 48h) by qRT-PCR. We also found that the expression of the mK5 was higher in the PCa cell lines (Figure 2D).

Figure 2 OAd.DD3.mK5 largely replicated in PCa tumor cells. A. Analysis of E1A in LNCaP, 22RV1, A549 and Hela cell lines treated with OAd. DD3.mK5 at an MOI of 5 for 48 hours by qRT-PCR. B. Date A are processed as the fold change relative to mock cells. C. Expression of E1A measured by western blot. D. The expression of the mk5 in four cancer cell lines LNCaP, 22RV1, A549 and Hela was detected using qRT-PCR. The qRT-PCR data were normalized to GAPDH RNA. All experiments were repeated three times. The bars represent the mean ± S.D (n = 3).
Figure 2

OAd.DD3.mK5 largely replicated in PCa tumor cells. A. Analysis of E1A in LNCaP, 22RV1, A549 and Hela cell lines treated with OAd. DD3.mK5 at an MOI of 5 for 48 hours by qRT-PCR. B. Date A are processed as the fold change relative to mock cells. C. Expression of E1A measured by western blot. D. The expression of the mk5 in four cancer cell lines LNCaP, 22RV1, A549 and Hela was detected using qRT-PCR. The qRT-PCR data were normalized to GAPDH RNA. All experiments were repeated three times. The bars represent the mean ± S.D (n = 3).

3.3 OAd.DD3.mK5 displays specific antitumor activity to prostate cancer cells in vitro

Next, we investigate the cytotoxicity of OAd.DD3.mK5 in vitro by MTT assay. LNCaP and 22RV1 cells were infected with OAd.DD3.mK5 at various MOIs from 0.01–20. Cell viability was measured after 4 days (Figure 3A-B). The results showed that OAd.DD3.mK5 had a stronger antitumor effect in LNCaP and 22RV1 cells in a dose-dependent manner, especially in LNCaP cell. Further, LNCaP and 22RV1 were infected with the OAd.DD3.mK5 at an MOI of 10 for 4 days (Figure 3C-D). All of these assays came to same conclusion: OAd.DD3.mK5 had significantly greater antitumor efficacy in LNCaP and 22RV1 cells.

Figure 3 OAd.DD3.mK5 displays antitumor activity in vitro. A-B. Cell viability of LNCaP and 22RV1 cells infected with OAd.DD3.mK5 at a series of MOIs on day 4. C-D. Cell viability of LNCaP and 22RV1 cells infected with OAd.DD3.mK5 for 4 days at 10MOI. E-F. Cell viability of A549 and Hela cells infected with OAd.DD3.mK5 at various MOIs on day 4. All date were repeated three times. The bars represent the mean ± S.D. (n = 3).
Figure 3

OAd.DD3.mK5 displays antitumor activity in vitro. A-B. Cell viability of LNCaP and 22RV1 cells infected with OAd.DD3.mK5 at a series of MOIs on day 4. C-D. Cell viability of LNCaP and 22RV1 cells infected with OAd.DD3.mK5 for 4 days at 10MOI. E-F. Cell viability of A549 and Hela cells infected with OAd.DD3.mK5 at various MOIs on day 4. All date were repeated three times. The bars represent the mean ± S.D. (n = 3).

To evaluate the cytotoxicity specificity of OAd.DD3. mK5, cell viability also was measured in A549 and Hela cells with virus at a series of MOIs. As shown in Figure 3E-F, a rare cytopathic effect of OAd.DD3.mK5 was observed in A549 and Hela cells (even at an MOI of 50, Hela only was killed a little). These data indicated that OAd.DD3.mK5 was unable to significantly inhibit growth of non-PCa cells.

3.4 Safety measure of OAd.DD3.mK5

The above-mentioned data had showed that significant decreases in cell viability occurred after infected OAd.DD3. mK5 in PCa cells. For safety, we measured the normal prostate mesenchymal cell (WPMY-1). We examined the cell viability under the different treatments via the MTT method (Figure 4A-B). Encouragingly, merely weak slightly cytotoxic effect of OAd.DD3.mK5 was observed in WPMY-1 cell.

Figure 4 Safety measure of OAd.DD3.mK5. A. Cell viability of WPMY-1 cell infected with OAd.DD3.mK5 at a series of MOIs on day 4. B. Cell viability of WPMY-1 cell infected with OAd.DD3.mK5 at 10MOI for 4 days. C-D. Cell viability of human primary prostatic fibroblast and human primary liver fibroblast cells infected with OAd.DD3.mK5 at various MOIs on day 4. All date were repeated three times. The bars represent the mean ± S.D. (n = 3).
Figure 4

Safety measure of OAd.DD3.mK5. A. Cell viability of WPMY-1 cell infected with OAd.DD3.mK5 at a series of MOIs on day 4. B. Cell viability of WPMY-1 cell infected with OAd.DD3.mK5 at 10MOI for 4 days. C-D. Cell viability of human primary prostatic fibroblast and human primary liver fibroblast cells infected with OAd.DD3.mK5 at various MOIs on day 4. All date were repeated three times. The bars represent the mean ± S.D. (n = 3).

In a similar assay, we also measured the cytotoxicity of OAd.DD3.mK5 in human primary prostatic fibroblast and human primary liver fibroblast cells (Figure 4C-D). The results showed that OAd.DD3.mK5 had little killing effect on primary cells.

3.5 OAd.DD3.mK5 suppresses PCa tumor growth in vivo

To examine the antitumor efficacy of oncolytic adenoviruses in vivo, OAd.DD3.mK5 and corresponding volumes of PBS were intratumorally injected in LNCaP xenograft. The data showed that OAd.DD3.mK5 can suppress tumor growth rate compared with PBS. The tumor growth was suppressed on the OAd.DD3.mK5-treated group in which the tumors of 3 mice (n = 6) completely disappeared about 43 days after injection (Figure 5A). Next, those mice were observed for an additional 120 days and had a slight degree of relapses (Figure 5C), and all the 6 mice were alive at the end of the experiment. We also measured the mouse body weight lasted 160 days. The results showed that the OAd. DD3.mK5-treated mice had a higher body weight, which indicated that the injection of OAd.DD3.mK5 had no significant effect on the living condition of mice (Figure 5B). As shown in Figure 5D, volume of tumors were measured after 160 days treated with OAd.DD3.mK5 or PBS.

Figure 5 OAd.DD3.mK5 displays antitumor activity in vivo. A, C. Tumor growth curve of LNCaP xenograft tumors after intratumoral injection of 5×108 pfu/mouse adenoviruses . OAd.DD3.mK5 or PBS were injected 16 days after subcutaneous inoculation of LNCaP cells. B. Body weight of mouse after initial injection. D. Volume of tumors that grew in LNCaP mice to initial volume. After that, mice were treated with PBS or OAd. DD3.mK5 for 160 days. Data are shown as the mean ± S.D. *P < 0.05, **P < 0.01, ***P < 0.001.
Figure 5

OAd.DD3.mK5 displays antitumor activity in vivo. A, C. Tumor growth curve of LNCaP xenograft tumors after intratumoral injection of 5×108 pfu/mouse adenoviruses . OAd.DD3.mK5 or PBS were injected 16 days after subcutaneous inoculation of LNCaP cells. B. Body weight of mouse after initial injection. D. Volume of tumors that grew in LNCaP mice to initial volume. After that, mice were treated with PBS or OAd. DD3.mK5 for 160 days. Data are shown as the mean ± S.D. *P < 0.05, **P < 0.01, ***P < 0.001.

3.6 Immunohistochemistry revealed the antitumor mechanism of OAd. DD3.mK5

The antiangiogenesis and inhibition of cell proliferation effects of OAd.DD3.mK5 in LNCaP xenografts were analyzed using CD31 immunofluorescence staining and TUNEL staining, respectively. The number of positive cells for endothelial marker CD31 in untreated mice, and a few positive CD31 cells were observed in treated animals with OAd.DD3.mK5(Figure 6A-B). These results support a notion that OAd.DD3.mK5 suppressing tumor growth via inhibiting tumor angiogenesis. A superior percentage of TUNEL positive cells were observed in the OAd.DD3.mK5 treated tumors than in the PBS groups (Figure 6C-D).

Figure 6 Anti-angiogenic and anti-cell proliferation effects of OAd.DD3.mK5 in LNCaP mouse model. A.CD31 immunofluorescence staining of tumors tissue isolated from mice after OAd.DD3.mK5 or PBS treatment. B. Quantification on the positive CD31+ vessels number (n=3). C. Representative images of TUNEL staining from tumor tissue after OAd.DD3.mK5 or PBS treatment. D. Quantification of the TUNEL staining(n=3). E. H&E staining of the tumors tissue. Arrows indicate the vessels in tumor tissue. Scale bar, 200 μm. All experiments date were repeated three times, and the bars represent the mean ± S.D. (n = 3). **P<0.01.
Figure 6

Anti-angiogenic and anti-cell proliferation effects of OAd.DD3.mK5 in LNCaP mouse model. A.CD31 immunofluorescence staining of tumors tissue isolated from mice after OAd.DD3.mK5 or PBS treatment. B. Quantification on the positive CD31+ vessels number (n=3). C. Representative images of TUNEL staining from tumor tissue after OAd.DD3.mK5 or PBS treatment. D. Quantification of the TUNEL staining(n=3). E. H&E staining of the tumors tissue. Arrows indicate the vessels in tumor tissue. Scale bar, 200 μm. All experiments date were repeated three times, and the bars represent the mean ± S.D. (n = 3). **P<0.01.

Furthermore, histopathological analysis using H&E staining showed that OAd.DD3.mK5 induced less levels of cell death and necrosis within the tumor mass than PBS. And, compared to untreated animals or treated animals, tumors from OAd.DD3.mK5-treated mice tumor tissue contained fewer blood vessels ( Figure 6E).

4 Discussion

Prostate cancer is the second most numerous cancer of male. Symptoms of early stage prostate cancer are obscure and the process of prostate cancer can last over ten years. So, when patients were diagnosed with prostate cancer, they also have been developed to an advanced stage in

the majority of instances, which leading to the poor prognosis of patients [19, 20, 21]. Limited by the condition that surgical method and chemoradiotherapy are helpless to the advanced prostate cancer patients, the 5-year overall survival rate is lower than 60% [22]. Oncolytic virus has showed the powerful antitumor effect in melanoma, lung cancer and multiple other cancers [23, 24, 25]. In this study, we proved a modified oncolytic virus carry a heterologous gene (mK5) can significant killing prostate cancer in vivo or in vitro.

The first time when the concept of oncolytic virus brought up was 1950s. After half a century development, the varies of strategies were put forward to optimize the oncolytic virus therapy. All of these strategies were mainly concentrated on two areas, improve the tumor specificity and the cancer-killing effect [26]. Ad5 is the most common human host virus used as vehicle to carry the heterologous gene to target cancer cells. ZD55 was reported previously, then we exchanged ZD55 E1A promotor to DD3 to improve tumor specificity of OAd.DD3.mK5. A 214-bp fragment of the DD3 core promoter has a high promoter activity, which highly overexpression in most types of prostate cancer, activated by androgen-receptor sensitively. The specificity of this promoter has been confirmed by the safety test. The DD3 promoter also can improve replication of adenovirus in prostate cancer cell, which significantly enhance the cytotoxicity effect.

Even a lot of the oncolytic virus therapy product have been launched, the clinical effect of virus were still in doubt. Therefore, the “Targeting Gene-Viro Therapy” suggests that oncolytic virus combined with gene therapy may more effective to help the cancer treatment than just inject a simple oncolytic virus alone. K5 play the key role in multiple cancers, mK5 is better than K5[27,28]. The OAd.DD3.mK5 showed have more effective to inhibit the angiogenesis and cancer cell proliferation in tumor [18,29]. The immunofluorescence staining and H&E staining also confirmed this effect. In vivo test showed that the OAd.DD3. mK5 can stop the xenografts tumor growth after injected immediately. However, the mechanism by which OAd.DD3. mK5 in the inhibition of tumor angiogenesis and proliferation still requires validation with additional experiments

We also try to determine the long-term safety and antitumor effect of OAd.DD3.mK5 by measuring the tumor size and body weight of mice until 160 days since OAd.DD3.mK injection. The extended animal experiment was designed to detect whether the tumor would recur after eliminated. The results illustrate OAd.DD3.mK5 can control the tumor development for an excessively long time, and nearly complete unaffected of mice living condition. But the antiviral system is activated by CD8+ T cell and the nude mice are lack of innate immune system [30]. The treatment effect in the model with whole immune system may different. So, the detailed mechanism and killing effect in immunized model are needed further investigate.

Although OAd.DD3.mK5 showed significant antitumor effects in our study, there are also some limitations to be solved before OAd.DD3.mK5 can be further used in clinical trials for prostate cancer patients, especially when it is delivered via intravenous injection. The existing limitations mainly include liver damage caused by virus accumulation and the clearance of viral particles by neutralizing antibodies, immune responses against the virus, and the influence of the tumor microenvironment on viral replication [16]. To address these problems, combined treatment with chemoradiotherapy, immunotherapy, packaging or modification via nanoparticles [17] had been used for the treatment of the oncolytic virus.

In summary, we construct a new oncolytic virus carry the human mK5 gene. These viruses can effective remission the tumor development and kill the prostate cancer cell in vivo and in vitro, which shows to have potential for clinical therapy.

Acknowledgments

This work was supported by a programme of Shanghai Municipal Committee of Science and Technology (grant nos. 15431902800 and 15140903100), the Conba-Zhejiang Sci-Tech University, Academician Workstation (Nos.116129A4J14365) and National Nature Science Foundation of China (81372453, 81572999), Shanghai Institutes for Biological Science, Chinese Academy of Sciences, and Sichuan Huiyang Life Science and Technology Corp. research program (Y363S21763).

  1. Conflict of interest

    Conflict of interest statement: Authors state no conflict of interest.

References

[1] Denmeade S.R.,Isaacs J.T., Development of prostate cancer treatment: The good news, Prostate, 2004, 58, 211-22410.1002/pros.10360Search in Google Scholar PubMed

[2] Sarkar D., Lebedeva I.V., Su Z.Z., Park E.S., Chatman L., Vozhilla N. et al., Eradication of therapy-resistant human prostate tumors using a cancer terminator virus, Cancer Research, 2007, 67, 5434-544210.1158/0008-5472.CAN-07-0195Search in Google Scholar PubMed

[3] Cao Y., Chen A., An S.S., Ji R.W., Davidson D.,Llinás M., Kringle 5 of plasminogen is a novel inhibitor of endothelial cell growth, Journal of Biological Chemistry, 1997, 272, 22924-2292810.1074/jbc.272.36.22924Search in Google Scholar PubMed

[4] Ji W.R., Barrientos L.G., Llinas M., Gray H., Villarreal X., DeFord M.E. et al., Selective inhibition by kringle 5 of human plasminogen on endothelial cell migration, an important process in angiogenesis, Biochem Biophys Res Commun, 1998, 247, 414-41910.1006/bbrc.1998.8825Search in Google Scholar PubMed

[5] Lu H., Dhanabal M., Volk R., Waterman M.J., Ramchandran R., Knebelmann B. et al., Kringle 5 causes cell cycle arrest and apoptosis of endothelial cells, Biochemical & Biophysical Research Communications, 1999, 258, 66810.1006/bbrc.1999.0612Search in Google Scholar PubMed

[6] Boehm T., Folkman J., Browder T.,O’Reilly M.S., Antiangiogenic therapy of experimental cancer does not induce acquired drug resistance, Nature, 1997, 390, 404-40710.1038/37126Search in Google Scholar PubMed

[7] Griffioen A.W.,Molema G., Angiogenesis : Potentials for pharmacologic intervention in the treatment of cancer, cardiovascular diseases, and chronic inflammation, Pharmacological Reviews, 2000, 52, 237Search in Google Scholar

[8] Hallenbeck P.L., Chang Y.N., Hay C., Golightly D., Stewart D., Lin J. et al., A novel tumor-specific replication-restricted adenoviral vector for gene therapy of hepatocellular carcinoma, Human Gene Therapy, 1999, 10, 172110.1089/10430349950017725Search in Google Scholar PubMed

[9] Fan J.K., Wei N., Ding M., Gu J.F., Liu X.R., Li B.H. et al., Targeting gene‐virotherapy for prostate cancer by dd3‐driven oncolytic virus‐harboring interleukin‐24 gene, International Journal of Cancer Journal International Du Cancer, 2010, 127, 70710.1002/ijc.25069Search in Google Scholar PubMed

[10] Sugano E., Tomita H.S., Abe T.,Tamai M., Establishment of effective methods for transducing genes into iris pigment epithelial cells by using adeno-associated virus type 2, Investigative Ophthalmology & Visual Science, 2005, 46, 334110.1167/iovs.04-1351Search in Google Scholar PubMed

[11] Pan Q., Huang Y., Chen L., Gu J.,Zhou X., Smac-armed vaccinia virus induces both apoptosis and necroptosis and synergizes the efficiency of vinblastine in hcc, Human Cell, 2014, 27, 162-17110.1007/s13577-014-0093-zSearch in Google Scholar PubMed

[12] Wang X., An Z., Geller J.,Hoffman R.M., High-malignancy orthotopic nude mouse model of human prostate cancer lncap, Prostate, 2015, 39, 182-18610.1002/(SICI)1097-0045(19990515)39:3<182::AID-PROS6>3.0.CO;2-BSearch in Google Scholar

[13] Chung L.W., Zhau H.E.,Wu T.T., Development of human prostate cancer models for chemoprevention and experimental therapeutics studies, Journal of Cellular Biochemistry Supplement, 1997, 28-29, 17410.1002/(SICI)1097-4644(1997)28/29+<174::AID-JCB21>3.0.CO;2-GSearch in Google Scholar

[14] Yuan S., Fang X., Xu Y., Ni A., Liu X.Y.,Chu L., An oncolytic adenovirus that expresses the hab18 and interleukin 24 genes exhibits enhanced antitumor activity in hepatocellular carcinoma cells, Oncotarget, 2016, 7, 60491-6050210.18632/oncotarget.11134Search in Google Scholar

[15] Xu Y., Chu L., Yuan S., Yang Y., Yang Y., Xu B. et al., Rgd-modified oncolytic adenovirus-harboring shpkm2 exhibits a potent cytotoxic effect in pancreatic cancer via autophagy inhibition and apoptosis promotion, Cell Death & Disease, 2017, 8, e283510.1038/cddis.2017.230Search in Google Scholar

[16] Ying C., Xiao B.D., Qin Y., Wang B.R., Liu X.Y., Wang R.W. et al., Golph2-regulated oncolytic adenovirus, gd55, exerts strong killing effect on human prostate cancer stem-like cells in vitro and in vivo, Acta Pharmacologica Sinica, 2017, 39, 405-41410.1038/aps.2017.91Search in Google Scholar

[17] Chen J., Gao P., Yuan S., Li R., Ni A., Chu L. et al., Oncolytic adenovirus complexes coated with lipids and calcium phosphate for cancer gene therapy, Acs Nano, 2016, 10, 11548-1156010.1021/acsnano.6b06182Search in Google Scholar

[18] Fan J., Xiao T., Jf, Wei N., He L., Ding M.,Liu X., Increased suppression of oncolytic adenovirus carrying mutant k5 on colorectal tumor, Biochemical & Biophysical Research Communications, 2008, 374, 198-20310.1016/j.bbrc.2008.07.005Search in Google Scholar

[19] Heidenreich A., Bastian P.J., Bellmunt J., Bolla M., Joniau S., Van T.D.K. et al., Eau guidelines on prostate cancer. Part 1: Screening, diagnosis, and local treatment with curative intent-update 2013, European Urology, 2014, 65, 12410.1016/j.eururo.2013.09.046Search in Google Scholar

[20] Sternberg C., Systemic treatment and new developments in advanced prostate cancer, European Journal of Cancer, 2001, 37 Suppl 7, S14710.1016/S0959-8049(01)80016-2Search in Google Scholar

[21] Nicholson B., Gulding K., Conaway M., Wedge S.R.,The-odorescu D., Combination antiangiogenic and androgen deprivation therapy for prostate cancer: A promising therapeutic approach, Clinical Cancer Research An Official Journal of the American Association for Cancer Research, 2004, 10, 872810.1158/1078-0432.CCR-04-0902Search in Google Scholar

[22] Epstein J.I., Jr A.W., Amin M.B., Egevad L.L.,Committee I.G., The 2005 international society of urological pathology (isup) consensus conference on gleason grading of prostatic carcinoma, American Journal of Surgical Pathology, 2006, 49, 758-75910.1097/01.pas.0000173646.99337.b1Search in Google Scholar PubMed

[23] Andtbacka R.H., Ross M., Puzanov I., Milhem M., Collichio F., Delman K.A. et al., Patterns of clinical response with talimogene laherparepvec (t-vec) in patients with melanoma treated in the optim phase iii clinical trial, Annals of Surgical Oncology, 2016, 23, 416910.1245/s10434-016-5286-0Search in Google Scholar PubMed PubMed Central

[24] Johnson D.B., Puzanov I.,Kelley M.C., Talimogene laherparepvec (t-vec) for the treatment of advanced melanoma, Immunotherapy, 2015, 7, 611-61910.2217/imt.15.35Search in Google Scholar PubMed PubMed Central

[25] Watanabe T., Hioki M., Fujiwara T., Nishizaki M., Kagawa S., Taki M. et al., Histone deacetylase inhibitor fr901228 enhances the antitumor effect of telomerase-specific replication-selective adenoviral agent obp-301 in human lung cancer cells, Experimental Cell Research, 2006, 312, 25610.1016/j.yexcr.2005.10.026Search in Google Scholar PubMed

[26] Parato K.A., Senger D., Forsyth P.A.,Bell J.C., Recent progress in the battle between oncolytic viruses and tumours, Nature Reviews Cancer, 2005, 5, 965-97610.1038/nrc1750Search in Google Scholar PubMed

[27] Chang Y., Mochalkin I., Mccance S.G., Cheng B., Tulinsky A.,Castellino F.J., Structure and ligand binding determinants of the recombinant kringle 5 domain of human plasminogen, Biochemistry, 1998, 37, 3258-327110.1021/bi972284eSearch in Google Scholar PubMed

[28] González-Suárez E., Geserick C., Flores J.M.,Blasco M.A., Antagonistic effects of telomerase on cancer and aging in k5-mtert transgenic mice, Oncogene, 2005, 24, 2256-227010.1038/sj.onc.1208413Search in Google Scholar PubMed

[29] Bui Nguyen T.M., Subramanian I.V., Xiao X., Nguyen P.,Ramakrishnan S., Adeno-associated virus-mediated delivery of kringle 5 of human plasminogen inhibits orthotopic growth of ovarian cancer, Gene Therapy, 2010, 17, 606-61510.1038/gt.2010.15Search in Google Scholar PubMed

[30] Ikeda K., Ichikawa T., Wakimoto H., Silver J.S., Deisboeck T.S., Finkelstein D. et al., Oncolytic virus therapy of multiple tumors in the brain requires suppression of innate and elicited antiviral responses, Nature Medicine, 1999, 5, 881-88710.1038/11320Search in Google Scholar PubMed

Received: 2018-05-24
Accepted: 2018-05-29
Published Online: 2018-12-24

© 2019 Jiali Hao et al. published by De Gruyter

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Articles in the same Issue

  1. Research Article
  2. Prostate Cancer-Specific of DD3-driven oncolytic virus-harboring mK5 gene
  3. Case Report
  4. Pediatric acute paradoxical cerebral embolism with pulmonary embolism caused by extremely small patent foramen ovale
  5. Research Article
  6. Associations between ambient temperature and acute myocardial infarction
  7. Case Report
  8. Discontinuation of imatinib mesylate could improve renal impairment in chronic myeloid leukemia
  9. Research Article
  10. METTL3 promotes the proliferation and mobility of gastric cancer cells
  11. The C677T polymorphism of the methylenetetrahydrofolate reductase gene and susceptibility to late-onset Alzheimer’s disease
  12. microRNA-1236-3p regulates DDP resistance in lung cancer cells
  13. Review Article
  14. The link between thyroid autoimmunity, depression and bipolar disorder
  15. Research Article
  16. Effects of miR-107 on the Chemo-drug sensitivity of breast cancer cells
  17. Analysis of pH dose-dependent growth of sulfate-reducing bacteria
  18. Review Article
  19. Musculoskeletal clinical and imaging manifestations in inflammatory bowel diseases
  20. Research Article
  21. Regional hyperthermia combined with chemotherapy in advanced gastric cancer
  22. Analysis of hormone receptor status in primary and recurrent breast cancer via data mining pathology reports
  23. Morphological and isokinetic strength differences: bilateral and ipsilateral variation by different sport activity
  24. The reliability of adjusting stepped care based on FeNO monitoring for patients with chronic persistent asthma
  25. Comparison of the clinical outcomes of two physiological ischemic training methods in patients with coronary heart disease
  26. Analysis of ticagrelor’s cardio-protective effects on patients with ST-segment elevation acute coronary syndrome accompanied with diabetes
  27. Computed tomography findings in patients with Samter’s Triad: an observational study
  28. Case Report
  29. A spinal subdural hematoma induced by guidewire-based lumbar drainage in a patient with ruptured intracranial aneurysms
  30. Research Article
  31. High expression B3GAT3 is related with poor prognosis of liver cancer
  32. Effects of light touch on balance in patients with stroke
  33. Oncoprotein LAMTOR5 activates GLUT1 via upregulating NF-κB in liver cancer
  34. Effects of budesonide combined with noninvasive ventilation on PCT, sTREM-1, chest lung compliance, humoral immune function and quality of life in patients with AECOPD complicated with type II respiratory failure
  35. Prognostic significance of lymph node ratio in ovarian cancer
  36. Case Report
  37. Brainstem anaesthesia after retrobulbar block
  38. Review Article
  39. Treating infertility: current affairs of cross-border reproductive care
  40. Research Article
  41. Serum inflammatory cytokines comparison in gastric cancer therapy
  42. Behavioural and psychological symptoms in neurocognitive disorders: Specific patterns in dementia subtypes
  43. MRI and bone scintigraphy for breast cancer bone metastase: a meta-analysis
  44. Comparative study of back propagation artificial neural networks and logistic regression model in predicting poor prognosis after acute ischemic stroke
  45. Analysis of the factors affecting the prognosis of glioma patients
  46. Compare fuhrman nuclear and chromophobe tumor grade on chromophobe RCC
  47. Case Report
  48. Signet ring B cell lymphoma: A potential diagnostic pitfall
  49. Research Article
  50. Subparaneural injection in popliteal sciatic nerve blocks evaluated by MRI
  51. Loneliness in the context of quality of life of nursing home residents
  52. Biological characteristics of cervical precancerous cell proliferation
  53. Effects of Rehabilitation in Bankart Lesion in Non-athletes: A report of three cases
  54. Management of complications of first instance of hepatic trauma in a liver surgery unit: Portal vein ligation as a conservative therapeutic strategy
  55. Matrix metalloproteinase 2 knockdown suppresses the proliferation of HepG2 and Huh7 cells and enhances the cisplatin effect
  56. Comparison of laparoscopy and open radical nephrectomy of renal cell cancer
  57. Case Report
  58. A severe complication of myocardial dysfunction post radiofrequency ablation treatment of huge hepatic hemangioma: a case report and literature review
  59. Solar urticaria, a disease with many dark sides: is omalizumab the right therapeutic response? Reflections from a clinical case report
  60. Research Article
  61. Binge eating disorder and related features in bariatric surgery candidates
  62. Propofol versus 4-hydroxybutyric acid in pediatric cardiac catheterizations
  63. Nasointestinal tube in mechanical ventilation patients is more advantageous
  64. The change of endotracheal tube cuff pressure during laparoscopic surgery
  65. Correlation between iPTH levels on the first postoperative day after total thyroidectomy and permanent hypoparathyroidism: our experience
  66. Case Report
  67. Primary angiosarcoma of the kidney: case report and comprehensive literature review
  68. Research Article
  69. miR-107 enhances the sensitivity of breast cancer cells to paclitaxel
  70. Incidental findings in dental radiology are concerning for family doctors
  71. Suffering from cerebral small vessel disease with and without metabolic syndrome
  72. A meta-analysis of robot assisted laparoscopic radical prostatectomy versus laparoscopic radical prostatectomy
  73. Indications and outcomes of splenectomy for hematological disorders
  74. Expression of CENPE and its prognostic role in non-small cell lung cancer
  75. Barbed suture and gastrointestinal surgery. A retrospective analysis
  76. Using post transplant 1 week Tc-99m DTPA renal scan as another method for predicting renal graft failure
  77. The pseudogene PTTG3P promotes cell migration and invasion in esophageal squamous cell carcinoma
  78. Lymph node ratio versus TNM system as prognostic factor in colorectal cancer staging. A single Center experience
  79. Review Article
  80. Minimally invasive pilonidal sinus treatment: A narrative review
  81. Research Article
  82. Anatomical workspace study of Endonasal Endoscopic Transsphenoidal Approach
  83. Hounsfield Units on Lumbar Computed Tomography for Predicting Regional Bone Mineral Density
  84. Communication
  85. Aspirin, a potential GLUT1 inhibitor in a vascular endothelial cell line
  86. Research Article
  87. Osteopontin and fatty acid binding protein in ifosfamide-treated rats
  88. Familial polyposis coli: the management of desmoid tumor bleeding
  89. microRNA-27a-3p down-regulation inhibits malignant biological behaviors of ovarian cancer by targeting BTG1
  90. PYCR1 is associated with papillary renal cell carcinoma progression
  91. Prediction of recurrence-associated death from localized prostate cancer with a charlson comorbidity index–reinforced machine learning model
  92. Colorectal cancer in the elderly patient: the role of neo-adjuvant therapy
  93. Association between MTHFR genetic polymorphism and Parkinson’s disease susceptibility: a meta-analysis
  94. Metformin can alleviate the symptom of patient with diabetic nephropathy through reducing the serum level of Hcy and IL-33
  95. Case Report
  96. Severe craniofacial trauma after multiple pistol shots
  97. Research Article
  98. Echocardiography evaluation of left ventricular diastolic function in elderly women with metabolic syndrome
  99. Tailored surgery in inguinal hernia repair. The role of subarachnoid anesthesia: a retrospective study
  100. The factors affecting early death in newly diagnosed APL patients
  101. Review Article
  102. Oncological outcomes and quality of life after rectal cancer surgery
  103. Research Article
  104. MiR-638 repressed vascular smooth muscle cell glycolysis by targeting LDHA
  105. microRNA-16 via Twist1 inhibits EMT induced by PM2.5 exposure in human hepatocellular carcinoma
  106. Analyzing the semantic space of the Hippocratic Oath
  107. Fournier’s gangrene and intravenous drug abuse: an unusual case report and review of the literature
  108. Evaluation of surgical site infection in mini-invasive urological surgery
  109. Dihydromyricetin attenuates inflammation through TLR4/NF-kappaB pathway
  110. Clinico-pathological features of colon cancer patients undergoing emergency surgery: a comparison between elderly and non-elderly patients
  111. Case Report
  112. Appendix bleeding with painless bloody diarrhea: A case report and literature review
  113. Research Article
  114. Protective effects of specneuzhenide on renal injury in rats with diabetic nephropathy
  115. PBF, a proto-oncogene in esophageal carcinoma
  116. Use of rituximab in NHL malt type pregnant in I° trimester for two times
  117. Cancer- and non-cancer related chronic pain: from the physiopathological basics to management
  118. Case report
  119. Non-surgical removal of dens invaginatus in maxillary lateral incisor using CBCT: Two-year follow-up case report
  120. Research Article
  121. Risk factors and drug resistance of the MDR Acinetobacter baumannii in pneumonia patients in ICU
  122. Accuracy of tumor perfusion assessment in Rat C6 gliomas model with USPIO
  123. Lemann Index for Assessment of Crohn’s Disease: Correlation with the Quality of Life, Endoscopic Disease activity, Magnetic Resonance Index of Activity and C- Reactive Protein
  124. Case report
  125. Münchausen syndrome as an unusual cause of pseudo-resistant hypertension: a case report
  126. Research Article
  127. Renal artery embolization before radical nephrectomy for complex renal tumour: which are the true advantages?
  128. Prognostic significance of CD276 in non-small cell lung cancer
  129. Potential drug-drug interactions in acute ischemic stroke patients at the Neurological Intensive Care Unit
  130. Effect of vitamin D3 on lung damage induced by cigarette smoke in mice
  131. CircRNA-UCK2 increased TET1 inhibits proliferation and invasion of prostate cancer cells via sponge miRNA-767-5p
  132. Case report
  133. Partial hydatidiform mole and coexistent live fetus: a case report and review of the literature
  134. Research Article
  135. Effect of NGR1 on the atopic dermatitis model and its mechanisms
  136. Clinical features of infertile men carrying a chromosome 9 translocation
  137. Review Article
  138. Expression and role of microRNA-663b in childhood acute lymphocytic leukemia and its mechanism
  139. Case Report
  140. Mature cystic teratoma of the pancreas: A rare cystic neoplasm
  141. Research Article
  142. Application of exercised-based pre-rehabilitation in perioperative period of patients with gastric cancer
  143. Case Report
  144. Predictive factors of intestinal necrosis in acute mesenteric ischemia
  145. Research Article
  146. Application of exercised-based pre-rehabilitation in perioperative period of patients with gastric cancer
  147. Effects of dexmedetomidine on the RhoA /ROCK/ Nox4 signaling pathway in renal fibrosis of diabetic rats
  148. MicroRNA-181a-5p regulates inflammatory response of macrophages in sepsis
  149. Intraventricular pressure in non-communicating hydrocephalus patients before endoscopic third ventriculostomy
  150. CyclinD1 is a new target gene of tumor suppressor miR-520e in breast cancer
  151. CHL1 and NrCAM are primarily expressed in low grade pediatric neuroblastoma
  152. Epidemiological characteristics of postoperative sepsis
  153. Association between unstable angina and CXCL17: a new potential biomarker
  154. Cardiac strains as a tool for optimization of cardiac resynchronization therapy in non-responders: a pilot study
  155. Case Report
  156. Resuscitation following a bupivacaine injection for a cervical paravertebral block
  157. Research Article
  158. CGF treatment of leg ulcers: A randomized controlled trial
  159. Surgical versus sequential hybrid treatment of carotid body tumors
https://doi.org/10.1515/med-2019-0001
Keywords for this article
Oncolytic adenovirus; mK5; Prostate cancer; Angiogenesis
Creative Commons
BY-NC-ND 4.0

Articles in the same Issue

  1. Research Article
  2. Prostate Cancer-Specific of DD3-driven oncolytic virus-harboring mK5 gene
  3. Case Report
  4. Pediatric acute paradoxical cerebral embolism with pulmonary embolism caused by extremely small patent foramen ovale
  5. Research Article
  6. Associations between ambient temperature and acute myocardial infarction
  7. Case Report
  8. Discontinuation of imatinib mesylate could improve renal impairment in chronic myeloid leukemia
  9. Research Article
  10. METTL3 promotes the proliferation and mobility of gastric cancer cells
  11. The C677T polymorphism of the methylenetetrahydrofolate reductase gene and susceptibility to late-onset Alzheimer’s disease
  12. microRNA-1236-3p regulates DDP resistance in lung cancer cells
  13. Review Article
  14. The link between thyroid autoimmunity, depression and bipolar disorder
  15. Research Article
  16. Effects of miR-107 on the Chemo-drug sensitivity of breast cancer cells
  17. Analysis of pH dose-dependent growth of sulfate-reducing bacteria
  18. Review Article
  19. Musculoskeletal clinical and imaging manifestations in inflammatory bowel diseases
  20. Research Article
  21. Regional hyperthermia combined with chemotherapy in advanced gastric cancer
  22. Analysis of hormone receptor status in primary and recurrent breast cancer via data mining pathology reports
  23. Morphological and isokinetic strength differences: bilateral and ipsilateral variation by different sport activity
  24. The reliability of adjusting stepped care based on FeNO monitoring for patients with chronic persistent asthma
  25. Comparison of the clinical outcomes of two physiological ischemic training methods in patients with coronary heart disease
  26. Analysis of ticagrelor’s cardio-protective effects on patients with ST-segment elevation acute coronary syndrome accompanied with diabetes
  27. Computed tomography findings in patients with Samter’s Triad: an observational study
  28. Case Report
  29. A spinal subdural hematoma induced by guidewire-based lumbar drainage in a patient with ruptured intracranial aneurysms
  30. Research Article
  31. High expression B3GAT3 is related with poor prognosis of liver cancer
  32. Effects of light touch on balance in patients with stroke
  33. Oncoprotein LAMTOR5 activates GLUT1 via upregulating NF-κB in liver cancer
  34. Effects of budesonide combined with noninvasive ventilation on PCT, sTREM-1, chest lung compliance, humoral immune function and quality of life in patients with AECOPD complicated with type II respiratory failure
  35. Prognostic significance of lymph node ratio in ovarian cancer
  36. Case Report
  37. Brainstem anaesthesia after retrobulbar block
  38. Review Article
  39. Treating infertility: current affairs of cross-border reproductive care
  40. Research Article
  41. Serum inflammatory cytokines comparison in gastric cancer therapy
  42. Behavioural and psychological symptoms in neurocognitive disorders: Specific patterns in dementia subtypes
  43. MRI and bone scintigraphy for breast cancer bone metastase: a meta-analysis
  44. Comparative study of back propagation artificial neural networks and logistic regression model in predicting poor prognosis after acute ischemic stroke
  45. Analysis of the factors affecting the prognosis of glioma patients
  46. Compare fuhrman nuclear and chromophobe tumor grade on chromophobe RCC
  47. Case Report
  48. Signet ring B cell lymphoma: A potential diagnostic pitfall
  49. Research Article
  50. Subparaneural injection in popliteal sciatic nerve blocks evaluated by MRI
  51. Loneliness in the context of quality of life of nursing home residents
  52. Biological characteristics of cervical precancerous cell proliferation
  53. Effects of Rehabilitation in Bankart Lesion in Non-athletes: A report of three cases
  54. Management of complications of first instance of hepatic trauma in a liver surgery unit: Portal vein ligation as a conservative therapeutic strategy
  55. Matrix metalloproteinase 2 knockdown suppresses the proliferation of HepG2 and Huh7 cells and enhances the cisplatin effect
  56. Comparison of laparoscopy and open radical nephrectomy of renal cell cancer
  57. Case Report
  58. A severe complication of myocardial dysfunction post radiofrequency ablation treatment of huge hepatic hemangioma: a case report and literature review
  59. Solar urticaria, a disease with many dark sides: is omalizumab the right therapeutic response? Reflections from a clinical case report
  60. Research Article
  61. Binge eating disorder and related features in bariatric surgery candidates
  62. Propofol versus 4-hydroxybutyric acid in pediatric cardiac catheterizations
  63. Nasointestinal tube in mechanical ventilation patients is more advantageous
  64. The change of endotracheal tube cuff pressure during laparoscopic surgery
  65. Correlation between iPTH levels on the first postoperative day after total thyroidectomy and permanent hypoparathyroidism: our experience
  66. Case Report
  67. Primary angiosarcoma of the kidney: case report and comprehensive literature review
  68. Research Article
  69. miR-107 enhances the sensitivity of breast cancer cells to paclitaxel
  70. Incidental findings in dental radiology are concerning for family doctors
  71. Suffering from cerebral small vessel disease with and without metabolic syndrome
  72. A meta-analysis of robot assisted laparoscopic radical prostatectomy versus laparoscopic radical prostatectomy
  73. Indications and outcomes of splenectomy for hematological disorders
  74. Expression of CENPE and its prognostic role in non-small cell lung cancer
  75. Barbed suture and gastrointestinal surgery. A retrospective analysis
  76. Using post transplant 1 week Tc-99m DTPA renal scan as another method for predicting renal graft failure
  77. The pseudogene PTTG3P promotes cell migration and invasion in esophageal squamous cell carcinoma
  78. Lymph node ratio versus TNM system as prognostic factor in colorectal cancer staging. A single Center experience
  79. Review Article
  80. Minimally invasive pilonidal sinus treatment: A narrative review
  81. Research Article
  82. Anatomical workspace study of Endonasal Endoscopic Transsphenoidal Approach
  83. Hounsfield Units on Lumbar Computed Tomography for Predicting Regional Bone Mineral Density
  84. Communication
  85. Aspirin, a potential GLUT1 inhibitor in a vascular endothelial cell line
  86. Research Article
  87. Osteopontin and fatty acid binding protein in ifosfamide-treated rats
  88. Familial polyposis coli: the management of desmoid tumor bleeding
  89. microRNA-27a-3p down-regulation inhibits malignant biological behaviors of ovarian cancer by targeting BTG1
  90. PYCR1 is associated with papillary renal cell carcinoma progression
  91. Prediction of recurrence-associated death from localized prostate cancer with a charlson comorbidity index–reinforced machine learning model
  92. Colorectal cancer in the elderly patient: the role of neo-adjuvant therapy
  93. Association between MTHFR genetic polymorphism and Parkinson’s disease susceptibility: a meta-analysis
  94. Metformin can alleviate the symptom of patient with diabetic nephropathy through reducing the serum level of Hcy and IL-33
  95. Case Report
  96. Severe craniofacial trauma after multiple pistol shots
  97. Research Article
  98. Echocardiography evaluation of left ventricular diastolic function in elderly women with metabolic syndrome
  99. Tailored surgery in inguinal hernia repair. The role of subarachnoid anesthesia: a retrospective study
  100. The factors affecting early death in newly diagnosed APL patients
  101. Review Article
  102. Oncological outcomes and quality of life after rectal cancer surgery
  103. Research Article
  104. MiR-638 repressed vascular smooth muscle cell glycolysis by targeting LDHA
  105. microRNA-16 via Twist1 inhibits EMT induced by PM2.5 exposure in human hepatocellular carcinoma
  106. Analyzing the semantic space of the Hippocratic Oath
  107. Fournier’s gangrene and intravenous drug abuse: an unusual case report and review of the literature
  108. Evaluation of surgical site infection in mini-invasive urological surgery
  109. Dihydromyricetin attenuates inflammation through TLR4/NF-kappaB pathway
  110. Clinico-pathological features of colon cancer patients undergoing emergency surgery: a comparison between elderly and non-elderly patients
  111. Case Report
  112. Appendix bleeding with painless bloody diarrhea: A case report and literature review
  113. Research Article
  114. Protective effects of specneuzhenide on renal injury in rats with diabetic nephropathy
  115. PBF, a proto-oncogene in esophageal carcinoma
  116. Use of rituximab in NHL malt type pregnant in I° trimester for two times
  117. Cancer- and non-cancer related chronic pain: from the physiopathological basics to management
  118. Case report
  119. Non-surgical removal of dens invaginatus in maxillary lateral incisor using CBCT: Two-year follow-up case report
  120. Research Article
  121. Risk factors and drug resistance of the MDR Acinetobacter baumannii in pneumonia patients in ICU
  122. Accuracy of tumor perfusion assessment in Rat C6 gliomas model with USPIO
  123. Lemann Index for Assessment of Crohn’s Disease: Correlation with the Quality of Life, Endoscopic Disease activity, Magnetic Resonance Index of Activity and C- Reactive Protein
  124. Case report
  125. Münchausen syndrome as an unusual cause of pseudo-resistant hypertension: a case report
  126. Research Article
  127. Renal artery embolization before radical nephrectomy for complex renal tumour: which are the true advantages?
  128. Prognostic significance of CD276 in non-small cell lung cancer
  129. Potential drug-drug interactions in acute ischemic stroke patients at the Neurological Intensive Care Unit
  130. Effect of vitamin D3 on lung damage induced by cigarette smoke in mice
  131. CircRNA-UCK2 increased TET1 inhibits proliferation and invasion of prostate cancer cells via sponge miRNA-767-5p
  132. Case report
  133. Partial hydatidiform mole and coexistent live fetus: a case report and review of the literature
  134. Research Article
  135. Effect of NGR1 on the atopic dermatitis model and its mechanisms
  136. Clinical features of infertile men carrying a chromosome 9 translocation
  137. Review Article
  138. Expression and role of microRNA-663b in childhood acute lymphocytic leukemia and its mechanism
  139. Case Report
  140. Mature cystic teratoma of the pancreas: A rare cystic neoplasm
  141. Research Article
  142. Application of exercised-based pre-rehabilitation in perioperative period of patients with gastric cancer
  143. Case Report
  144. Predictive factors of intestinal necrosis in acute mesenteric ischemia
  145. Research Article
  146. Application of exercised-based pre-rehabilitation in perioperative period of patients with gastric cancer
  147. Effects of dexmedetomidine on the RhoA /ROCK/ Nox4 signaling pathway in renal fibrosis of diabetic rats
  148. MicroRNA-181a-5p regulates inflammatory response of macrophages in sepsis
  149. Intraventricular pressure in non-communicating hydrocephalus patients before endoscopic third ventriculostomy
  150. CyclinD1 is a new target gene of tumor suppressor miR-520e in breast cancer
  151. CHL1 and NrCAM are primarily expressed in low grade pediatric neuroblastoma
  152. Epidemiological characteristics of postoperative sepsis
  153. Association between unstable angina and CXCL17: a new potential biomarker
  154. Cardiac strains as a tool for optimization of cardiac resynchronization therapy in non-responders: a pilot study
  155. Case Report
  156. Resuscitation following a bupivacaine injection for a cervical paravertebral block
  157. Research Article
  158. CGF treatment of leg ulcers: A randomized controlled trial
  159. Surgical versus sequential hybrid treatment of carotid body tumors
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 9.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2019-0001/html
Scroll to top button