Home Medicine Hyperbaric oxygenation alleviates chronic constriction injury (CCI)-induced neuropathic pain and inhibits GABAergic neuron apoptosis in the spinal cord
Article Publicly Available

Hyperbaric oxygenation alleviates chronic constriction injury (CCI)-induced neuropathic pain and inhibits GABAergic neuron apoptosis in the spinal cord

  • Huiqun Fu , Fenghua Li , Sebastian Thomas and Zhongjin Yang EMAIL logo
Published/Copyright: October 1, 2017
Download Article (PDF)
Become an author with De Gruyter Brill
Author Information Explore this Subject
Scandinavian Journal of Pain
From the journal Scandinavian Journal of Pain Volume 17 Issue 1

Abstract

Background and aims

Dysfunction of GABAergic inhibitory controls contributes to the development of neuropathic pain. We examined our hypotheses that (1) chronic constriction injury (CCI)-induced neuropathic pain is associated with increased spinal GABAergic neuron apoptosis, and (2) hyperbaric oxygen therapy (HBO) alleviates CCI-induced neuropathic pain by inhibiting GABAergic neuron apoptosis.

Methods

Male rats were randomized into 3 groups: CCI, CCI+HBO and the control group (SHAM). Mechanical allodynia was tested daily following CCI procedure. HBO rats were treated at 2.4 atmospheres absolute (ATA) for 60 min once per day. The rats were euthanized and the spinal cord harvested on day 8 and 14 post-CCI. Detection of GABAergic cells and apoptosis was performed. The percentages of double positive stained cells (NeuN/GABA), cleaved caspase-3 or Cytochrome C in total GABAergic cells or in total NeuN positive cells were calculated.

Results

HBO significantly alleviated mechanical allodynia. CCI-induced neuropathic pain was associated with significantly increased spinal apoptotic GABA-positive neurons. HBO considerably decreased these spinal apoptotic cells. Cytochrome-C-positive neurons and cleaved caspase-3-positive neurons were also significantly higher in CCI rats. HBO significantly decreased these positive cells. Caspase-3 mRNA was also significantly higher in CCI rats. HBO reduced mRNA expression of caspase-3.

Conclusions

CCI-induced neuropathic pain was associated with increased apoptotic GABAergic neurons induced by activation of key proteins of mitochondrial apoptotic pathways in the dorsal horn of the spinal cord. HBO alleviated CCI-induced neuropathic pain and reduced GABAergic neuron apoptosis. The beneficial effect of HBO may be via its inhibitory role in CCI-induced GABAergic neuron apoptosis by suppressing mitochondrial apoptotic pathways in the spinal cord.

Implications

Increased apoptotic GABAergic neurons induced by activation of key proteins of mitochondrial apoptotic pathways in the dorsal horn of the spinal cord is critical in CCI-induced neuropathic pain. The inhibitory role of HBO in GABAergic neuron apoptosis suppresses ongoing neuropathic pain.

Keywords: HBO; CCI-induced neuropathic pain; GABAergic neurons; Spinal cord; Apoptosis

1 Introduction

Chronic pain is a significant national public health problem. It is the most frequent reason for individuals to seek medical care, and accounts for millions of medical visits annually. The prevalence of neuropathic pain in the general population ranges from 6.9 to 14% [1]. Neuropathic pain usually results from a lesioned or diseased central or peripheral nervous system [2]. Currently, no definite treatment is available due to the heterogeneity of neuropathic pain syndromes that link to various mechanisms [3, 4, 5]. Different animal models have been used for understanding peripheral and central pathogenic mechanisms of neuropathic pain. Among these models, the chronic constrictive injury (CCI)-induced neuropathic pain model introduced by Bennet and Xie induces hyperalgesia and allodynia, and is similar to that seen in clinic patients [6].

A delicate balance between functions of excitation and inhibition in the dorsal horn of the spinal cord is essential to maintain adequate pain sensation. It has been suggested that the spinal GABAergic hypofunction resulting from the loss of GABA neurons, a reduction in spinal GABA content and its synthesizing enzymes, and a decrease in activity and expression of the K+–Cl- cotransporter contribute to the development of neuropathic pain [7, 8, 9, 10]. A significant reduction in GABAergic neurons in the superficial dorsal horn of the spinal cord has been observed in CCI-induced and partial sciatic nerve ligation induced neuropathic pain [11,12]. Apoptotic cell death in the dorsal horn of the spinal cord is believed to cause the reduction of GABAergic neurons [13, 14, 15, 16]. Caspase-3-mediated cell apoptosis is involved in CCI-induced neuropathic pain [15]. In addition to activation of the TNF-a apoptosis-caspase signalling pathway in sensory neurons of dorsal root ganglion in the spinal nerve ligation (SNL) injury model [17], activation of mitochondrial apoptosis pathways is also involved in peripheral neuropathic pain [14,18, 19, 20]. Over-expression of NMDA receptors induce excessive Ca2+ influx and generates NO and O2 to form ONOO-, which results in an increase of mitochondrial membrane permeability. Cytochrome c (Cytc) is then released from the intermembrane space into the cytoplasm where the Cytc interacts with apoptotic protease-activating factor 1, triggering the caspase- independent cell death pathway [21,22]. Increased mitochondrial permeability plays an important role in activating apoptosis and inducing peripheral neuropathic pain [23]. However, the interaction between the loss of GABAergic neurons and the activated mitochondrial apoptosis pathway in CCI-induced neuropathic pain is unknown.

Hyperbaric oxygenation therapy (HBO), in which patients are exposed to 100% oxygen at above sea level atmospheric pressure in a cylindrical pressure chamber, has been used as a safe and effective treatment for a variety of clinical disorders. Recent research has suggested that HBO may have beneficial effects in the treatment of pain disorders, including delayed onset muscle soreness, fibromyalgia, inflammatory pain and neuropathic pain [24,25]. In this study, we examined our hypotheses that (1) excitotoxic apoptosis of GABA neurons in the dorsal horn of the spinal cord plays a key role in CCI-induced neuropathic pain, and (2) HBO may be beneficial in the treatment of neuropathic pain by reducing GABAergic neuron apoptosis through maintaining the integrity and function of the mitochondrial membrane.

2 Material and methods

All experiments were approved by the Institutional Committee for the Humane Use of Animals, and were conducted in accordance with the guidelines established by the National Institutes of Health. Male Sprague-Dawley rats (Taconic, Hudson, NY) weighing 200–250 g were selected for the study and housed 2–3 per cage in controlled laboratory conditions (23 ° C on a 12-h light/dark cycle with food and water ad libitum). One hundred and four rats were randomly divided into three groups: CCI (n = 8 at each point), CCI+HBO (n = 8 at each point) and the control group (SHAM) (n = 7 at each point).

2.1 Neuropathic pain model

Chronic constriction injury of the sciatic nerve was induced in the right hind limb in CCI and CCI + HBO rats. All surgeries were performed under general anaesthesia with the injection of ketamine and xylazine (150:30 mg/mL) at 0.7 mL/kg IM on the left buttock. In brief, the right common sciatic nerve of each rat was exposed at the mid-thigh level. Approximately 7 mm of nerve was freed and 4 ligatures (4.0 chromic gut) were loosely tied around the nerve with 1 mm of spacing between ligatures. The incision was then closed in layers with 3–0 monofilament nylon sutures. Animals in the SHAM group received surgery identical to that described but without nerve injury.

2.2 Behavioural test

Mechanical sensitivity was assessed using a von Frey filament in all rats for 3 consecutive days prior to any surgical procedures to establish baseline values. Mechanical allodynia was assessed daily post-surgery. According to pervious methods [26], rats were placed individually on a metal grid and covered with a Plexiglas box (10 cm × 12cm × 30 cm). The middle-calibre filament (2.0 g) was pushed onto the plantar surface of the right hind paw 5 times (3 s separated each push) until the filament bent. The Up-Down method was used for mechanosensitivity testing with a series of von Frey filaments with logarithmically incremental stiffness from 0.04 to 26.0 g. The result of the test was determined to be the lowest force that provoked paw withdrawal at least twice in five von Frey filament presentations per test [27].

Three researchers participated in the management of experimental activities. One researcher performed the surgical procedures, the second performed the behavioural tests while blinded to the experimental treatment groups, and the third collected and analyzed the data.

2.3 Hyperbaric oxygen treatment

HBO was conducted based on our previous studies [15,26]. Calcium carbonate crystals were put on the bottom of the cylindrical chamber (Sechrist Model 1300B; Sechrist Industries, Inc., Anaheim, CA) to absorb exhaled carbon dioxide. The chamber was ventilated with 100% oxygen for 10 min before HBO-group rats were placed inside the chamber. Then, the pressure was increased at a rate of 0.1 atmospheres absolute (ATA)/minute to the desired pressure (2.4 ATA) and maintained for 60 min. Oxygen content was maintained at 98% and CO2 at 0.03%. The HBO rats were treated once per day. The CCI and SHAM rats were placed into the chamber with room air without added pressure for 60 min once per day. The rats were euthanized and the spinal cord harvested on day 8 and 14 post-CCI procedure. The lumbar 4-5 region of the spinal cord was cryosec- tioned at 10 μm and immunohistochemical detection of GABAergic cells and apoptosis was performed.

2.4 Immunohistochemistry

The rats were transcardially perfused with 0.1 phosphate- buffered saline (PBS; pH 7.4; Sigma, St. Louis, MO, USA) followed by 10% neutral buffered formalin. The L4 and L5 lumbar segment was dissected out and post-fixed in 10% formalin (Sigma, St. Louis, MO, USA) overnight at 4 °C, then cryoprotected in 30% sucrose until sectioning. The lumbar 4-5 region of the spinal cord was embedded in optimum cutting temperature compound (Sakura Finetek, USA, Inc., Torrance, CA, USA) and snap frozen in liquid nitrogen. Coronal spinal cord sections were cut at a 10 μm thickness with freezing microtome (CM1850, Leica Microsciences, Mannheim, Germany) and processed for immunofluorescence. Sections were then per- meabilized with 0.3% Triton X-100 (Sigma, St. Louis, MO, USA) and blocked in 0.3% horse serum (Sigma, St. Louis, MO, USA). Sections were then incubated with primary antibodies overnight at 4 °C: rabbit anti-Cleaved caspase-3 IgG (1:200; Cell Signalling Technology, Danvers, MA, USA), mouse anti-GABA IgG (1:1000; St. Louis, MO, USA), rabbit Anti-Cytochrome C IgG (1:100; Cambridge, MA, USA), mouse Anti-NeuN IgG (1:500; Millipore, Billerica, MA, USA), and rabbit anti-NeuN (1:500; Millipore, Billerica, MA, USA). After washing, sections were incubated with Alexa Fluor 594 donkey anti-Rabbit IgG (1:500; Invitrogen, Paisley, UK), Alexa Fluor 594 donkey anti-Mouse IgG (1:500; Invitrogen, Paisley, UK), Alexa Fluor 488 donkey anti-Mouse IgG (1:500; Invitrogen, Paisley, UK), and Alexa Fluor 488 donkey anti-rabbit IgG (1:500; Paisley, UK) for two hours in the dark at room temperature. Negative control sections underwent the same procedures without the presence of primary and secondary antibodies. Cyteblasts were counterstained with Hoechst 33342 (1:1000; Sigma, St. Louis, MO, USA). Samples were analyzed with confocal microscopy (Zeiss LSM780, Leica, Benshein, Germany) and an image analyzing system (Optimas 6.5, CyberMetrics, Scottsdale, AZ, USA) by an investigator blinded to the experimental groups. Cell counts were performed within 1 mm diameter in the dorsal horn of the right spinal cord region; 3 sections were evaluated for each animal.

The stereological method was used to scan all samples and count neuronal cell deaths. The stereological method was also used to scan the figures presented in this manuscript.

2.5 Real-time quantitative reverse transcriptase polymerase chain reaction (RT-PCR)

For RT-PCR studies, the rats were perfused transcardially with 240 ml PBS at 4 °C. The spinal cords at the L4-5 level were harvested rapidly, cut into left and right parts and immediately frozen in liquid nitrogen. Total RNA was extracted using Trizol (Invitro- gen, Paisley, UK) and purified using the RNeasy Mini Kit (Qiagen, Palo Alto, CA, USA). Total RNA concentration and the quantity of RNA was assessed using a Thermo Scientific NanoDrop ND 2000 Spectrophotometer. The integrity of total RNA was measured by agaros gel electrophoresis, and cDNA was synthesized using the High Capacity RNA-to-cDNA Kit according to the manufacturer’s protocol (Catalogue number 4387406, Applied Biosystems). Primer sequences and amplification profiles used for caspase-3 and GAD67 (KiCqStart® SYBR® Green Primers, Sigma, St. Louis, MO, USA) are shown in Table 1. DNA amplification was carried out according to the manufacturer’s protocol (LightCycler® 480 SYBR Green I Master, Roche Life Science, Indianapolis, IN, USA). The mixture was amplified for 40 cycles using qPCR instrumentation (Bio-Rad CFX480 touch, Bio-Rad Laboratories, Inc. Life Science Research, Hercules, CA, USA). Each cycle consisted of pre-incubation for 5 min at 95 °C, 15s amplification at 95 °C, 15 s at 61 °C, 15 s at 72 °C, a melting curve for 5 s at 95 °C and 1 min at 65 °C, and cooling for 10 s at 40 °C. Amplification products were separated on 1.8% agarose gel. The intensity of each band was quantified using NIH Image software (version 1.60) and expressed in arbitrary units.

Table 1

Sequences of Primers for RT-PCR.

Forward Primers (5′ → 3′) Reverse Primers (5′ → 3′)
Caspas3 TCGATAAAAGCACTGGAATG ACTGTGATCTTGGTTAGAAACAC
GAD1 CTACTGGTTTGGATATCATTGG GGAGAAAATATCCCATCACC
β-actin AAGACCTCTATGCCAACAC TGATCTTCATGGTGCTAGG

2.6 Statistical analysis

Numerical data are presented as the mean and standard deviation. Data analyses were performed using SPSS software (Ver. 11.5, IBM, Chicago, IL, USA). Statistical significance was determined using a two-way repeated-measures ANOVA and a two-way ANOVA, followed by Bonferroni post hoc analysis wherever appropriate. A value of p < 0.05 was considered statistically significant. Pearson’s correlation coefficient was used for correlation analyses.

3 Results

3.1 HBO alleviates CCI-induced mechanical allodynia

The results of behavioural testing in the present study were in agreement with our previous reports [15,26]. The CCI rats showed ventroflexion of the right toe, walking with the medial edge of the right hind paw, shaking and licking of the right hind paw, and frequent holding of the affected hind paw off the floor, which are behaviours suggestive of spontaneous pain. The results of the behavioural test for mechanical allodynia of the hind paw are presented in Fig. 1. Following CCI, mechanical allodynia developed in the ipsilateral paw of CCI rats compared to SHAM rats (1.42 ±1.24 vs. 4.00 ±1.5 on day 8; 0.65 ±0.36 vs. 3.75 ±1.38 on day 14; p < 0.05). HBO significantly improved mechanical allodynia (2.8 ±1.3 vs. 1.42 ±1.24 on day 8; and 2.15 ±1.2 vs. 0.65 ± 0.36 on day 14, p<0.05).

Fig. 1 Effect of HBO on mechanical allodynia 8 and 14 days post-surgery, and the baseline of mechanical allodynia. Following CCI, mechanical allodynia had developed in the ipsilateral paw compared to the SHAM rats (1.42 ±1.24 vs. 4.00 ± 1.5 at day 8; 0.65 ±0.36 vs. 3.75 ± 1.38 at day 14; p <0.05). HBO significantly improved mechanical allodynia (2.8 ± 1.3 vs. 1.424 ±1.24 on day 8; 2.15 ± 1.2 vs. 0.65 ±0.36, on day 14; p<0.05). The data are presented as mean ±SEM. HBO: Hyperbaric oxygenation treatment (n = 16); CCI: Chronic constriction injury induced neuropathic pain (n = 16); CCI+HBO: CCI rats treated with HBO; SHAM: Control group (n = 12). D0: Day zero, D8: Day 8, D14: Day 14. *p<0.05. **p<0.01, ***p<0.001.
Fig. 1

Effect of HBO on mechanical allodynia 8 and 14 days post-surgery, and the baseline of mechanical allodynia. Following CCI, mechanical allodynia had developed in the ipsilateral paw compared to the SHAM rats (1.42 ±1.24 vs. 4.00 ± 1.5 at day 8; 0.65 ±0.36 vs. 3.75 ± 1.38 at day 14; p <0.05). HBO significantly improved mechanical allodynia (2.8 ± 1.3 vs. 1.424 ±1.24 on day 8; 2.15 ± 1.2 vs. 0.65 ±0.36, on day 14; p<0.05). The data are presented as mean ±SEM. HBO: Hyperbaric oxygenation treatment (n = 16); CCI: Chronic constriction injury induced neuropathic pain (n = 16); CCI+HBO: CCI rats treated with HBO; SHAM: Control group (n = 12). D0: Day zero, D8: Day 8, D14: Day 14. *p<0.05. **p<0.01, ***p<0.001.

3.2 HBO reduces CCI-induced increase in apoptotic cells and apoptotic GABAgeric neurons in the spinal cord

The development of CCI-induced neuropathic pain was associated with significantly increased apoptotic-positive neurons in the spinal cord compared to the SHAM group (42 ± 9% vs. 13 ± 5%, p<0.001 on day 8; and 39±14% vs. 14±7%, p<0.001 on day 14). The ratio of apoptotic GABA-positive neurons in CCI rats was significantly higher compared to the SHAM rats (48.0 ± 10.0% vs. 17.0 ±8.0%, p<0.001 on day 8; and 48.0 ±11.0 vs. 12.0 ±11.0, p <0.001 on day 14). HBO significantly reduced the occurrence of apoptotic cells (26.0 ±5.0 vs. 42.0 ±9.0%, p<0.001 on day 8; and 25.0 ± 9.0 vs. 39.0 ±14.0, p < 0.001 on day 14). Percentages of apoptotic GABA-positive neurons in CCI+HBO rats was significantly lower compared to CCI rats (22.0 ± 9.0% vs. 48.0 ± 10.0% on day 8; and 20.0 ±11.0% vs. 48.0 ±11.0% on day 14, p < 0.001) (Fig. 2).

Fig. 2 Effect of HBO on apoptotic neurons and apoptotic GABAergic neurons on day 8 and day 14 post-surgery. The ratio of apoptotic neurons in CCI rats was significantly higher compared to SHAM rats (42 ±9%vs. 13 ±5%, p <0.001 on day 8;39 ± 14%vs. 14 ±7%, p <0.001 on day 14). HBO significantly lowered apoptotic cells in CCI (26.0 ±5.0 vs. 42.0 ±9.0%, p <0.001 on day 8; 25.0 ±9.0 vs. 39.0 ±14.0, p <0.001 on day 14). Percentages of apoptotic GABA-positive neurons in CCI rats was significantly higher compared to SHAM rats (48.0 ±10.0% vs. 17.0 ±8.0%, p <0.001 on day 8; 48.0 ±11.0 vs. 12.0 ±11.0, p <0.001 on day 14, p <0.001). HBO significantly lowered apoptotic cells in CCI (22.0±9.0%vs. 48.0± 10.0%, onday 8; 20.0±11.0% vs. 48.0±11.0% onday 14,p<0.001). GABA: GABA (red) positive cells; NeuN: NeuN (green) positive neurons; and Merge: GABA (red) expressed inneuron (NeuN green). HBO: Hyperbaric oxygenation treatment (n = 16); CCI: Chronic constriction injury induced neuropathic pain (n = 16); CCI+HBO: CCI rats treated with HBO; SHAM: Control group (n = 12).D8: Day 8, D14: Day 14. *p <0.05, **p <0.01, ***p <0.001. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Fig. 2

Effect of HBO on apoptotic neurons and apoptotic GABAergic neurons on day 8 and day 14 post-surgery. The ratio of apoptotic neurons in CCI rats was significantly higher compared to SHAM rats (42 ±9%vs. 13 ±5%, p <0.001 on day 8;39 ± 14%vs. 14 ±7%, p <0.001 on day 14). HBO significantly lowered apoptotic cells in CCI (26.0 ±5.0 vs. 42.0 ±9.0%, p <0.001 on day 8; 25.0 ±9.0 vs. 39.0 ±14.0, p <0.001 on day 14). Percentages of apoptotic GABA-positive neurons in CCI rats was significantly higher compared to SHAM rats (48.0 ±10.0% vs. 17.0 ±8.0%, p <0.001 on day 8; 48.0 ±11.0 vs. 12.0 ±11.0, p <0.001 on day 14, p <0.001). HBO significantly lowered apoptotic cells in CCI (22.0±9.0%vs. 48.0± 10.0%, onday 8; 20.0±11.0% vs. 48.0±11.0% onday 14,p<0.001). GABA: GABA (red) positive cells; NeuN: NeuN (green) positive neurons; and Merge: GABA (red) expressed inneuron (NeuN green). HBO: Hyperbaric oxygenation treatment (n = 16); CCI: Chronic constriction injury induced neuropathic pain (n = 16); CCI+HBO: CCI rats treated with HBO; SHAM: Control group (n = 12).D8: Day 8, D14: Day 14. *p <0.05, **p <0.01, ***p <0.001. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

3.3 HBO decreased CCI-induced cleaved caspase-3-positive neurons in the dorsal horn of the spinal cord

The ratio of cleaved caspase-3-positive neurons was significantly higher in CCI rats than in SHAM rats (20.0 ± 5.0 vs. 4.0 ± 2.0 on day 8; and 18.0 ±3.0 vs. 4.0 ±2.0 on day 14, p <0.001). HBO significantly decreased the cleaved caspase-3-positive neurons in CCI rats (10.0 ± 4.0 vs. 20.0 ± 4.0 on day 8, and 18.0 ± 3.0 vs. 8.0 ± 3.0 on day 14, p<0.001) (Fig. 3).

Fig. 3 Activated caspase-3 in neurons of spinal dorsal horn after CCI. The ratio of cleaved caspase-3-positive neurons was significantly higher in CCI rats than in SHAM rats (20.0 ± 5.0 vs. 4.0 ± 2.0 on day 8; 18.0 ± 3.0 vs. 4.0 ± 2.0 on day 14, p <0.001). HBO significantly decreased cleaved caspase-3-positive neurons in CCI (10.0 ±4.0 vs. 20.0 ± 4.0 on day 8; 18.0 ± 3.0 vs. 8.0 ± 3.0 on day 14, p <0.001). After CCI, the related expression of caspase-3 mRNA was higher in CCI rats and CCI+HBO rats compared to SHAM rats (2.24±3.0 vs. 1.0±0.0, 1.35±0.29 on day 14, p<0.05). Co-located staining of caspase-3 (red) and NeuN (green) demonstrated cleaved caspase-3 in neurons of the spinal dorsal horn. HBO: Hyperbaric oxygenation treatment (n = 16); CCI: Chronic constriction injury induced neuropathic pain (n = 16); CCI+HBO: CCI rats treated with HBO; SHAM: Control group (n = 12). D8: Day 8, D14: Day 14. *p <0.05, ***p <0.001. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Fig. 3

Activated caspase-3 in neurons of spinal dorsal horn after CCI. The ratio of cleaved caspase-3-positive neurons was significantly higher in CCI rats than in SHAM rats (20.0 ± 5.0 vs. 4.0 ± 2.0 on day 8; 18.0 ± 3.0 vs. 4.0 ± 2.0 on day 14, p <0.001). HBO significantly decreased cleaved caspase-3-positive neurons in CCI (10.0 ±4.0 vs. 20.0 ± 4.0 on day 8; 18.0 ± 3.0 vs. 8.0 ± 3.0 on day 14, p <0.001). After CCI, the related expression of caspase-3 mRNA was higher in CCI rats and CCI+HBO rats compared to SHAM rats (2.24±3.0 vs. 1.0±0.0, 1.35±0.29 on day 14, p<0.05). Co-located staining of caspase-3 (red) and NeuN (green) demonstrated cleaved caspase-3 in neurons of the spinal dorsal horn. HBO: Hyperbaric oxygenation treatment (n = 16); CCI: Chronic constriction injury induced neuropathic pain (n = 16); CCI+HBO: CCI rats treated with HBO; SHAM: Control group (n = 12). D8: Day 8, D14: Day 14. *p <0.05, ***p <0.001. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Expression of caspase-3 mRNA was significantly elevated in the dorsal horn of the spinal cord in CCI rats compared to SHAM rats. Notably, mRNA expression of caspase-3 was higher in CCI rats compare to SHAM rats (2.24 ± 0.29 vs. 1.0 ± 0.0 on day 14, p < 0.05). HBO reduced mRNA expression of caspase-3 in the spinal cord (1.75 ±1.25 on day 14 (Fig. 3)).

3.4 HBO inhibits neuronal mitochondrial release of Cytc in the dorsal horn of the spinal cord

The ratio of Cytc-positive neurons was significantly higher in CCI rats than in SHAM rats (43.0 ± 7.0 vs. 7.0 ±3.0, p < 0.001 on day 8, and 40.0 ± 7.0 vs. 8.0 ± 6.0, p < 0.001 on day 14). HBO significantly decreased CCI-induced Cytc-positive cells (16.0 ± 6.0 vs. 43.0 ± 7.0, p < 0.05 on day 8, and 16.0 ± 4.0 vs. 40.0 ± 7.0, p < 0.001 on day 14) (Fig. 4).

Fig. 4 Mitochondrial release of cytochrome C (Cytc) in neurons ofthe spinal dorsal horn. The ratio of Cytc-positive neurons was significantly higher in CCI rats than in SHAM rats(43.0 ±7.0vs. 7.0 ±3.0onday 8; 40.0 ±7.0 vs. 8.0 ±6.0 on day 14, p <0.001). HBO significantly decreased CCI-induced Cytc-positive cells (16.0 ±6.0vs.43.0 ±7.0, p <0.05 on day 8; 16.0 ±4.0 vs. 40.0 ±7.0, p <0.001 on day 14). Cytc: Cytc was stained red; NeuN: NeuN was stained green. Merge: Cytc expression in neurons (NeuN stained green) ofthe spinal cord. HBO: Hyperbaric oxygenation treatment (n = 16); CCI: Chronic constriction injury induced neuropathic pain (n = 16); CCI+HBO: CCI rats treated with HBO; SHAM: Control group (n = 12).D8: Day 8, D14: Day 14. **p <0.01, ***p <0.001. (For interpretation of the references to colorinthis figure legend, the readeris referredtothe web version of this article.)
Fig. 4

Mitochondrial release of cytochrome C (Cytc) in neurons ofthe spinal dorsal horn. The ratio of Cytc-positive neurons was significantly higher in CCI rats than in SHAM rats(43.0 ±7.0vs. 7.0 ±3.0onday 8; 40.0 ±7.0 vs. 8.0 ±6.0 on day 14, p <0.001). HBO significantly decreased CCI-induced Cytc-positive cells (16.0 ±6.0vs.43.0 ±7.0, p <0.05 on day 8; 16.0 ±4.0 vs. 40.0 ±7.0, p <0.001 on day 14). Cytc: Cytc was stained red; NeuN: NeuN was stained green. Merge: Cytc expression in neurons (NeuN stained green) ofthe spinal cord. HBO: Hyperbaric oxygenation treatment (n = 16); CCI: Chronic constriction injury induced neuropathic pain (n = 16); CCI+HBO: CCI rats treated with HBO; SHAM: Control group (n = 12).D8: Day 8, D14: Day 14. **p <0.01, ***p <0.001. (For interpretation of the references to colorinthis figure legend, the readeris referredtothe web version of this article.)

The expression of GAD67 mRNA in spinal cord was lower in CCI rats than in SHAM rats (0.57 ±0.39 vs. 0.78 ±0.1 on day 14), although this did not reach statistical significance. GAD67 mRNA did not change on day 8 after CCI (Fig. 5).

Fig. 5 mRNA expression of GAD67 in spinal dorsal horn after CCI. mRNA expression of GAD1 was lower in CCI rats than in SHAM rats (0.57 ± 0.39 vs. 0.78 ± 0.1 on day 14). GAD67 mRNA did not change on day 8 after CCI. HBO: Hyperbaric oxygenation treatment (n = 16); CCI: Chronic constriction injury induced neuropathic pain (n = 16); CCI+HBO: CCI rats treated with HBO; SHAM: Control group (n = 12). D8: Day 8, D14: Day 14. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Fig. 5

mRNA expression of GAD67 in spinal dorsal horn after CCI. mRNA expression of GAD1 was lower in CCI rats than in SHAM rats (0.57 ± 0.39 vs. 0.78 ± 0.1 on day 14). GAD67 mRNA did not change on day 8 after CCI. HBO: Hyperbaric oxygenation treatment (n = 16); CCI: Chronic constriction injury induced neuropathic pain (n = 16); CCI+HBO: CCI rats treated with HBO; SHAM: Control group (n = 12). D8: Day 8, D14: Day 14. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

4 Discussion

The main findings of the present study are that (1) CCI-induced neuropathic pain was associated with increased apoptotic GABAergic neurons and decreased expression of GAD67 mRNA in the dorsal horn of the spinal cord; (2) the increase in apoptotic GABAergic neurons was associated with the increased apoptosis- associated mitochondrial outer membrane permeabilization; (3) HBO alleviated CCI-induced neuropathic pain and reduced apop- totic GABAergic neurons in the dorsal horn of the spinal cord; and (4) the beneficial effect of HBO in CCI-induced neuropathic pain may be due to its inhibitory role in CCI-induced GABAergic neuron apoptosis in the spinal cord.

A delicate balance between excitation and inhibition in the dorsal horn of the spinal cord is essential for maintaining adequate pain sensation. In the superficial dorsal horn in the termination area of nociceptors, the majority of inhibitory neurons are purely GABAergic neurons [28]. It has been proposed that a profound dysfunction of these GABAergic neurons may be responsible for the development of nerve-injury-induced neuropathic pain [10,29,30].

Reduction of GABAergic transmission may be caused by the loss of GABAergic neurons in the superficial dorsal horn and/or the decrease of glutamic acid decarboxylase (GAD) in the dorsal horn [7,9]. GAD is an enzyme that catalyzes the decarboxylation of glutamate to GABA. A reduction in GAD enzyme decreases GABA neurotransmitter products. Moore et al. found that partial nerve injury not only reduced presynaptic GABA release, but also decreased dorsal horn levels of the GABA-synthesizing enzyme GAD65 ipsilateral to the injury and induces neuronal apoptosis in identified neurons. Both of these mechanisms could reduce pre- synaptic GABA levels and promote a functional loss of GABAergic transmission in the superficial dorsal horn. Neuronal apoptosis has been attributed to the loss of GABAergic transmission [13].

We previously reported that CCI-induced neuropathic pain was associated with significantly increased neuronal apoptosis in the lumbar 4-5 spinal cord, and that these apoptotic cells were mainly distributed in the territory of the ipsilateral dorsal horn of the spinal cord. The present study provides new evidence that these apoptotic neurons are mainly GABAergic neurons. The present study suggests that reduced GABAergic neuron inhibitory function may play an essential role in CCI-induced neuropathic pain.

Studies of Polgar et al. suggested that the reduction in GABA levels and the loss of GABAergic neurons were not detected in the spinal dorsal horn of CCI and SNL animals in the development of thermal hyperalgesia [31,32]. The reasons for the discrepancy remain unclear. As discussed by the authors, the explanation may lie in the use of inconsistent and/or different methods for immuno- labeling GABAergic neurons and analyzing GABA levels. Further studies have shown that the number of enhanced green fluorescent protein (EGFP)+ GAD67 neurons and the density of axon terminals with GAD65 in the dorsal horn of spinal cord were found to be significantly decreased in SNL model mice and CCI model rats [33,34]. Furthermore, increasing the GABAergic neurons via the spinal cord transplantation of embryonic stem-cell-derived spinal GABAergic progenitor cells was proven successful in treating neuropathic pain [35, 36, 37]. These progenitor cells were activated by primary afferent and form GABAergic neurons integrating into host circuitry and recapitulating endogenous inhibitory circuits, which prevented the development of nerve-injury-induced mechanical hypersensitivity [36, 37, 38]. Our results support the conception that CCI-induced neuropathic pain was associated with increased apoptotic neurons, mainly GABAergic neurons, in the superficial dorsal horn of spinal cord as detected on days 8 and 14 post-surgery.

Apoptosis is initiated by a subfamily of cysteine proteases known as caspases. One of the pathways of cell apoptosis is activated by the release of Cytc from the mitochondria into cytosol. In this pathway, a variety of apoptotic stimuli cause the release of Cytc from mitochondria; this in turn induces a series of biochemical reactions that result in caspase activation and subsequent cell death. The release of Cytc and activation of caspase-3 have been observed in CCI-induced neuropathic pain [39]. In nerve-injury-induced neuropathic pain, the synthesis of GAD67 and GAD65 proteins and mRNA was observed being down-regulated, which causes the hypofunction of GABAergic transmission [9,30,34,40,41,42]. Increasing the GAD67 level in GABAergic neurons by gene transfer technique alleviates neuropathic pain [41,43]. Therefore, the data showed that nerve injury not only significantly decreased GAD65/67 levels but also induced marked reductions in GABA levels in the superficial dorsal horn. Our result is similar to the results from Vaysse et al. [44] and Wang et al. [42] in that the reduction of GAD67 mRNA, but not GAD65 mRNA, was observed in the dorsal horn of the spinal cord in CCI group rats 14 days post-surgery. Nerve-injury-induced neuropathic pain is associated with mitochondrial dysfunctions that lead to the activation of the apoptotic cascade.

Lorenzo et al. showed that the density of GAD65 inhibitory terminals was reduced in lamina I and lamina II of the spinal cord after injury. The loss of GAD65 terminals was greatest in lamina II with the highest drop occurring at around 3-4 weeks post-injury, which correlated with the altered thresholds to mechanical and thermal stimuli [34]. The results from our study validate their findings that lower levels of GAD67 mRNA in the spinal cord occurs as detected on day 14 after surgery, which correlated well with CCI-induced behavioural changes.

Studies show that blocking the pathway of neuronal apopto- sis prevents the loss of GABAergic neurons and the reduction of inhibitory currents, along with attenuation of pain hypersensitivity induced by peripheral nerve lesions. However, the mechanism of apoptosis of GABA neurons in the dorsal horn of the spinal cord during the development of neuropathic pain remains unclear. Exci- totoxic apoptosis is a common pathway in neuronal apoptosis with excitatory amino acids as a final common pathway for neurologic disorders, including severe neuropathic pain, Alzheimer’s disease, dementia, depression, and glaucoma [45].

In preclinical studies, the administration of NMDA receptor antagonists and GABA-A agonists can reverse allodynia and hyperalgesia [46,47]. Over-activation of glutamate receptor activates the intrinsic pathway that is the mitochondrial pathway of apoptosis [48]. In the intrinsic pathway, mitochondrial outer membrane permeabilization occurs. Cytc is released from mitochondria and binds to apoptotic protease-activating factor 1, leading to the formation of a caspase activation platform termed the apoptosome. The apoptosome activates an initiator caspase, caspase-9, which in turn cleaves and activates caspase-3 and caspase-7.

Apoptotic signalling is involved in neuropathic pain. Our previous studies showed that CCI-induced neuronal apoptosis might be associated with TNF-a-mediated activation of the caspase- 3 protein and the increase of caspase-3 mRNA in the spinal dorsal horn. The present study suggests that CCI induced the increase in caspase-3 mRNA and activated the caspase-3 protein and the release of Cytc in spinal dorsal horn as detected on day 8 and 14 after surgery, which was in line with the results of behaviour tests and the increase of apoptotic GABAergic neurons. These data indicate that the mitochondrial pathway of apoptosis might be associated with CCI-induced apoptotic GABAergic neurons.

HBO refers to 100% oxygen provided at 2-3 times the atmospheric pressure at sea level [49]. HBO has been proposed to be a reliable option for neuroprotection [50]. HBO has been observed to prevent apoptosis after focal cerebral ischaemia by opening the mitochondrial ATP-sensitive potassium channel [51]. In addition, HBO therapy has been observed to reduce Cytc and decrease caspase-9 and caspase-3 in the hippocampus and ischaemic penumbra in MCAO models. Therefore, HBO protects brain tissues from ischaemia-reperfusion injury by suppressing mitochondrial apoptotic pathways [52]. The effect of HBO on the function of GABAergic neurons in nerve-injury-induced neuropathic pain has not been reported. In our previous study, HBO alleviated CCI-induced neuropathic pain via its inhibiting role in CCI-induced neuronal apoptosis in the spinal cord. HBO’s inhibition of CCI-induced neuronal apoptosis might be due to the inhibition of endoneuronal TNF-a production [26].

The present study indicated that the beneficial effect of HBO in CCI-induced neuropathic pain may be due to its inhibitory role in CCI-induced GABAergic neuron apoptosis through the inhibition of mitochondrial apoptotic pathways in the spinal cord. In CCI-rats, increased release of Cytc and caspase-3 active fragments expressed in the sciatic nerve has been described. Treatment of animals with acetyl-l-carnitine prevents apopto- sis induction and reduces cytosolic Cytc in a significant manner [53].

In diabetic neuropathic pain, the activation of caspase-3 and release of Cytc was significantly increased in the spinal cord of diabetic animals. Thymus caramanicus Jalas attenuates neural apo- ptosis and ameliorates diabetic neuropathy [54].

The hypothesis has been put forward that apoptotic inhibition via the mitochondrial pathway is involved in hyperbaric-oxygen- induced neuroprotection on ischaemia-reperfusion injury in rat brain. In traumatic brain injury, treatment with HBO was observed to alleviate neuronal apoptosis by reducing the release of Cytc and the dimers of Bax, and up-regulating the expression of Bcl-2 [55].

In a MCAO rat study, pre-treatment with HBO was also found to reduce cytoplasm Cytc levels, decrease caspase enzyme activity, upregulate the ratio of Bcl-2 and Bax expression, and abate the apoptosis of ischaemic tissue. The neuroprotection effect of HBO may be through suppression of the mitochondrial apoptotic pathways [52]. The present study provides further evidence that CCI-induced neuropathic pain is associated with the increased release of Cytc in the spinal cord. Alleviation of neuropathic pain by HBO may be associated with a decreased Cytc release from the spinal cord.

5 Summary

The present study shows that CCI-induced neuropathic pain was associated with an increase in apoptotic GABAergic neurons induced by the activation of key proteins of mitochondrial apop- totic pathways in the dorsal horn of the spinal cord. HBO alleviated CCI-induced neuropathic pain and reduced GABAergic neuron apo- ptosis in the dorsal horn of the spinal cord. The beneficial effect of HBO in CCI-induced neuropathic pain may be due to its inhibitory role in CCI-induced GABAergic neuron apoptosis via suppressing the mitochondrial apoptotic pathways in the spinal cord.

  1. Authors’ contributions: ZY designed the experimental protocol. FQconducted the experiments, performed chemical assays, collected and analyzed the data and performed statistical analysis. All authors participated in the experimental processes, data interpretation and manuscript preparation. All authors read and approved the final version of the manuscript.

  2. Funding: This study was supported by the Research Fund of the Department of Anesthesiology, Upstate Medical University, Syracuse, NY, USA.

  3. Ethical issues: All experiments were approved by the Institutional Committee for the Humane Use of Animals, Upstate Medical University. Registration as IACUC#234. All experiments were conducted in accordance with the guidelines established by the National Institutes of Health.

  4. Conflict of interest: None declared.

Acknowledgements

This study is supported by the Research fund from the department of Anesthesiology, Upstate Medical University. We thank Corey Austin and Kim Hare for their English assistance in preparation of this manuscript, and Jon Kilner, MS, MA (Pittsburgh, PA) for his editorial assistance.

References

[1] van Hecke O, Austin SK, Khan RA, Smith BH, Torrance N. Neuropathic pain in the general population: a systematic review of epidemiological studies. Pain 2014;155:654–62, http://dx.doi.org/10.1016/j.pain.2013.11.013.Search in Google Scholar

[2] O’Connor AB. Neuropathic pain. Quality of life impact, costs and cost effectiveness of therapy.Pharmacoeconomics 2009;27:95–112, http://dx.doi.org/10.2165/00019053-200927020-00002.Search in Google Scholar

[3] Attal N, Bouhassira D, Baron R, Dostrovsky J, Dworkin RH, Finnerup N, Gourlay G, Haanpaa M, Raja S, Rice AS, Simpson D, Treede RD. Assessing symptom profiles in neuropathic pain clinical trials: can it improve outcome? Eur J Pain 2011;15:441–3, http://dx.doi.org/10.1016/j.ejpain2011.03.005.Search in Google Scholar

[4] Baron R, Forster M, Binder A. Subgrouping of patients with neuropathic pain according to pain-related sensory abnormalities: a first step to a stratified treatment approach. Lancet Neurol 2012;11:999–1005, http://dx.doi.org/10.1016/S1474-4422(12)70189-8.Search in Google Scholar

[5] Bouhassira D, Attal N. Translational neuropathic pain research: a clinical perspective. Neuroscience 2016;338:27–35, http://dx.doi.org/10.1016Zj.neurosdence.2016.03.029.Search in Google Scholar

[6] Bennett GJ, Xie YK. Aperipheral mononeuropathy in rat that produces disorders of pain sensation like those seen in man Pain 1988;33:87–107.Search in Google Scholar

[7] Meisner JG, Marsh AD, Marsh DR. Loss of GABAergic interneurons in laminae I-III of the spinal cord dorsal horn contributes to reduced GABAergic tone and neuropathic pain after spinal cord injury. J Neurotrauma 2010;27:729–37, http://dx.doi.org/10.1089/neu.2009.1166.Search in Google Scholar

[8] Ford A, Castonguay A, Cottet M, Little JW, Chen Z, Symons-Liguori AM, Doyle T, Egan TM, Vanderah TW, De Konnick Y, Tosh DK, Jacobson KA, Salvemini D. Engagement of the GABA to KCC2 signaling pathway contributes to the analgesic effects of A3AR agonists in neuropathic pain. J Neurosci 2015;35:6057–67, http://dx.doi.org/10.1523/JNEUROSCI.4495-14.2015.Search in Google Scholar

[9] Kami K, Taguchi Ms S, Tajima F, Senba E. Improvements in impaired GABA and GAD65/67 production in the spinal dorsal horn contribute to exercise-induced hypoalgesia in a mouse model of neuropathic pain. Mol Pain 2016;12:1–14, http://dx.doi.org/10.1177/1744806916629059.Search in Google Scholar

[10] Medrano MC, Dhanasobhon D, Yalcin I, Schlichter R, Cordero-Erausquin M. Loss of inhibitory tone on spinal cord dorsal horn spontaneously and nonspontaneously active neurons in a mouse model of neuropathic pain. Pain 2016;157:1432–42, http://dx.doi.org/10.1097/j.pain.0000000000000538.Search in Google Scholar

[11] Eaton MJ, Plunkett JA, Karmally S, Martinez MA, Montanez K. Changes in GAD- and GABA-immunoreactivity in the spinal dorsal horn after peripheral nerve injury and promotion of recovery by lumbar transplant of immortalized serotonergic pre-cursors. J Chem Neuroanat 1998;16:57–72.Search in Google Scholar

[12] Ibuki T, Hama AT, Wang XT, Pappas GD, Sagen J. Loss of GABA-immunoreactivity in the spinal dorsal horn of rats with peripheral nerve injury and promotion of recovery by adrenal medullary grafts. Neuroscience 1997;76: 845–58.Search in Google Scholar

[13] Moore KA, Kohno T, Karchewski LA, Scholz J, Baba H, Woolf CJ. Partial peripheral nerve injuty promotesaselective lossofGABAergic inhibition inthesuperficial dorsal horn of the spinal cord. J Neurosci 2002;22:6724–31.Search in Google Scholar

[14] Sekiguchi M, Sekiguchi Y, Konno S, Kobayashi H, Homma Y, Kiku-chi S. Comparison of neuropathic pain and neuronal apoptosis following nerve root or spinal nerve compression. Eur Spine J 2009;18:1978–85, http://dx.doi.org/10.1007/s00586-009-1064-z.Search in Google Scholar

[15] Hu Q Fang L, Li F, Thomas S, Yang Z. Hyperbaric oxygenation treatment alleviates CCI-induced neuropathic pain and decreases spinal apoptosis. Eur J Pain 2015;19:920–8, http://dx.doi.org/10.1002/ejp.618.Search in Google Scholar

[16] Zhao BS, Song XR, Hu PY, Meng LX, Tan YH, She YJ, Ding YY. Hyperbaric oxygen treatment at various stages following chronic constriction injury produces different antinociceptive effects via regulation of P2X4R expression and apoptosis. PLOS ONE 2015;10:e0120122, http://dx.doi.org/10.1371/journal.pone.0120122.eCollection_2015.Search in Google Scholar

[17] Joseph EK, Levine JD. Caspase signaling in neuropathic and inflammatory pain in the rat. Eur J Neurosci 2004;20:2896–902.Search in Google Scholar

[18] Xiao WH, Bennett GJ. Effects of mitochondrial poisons on the neuropathic pain produced by the chemotherapeutic agents, paclitaxel and oxaliplatin. Pain 2012;153:704–9, http://dx.doi.org/10.1016/j.pain.2011.12.011.Search in Google Scholar

[19] Amin B, Abnous K, Motamedshariaty V, Hosseinzadeh H. Attenuation of oxidative stress, inflammation and apoptosis by ethanolic and aqueous extracts of Crocus sativus L. stigma after chronic constriction injury of rats. An Acad Bras Cienc 2014;86:1821–32, http://dx.doi.org/10.1590/0001-3765201420140067.Search in Google Scholar

[20] Janzade A, Jameie SB, Choobchian S, Nasirinezhad F. Neuroprotective effect of coenzyme Q10 in chronic constriction injury-induced neuropathic pain in rats. Thrita 2014;3:e16607, http://dx.doi.org/10.5812/thrita.Search in Google Scholar

[21] Cai J, Yang J, Jones DP. Mitochondrial control of apoptosis: the role of cytochrome C. Biochim Biophys Acta 1998;1366:139–49.Search in Google Scholar

[22] Gogvadze V, Orrenius S, Zhivotovsky B. Multiple pathways of cytochrome C release from mitochondria in apoptosis. Biochim Biophys Acta 2006;1757:639–47.Search in Google Scholar

[23] Sui B, Xu T, Liu J, Wei W, Zheng C, Guo B, Wang Y, Yang Y. Understanding the role of mitochondria in the pathogenesis of chronic pain. Postgrad Med J 2013;89:709–14.Search in Google Scholar

[24] Yildiz S, Uzun G, Kiralp MZ. Hyperbaric oxygen therapy in chronic pain management. Curr Pain Headache Rep 2006;10:95–100.Search in Google Scholar

[25] Gu N, Niu JY, Liu WT, Sun YY, Liu S, Lv Y, Dong HL, Song XJ, Xiong LZ. Hyperbaric oxygen therapy attenuates neuropathic hyperalgesia in rats and idiopathic trigeminal neuralgia in patients. Eur J Pain 2012;16:1094–105.Search in Google Scholar

[26] Li F, Fang L, Huang S, Yang Z, Nandi J, Thomas S, Chen C, Camporesi E. Hyperbaric oxygenation therapy alleviates chronic constrictive injury induced neuropathic pain and reduces tumor necrosis factor-alpha production. Anesth Analg 2011;113:626–33, http://dx.doi.org/10.1213/ANE.0b013e31821f9544.Search in Google Scholar

[27] Bonin RP, Bories C, De Koninck Y. A simplified up-down method (SUDO) for measuring mechanical nociception in rodents using von Frey filaments. Mol Pain 2014;10:26, http://dx.doi.org/10.1186/1744-8069-10-26.Search in Google Scholar

[28] Polgar E, Durrieux C, Hughes DI, Todd AJ. A quantitative study of inhibitory interneurons in laminae I–III of the mouse spinal dorsal horn. PLOS ONE 2013;8:e78309, http://dx.doi.org/10.1371/journal.pone.0078309.Search in Google Scholar

[29] Sivilotti L, Woolf CJ. The contribution of GABAA and glycine receptors to central sensitization: disinhibition and touch-evoked allodynia in the spinal cord. J Neurophysiol 1994;72:169–79.Search in Google Scholar

[30] Kanao M, Kanda H, Huang W, Liu S, Yi H, Candiotti KA, Lubarsky DA, Levitt RC, Hao S. Gene transfer of glutamic acid decarboxylase 67 by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120 combined with ddC in rats. Anesth Analg 2015;120:1394–404, http://dx.doi.org/10.1213/ANE.0000000000000729.Search in Google Scholar

[31] Polgar E, Hughes DI, Riddell JS, Maxwell DJ, Puskar Z, Todd AJ. Selective loss of spinal GABAergic or glycinergic neurons is not necessary for development of thermal hyperalgesia in the chronic constriction injury model of neuropathic pain. Pain 2003;104:229–39.Search in Google Scholar

[32] Polgar E, Todd AJ. Tactile allodynia can occur in the spared nerve injury model in the rat without selective loss of GABA or GABA(A) receptors from synapses in laminae I-II of the ipsilateral spinal dorsal horn. Neuroscience 2008;156:193–202, http://dx.doi.org/10.1016/j.neuroscience.2008.07.009.Search in Google Scholar

[33] Yowtak J, Wang J, Kim HY, Lu Y, Chung K, Chung JM. Effect of antioxidant treatment on spinal GABA neurons in a neuropathic pain model in the mouse. Pain 2013;154:2469–76, http://dx.doi.org/10.1016Zj.pain.2013.07.024.Search in Google Scholar

[34] Lorenzo LE, Magnussen C, Bailey AL, St Louis M, De Koninck Y, Ribeiro-da-Silva A. Spatial and temporal pattern of changes in the number of GAD65-immunoreactive inhibitory terminals in the rat superficial dorsal horn following peripheral nerve injury. Mol Pain 2014;10:57, http://dx.doi.org/10.1186/1744-8069-10-57.Search in Google Scholar

[35] Hwang I, Hahm SC, Choi KA, Park SH, Jeong H, Yea JH, Kim J, Hong S. Intrathecal transplantation of embryonic stem cell-derived spinal GABAergic neural precursor cells attenuates neuropathic pain in a spinal cord injury rat model. Cell Transplant 2016;25:593–607, http://dx.doi.org/10.3727/096368915X689460.Search in Google Scholar

[36] Jergova S, Gajavelli S, Pathak N, Sagen J. Recombinant neural progenitor transplants in the spinal dorsal horn alleviate chronic central neuropathic pain. Pain 2016;157:977–89, http://dx.doi.org/10.1097/j.pain.0000000000000471.Search in Google Scholar

[37] Jergova S, Gajavelli S, Varghese MS, Shekane P, Sagen J. Analgesic effect of recombinant gabaergic cells in a model of peripheral neuropathic pain. Cell Transplant 2016;25:629–43, http://dx.doi.org/10.3727/096368916X690782.Search in Google Scholar

[38] Etlin A, Braz JM, Kuhn JA, Wang X, Hamel KA, Llewellyn-Smith IJ, Basbaum AI. Functional synaptic integration of forebrain GABAergic precursors into the adult spinal cord. J Neurosci 2016;36:11634–45.Search in Google Scholar

[39] Kim WS, Park JY, Kim TK, Baik SW. The changes of mitochondrial cytochrome c and GABAergic neuron in neuropathic pain model. Korean J Anesthesiol 2012;62:365–70, http://dx.doi.org/10.4097/kjae.2012.62A365.Search in Google Scholar

[40] Jee M, Im Y, Choi JI, Kang SK. Novel, small molecule induced GABA-hATSCs for targeting of neuropathic pain. Hum Gene Ther 2013;24:1042, http://dx.doi.org/10.1089/hum.2012.097.Search in Google Scholar

[41] Huang ZZ, Wei JY, Ou-Yang HD, Li D, Xu T, Wu SL, Zhang XL, Liu CC, Ma C, Xin WJ. mir-500-mediated GAD67 downregulation contributes to neuropathic pain. J Neurosci 2016;36:6321–31, http://dx.doi.org/10.1523/JNEUROSCI.0646-16.2016.Search in Google Scholar

[42] Wang Y, Lin ZP, Zheng HZ, Zhang S, Zhang ZL, Chen Y, You YS, Yang MH. Abnormal DNA methylation in the lumbar spinal cord following chronic constriction injury in rats. Neurosci Lett 2016;610:1–5, http://dx.doi.org/10.1016/j.neulet.2015.10.048.Search in Google Scholar

[43] Basbaum AI, Braz JM. Cell transplants to treat the “disease” of neuropathic pain and itch. Pain 2016;157:S42–7, http://dx.doi.org/10.1097/j.pain.0000000000000441.Search in Google Scholar

[44] Vaysse L, Sol JC, Lazorthes Y, Courtade-Saidi M, Eaton MJ, Jozan S. GABAergic pathway in a rat model of chronic neuropathic pain: modulation after intrathecal transplantation of a human neuronal cell line. Neurosci Res 2011;69:111–20, http://dx.doi.org/10.1016/j.neures.2010.10.006.Search in Google Scholar

[45] Lipton SA, Rosenberg PA. Excitatory amino acids as a final common pathway forneurologic disorders. N EnglJ Med 1994;330:613–22.Search in Google Scholar

[46] Zeilhofer HU, Benke D, Yevenes GE. Chronic pain states: phar macological strategies to restore diminished inhibitory spinal pain control. Annu Rev Pharmacol Toxicol 2012;52:111–33, http://dx.doi.org/10.1146/annurevpharmtox-010611-134636.Search in Google Scholar

[47] Finnerup NB, Attal N, Haroutounian S, McNicol E, Baron R, Dworkin RH, Gilron I, Haanpaa M, Hansson P, Jensen TS, Kamerman PR, Lund K, Moore A, Raja SN, Rice AS, Rowbotham M, Sena E, Siddall P, Smith BH, Wallace M. Pharmacotherapy for neuropathic pain in adults: a systematic review and meta-analysis. Lancet Neurol 2015;14:162–73, http://dx.doi.org/10.1016/S1474-4422(14)70251-0.Search in Google Scholar

[48] Green DR, Kroemer G. The pathophysiology of mitochondrial cell death. Science 2004;305:626–9.Search in Google Scholar

[49] Wang Y, Zhang S, Luo M, Li Y. Hyperbaric oxygen therapy improves local microenvironment afterspinal cord injury. Neural Regen Res 2014;9:2182–8, http://dx.doi.org/10.4103/1673-5374.147951.Search in Google Scholar

[50] Hu Q, Manaenko A, Matei N, Guo Z, Xu T, Tang J, Zhang JH. Hyperbaric oxygen: a reliable preconditioning option for neuroprotection. Med Gas Res 2016;6:20–32, http://dx.doi.org/10.4103/2045-9912.179337.Search in Google Scholar

[51] Lou M, Chen Y, Ding M, Eschenfelder CC, Deuschl G. Involvement of the mitochondrial ATP-sensitive potassium channel in the neuroprotective effect of hyperbaric oxygenation after cerebral ischemia. Brain Res Bull 2006;69:109–16.Search in Google Scholar

[52] Li JS, Zhang W, Kang ZM, Ding SJ, Liu WW, Zhang JH, Guan YT, Sun XJ. Hyperbaric oxygen preconditioning reduces ischemia-reperfusion injury by inhibition of apoptosis via mitochondrial pathway in rat brain. Neuroscience 2009;159:1309–15, http://dx.doi.org/10.1016/j.neuroscience.2009.01.011.Search in Google Scholar

[53] Di Cesare Mannelli L, Ghelardini C, Calvani M, Nicolai R, Mosconi L, Vivoli E, Pacini A, Bartolini A. Protective effect of acetyl-l-car-nitine on the apoptotic pathway of peripheral neuropathy. EurJ Neurosci 2007;26:820–7.Search in Google Scholar

[54] Hajializadeh Z, Nasri S, Kaeidi A, Sheibani V, Rasoulian B, Esmaeili-Mahani S. Inhibitory effect ofThymus caramanicus Jalas on hyperglycemia-induced apoptosis in in vitro and in vivo models of diabetic neuropathic pain. J Ethnopharmacol 2014;153:596–603, http://dx.doi.org/10.1016/jjep.2014.02.049.Search in Google Scholar

[55] Liu Z, Jiao QF, You C, Che YJ, Su FZ. Effect of hyperbaric oxygen on cytochrome C, Bcl-2 and Bax expression after experimental traumatic brain injury in rats. Chin J Traumatol 2006;9:168–74.Search in Google Scholar
Received: 2017-07-27
Accepted: 2017-08-28
Published Online: 2017-10-01
Published in Print: 2017-10-01

© 2017 Scandinavian Association for the Study of Pain

Articles in the same Issue

  1. Observational study
  2. Perceived sleep deficit is a strong predictor of RLS in multisite pain – A population based study in middle aged females
  3. Clinical pain research
  4. Prospective, double blind, randomized, controlled trial comparing vapocoolant spray versus placebo spray in adults undergoing intravenous cannulation
  5. Clinical pain research
  6. The Functional Barometer — An analysis of a self-assessment questionnaire with ICF-coding regarding functional/activity limitations and quality of life due to pain — Differences in age gender and origin of pain
  7. Clinical pain research
  8. Clinical outcome following anterior arthrodesis in patients with presumed sacroiliac joint pain
  9. Observational study
  10. Chronic disruptive pain in emerging adults with and without chronic health conditions and the moderating role of psychiatric disorders: Evidence from a population-based cross-sectional survey in Canada
  11. Educational case report
  12. Management of patients with pain and severe side effects while on intrathecal morphine therapy: A case study
  13. Clinical pain research
  14. Behavioral inhibition, maladaptive pain cognitions, and function in patients with chronic pain
  15. Observational study
  16. Comparison of patients diagnosed with “complex pain” and “somatoform pain”
  17. Original experimental
  18. Patient perspectives on wait times and the impact on their life: A waiting room survey in a chronic pain clinic
  19. Topical review
  20. New evidence for a pain personality? A critical review of the last 120 years of pain and personality
  21. Clinical pain research
  22. A multi-facet pain survey of psychosocial complaints among patients with long-standing non-malignant pain
  23. Clinical pain research
  24. Pain patients’ experiences of validation and invalidation from physicians before and after multimodal pain rehabilitation: Associations with pain, negative affectivity, and treatment outcome
  25. Observational study
  26. Long-term treatment in chronic noncancer pain: Results of an observational study comparing opioid and nonopioid therapy
  27. Clinical pain research
  28. COMBAT study – Computer based assessment and treatment – A clinical trial evaluating impact of a computerized clinical decision support tool on pain in cancer patients
  29. Original experimental
  30. Quantitative sensory tests fairly reflect immediate effects of oxycodone in chronic low-back pain
  31. Editorial comment
  32. Spatial summation of pain and its meaning to patients
  33. Original experimental
  34. Effects of validating communication on recall during a pain-task in healthy participants
  35. Original experimental
  36. Comparison of spatial summation properties at different body sites
  37. Editorial comment
  38. Behavioural inhibition in the context of pain: Measurement and conceptual issues
  39. Clinical pain research
  40. A randomized study to evaluate the analgesic efficacy of a single dose of the TRPV1 antagonist mavatrep in patients with osteoarthritis
  41. Editorial comment
  42. Quantitative sensory tests (QST) are promising tests for clinical relevance of anti–nociceptive effects of new analgesic treatments
  43. Educational case report
  44. Pregabalin as adjunct in a multimodal pain therapy after traumatic foot amputation — A case report of a 4-year-old girl
  45. Editorial comment
  46. Severe side effects from intrathecal morphine for chronic pain after repeated failed spinal operations
  47. Editorial comment
  48. Opioids in chronic pain – Primum non nocere
  49. Editorial comment
  50. Finally a promising analgesic signal in a long-awaited new class of drugs: TRPV1 antagonist mavatrep in patients with osteoarthritis (OA)
  51. Observational study
  52. The relationship between chronic musculoskeletal pain, anxiety and mindfulness: Adjustments to the Fear-Avoidance Model of Chronic Pain
  53. Clinical pain research
  54. Opioid tapering in patients with prescription opioid use disorder: A retrospective study
  55. Editorial comment
  56. Sleep, widespread pain and restless legs — What is the connection?
  57. Editorial comment
  58. Broadening the fear-avoidance model of chronic pain?
  59. Observational study
  60. Identifying characteristics of the most severely impaired chronic pain patients treated at a specialized inpatient pain clinic
  61. Editorial comment
  62. The burden of central anticholinergic drugs increases pain and cognitive dysfunction. More knowledge about drug-interactions needed
  63. Editorial comment
  64. A case-history illustrates importance of knowledge of drug-interactions when pain-patients are prescribed non-pain drugs for co-morbidities
  65. Editorial comment
  66. Why can multimodal, multidisciplinary pain clinics not help all chronic pain patients?
  67. Topical review
  68. Individual variability in clinical effect and tolerability of opioid analgesics – Importance of drug interactions and pharmacogenetics
  69. Editorial comment
  70. A new treatable chronic pain diagnosis? Flank pain caused by entrapment of posterior cutaneous branch of intercostal nerves, lateral ACNES coined LACNES
  71. Clinical pain research
  72. PhKv a toxin isolated from the spider venom induces antinociception by inhibition of cholinesterase activating cholinergic system
  73. Clinical pain research
  74. Lateral Cutaneous Nerve Entrapment Syndrome (LACNES): A previously unrecognized cause of intractable flank pain
  75. Editorial comment
  76. Towards a structured examination of contextual flexibility in persistent pain
  77. Clinical pain research
  78. Context sensitive regulation of pain and emotion: Development and initial validation of a scale for context insensitive avoidance
  79. Editorial comment
  80. Is the search for a “pain personality” of added value to the Fear-Avoidance-Model (FAM) of chronic pain?
  81. Editorial comment
  82. Importance for patients of feeling accepted and understood by physicians before and after multimodal pain rehabilitation
  83. Editorial comment
  84. A glimpse into a neglected population – Emerging adults
  85. Observational study
  86. Assessment and treatment at a pain clinic: A one-year follow-up of patients with chronic pain
  87. Clinical pain research
  88. Randomized, double-blind, placebo-controlled, dose-escalation study: Investigation of the safety, pharmacokinetics, and antihyperalgesic activity of L-4-chlorokynurenine in healthy volunteers
  89. Clinical pain research
  90. Prevalence and characteristics of chronic pain: Experience of Niger
  91. Observational study
  92. The use of rapid onset fentanyl in children and young people for breakthrough cancer pain
  93. Original experimental
  94. Acid-induced experimental muscle pain and hyperalgesia with single and repeated infusion in human forearm
  95. Original experimental
  96. Swearing as a response to pain: A cross-cultural comparison of British and Japanese participants
  97. Clinical pain research
  98. The cognitive impact of chronic low back pain: Positive effect of multidisciplinary pain therapy
  99. Clinical pain research
  100. Central sensitization associated with low fetal hemoglobin levels in adults with sickle cell anemia
  101. Topical review
  102. Targeting cytokines for treatment of neuropathic pain
  103. Original experimental
  104. What constitutes back pain flare? A cross sectional survey of individuals with low back pain
  105. Original experimental
  106. Coping with pain in intimate situations: Applying the avoidance-endurance model to women with vulvovaginal pain
  107. Clinical pain research
  108. Chronic low back pain and the transdiagnostic process: How do cognitive and emotional dysregulations contribute to the intensity of risk factors and pain?
  109. Original experimental
  110. The impact of the Standard American Diet in rats: Effects on behavior, physiology and recovery from inflammatory injury
  111. Educational case report
  112. Erector spinae plane (ESP) block in the management of post thoracotomy pain syndrome: A case series
  113. Original experimental
  114. Hyperbaric oxygenation alleviates chronic constriction injury (CCI)-induced neuropathic pain and inhibits GABAergic neuron apoptosis in the spinal cord
  115. Observational study
  116. Predictors of chronic neuropathic pain after scoliosis surgery in children
  117. Clinical pain research
  118. Hospitalization due to acute exacerbation of chronic pain: An intervention study in a university hospital
  119. Clinical pain research
  120. A novel miniature, wireless neurostimulator in the management of chronic craniofacial pain: Preliminary results from a prospective pilot study
  121. Clinical pain research
  122. Implicit evaluations and physiological threat responses in people with persistent low back pain and fear of bending
  123. Original experimental
  124. Unpredictable pain timings lead to greater pain when people are highly intolerant of uncertainty
  125. Original experimental
  126. Initial validation of the exercise chronic pain acceptance questionnaire
  127. Clinical pain research
  128. Exploring patient experiences of a pain management centre: A qualitative study
  129. Clinical pain research
  130. Narratives of life with long-term low back pain: A follow up interview study
  131. Observational study
  132. Pain catastrophizing, perceived injustice, and pain intensity impair life satisfaction through differential patterns of physical and psychological disruption
  133. Clinical pain research
  134. Chronic pain disrupts ability to work by interfering with social function: A cross-sectional study
  135. Original experimental
  136. Evaluation of external vibratory stimulation as a treatment for chronic scrotal pain in adult men: A single center open label pilot study
  137. Observational study
  138. Impact of analgesics on executive function and memory in the Alzheimer’s Disease Neuroimaging Initiative Database
  139. Clinical pain research
  140. Visualization of painful inflammation in patients with pain after traumatic ankle sprain using [11C]-D-deprenyl PET/CT
  141. Original experimental
  142. Developing a model for measuring fear of pain in Norwegian samples: The Fear of Pain Questionnaire Norway
  143. Topical review
  144. Psychoneuroimmunological approach to gastrointestinal related pain
  145. Letter to the Editor
  146. Do we need an updated definition of pain?
  147. Narrative review
  148. Is acetaminophen safe in pregnancy?
  149. Book Review
  150. Physical Diagnosis of Pain
  151. Book Review
  152. Advances in Anesthesia
  153. Book Review
  154. Atlas of Pain Management Injection Techniques
  155. Book Review
  156. Sedation: A Guide to Patient Management
  157. Book Review
  158. Basics of Anesthesia
https://doi.org/10.1016/j.sjpain.2017.08.014
Keywords for this article
HBO; CCI-induced neuropathic pain; GABAergic neurons; Spinal cord; Apoptosis

Articles in the same Issue

  1. Observational study
  2. Perceived sleep deficit is a strong predictor of RLS in multisite pain – A population based study in middle aged females
  3. Clinical pain research
  4. Prospective, double blind, randomized, controlled trial comparing vapocoolant spray versus placebo spray in adults undergoing intravenous cannulation
  5. Clinical pain research
  6. The Functional Barometer — An analysis of a self-assessment questionnaire with ICF-coding regarding functional/activity limitations and quality of life due to pain — Differences in age gender and origin of pain
  7. Clinical pain research
  8. Clinical outcome following anterior arthrodesis in patients with presumed sacroiliac joint pain
  9. Observational study
  10. Chronic disruptive pain in emerging adults with and without chronic health conditions and the moderating role of psychiatric disorders: Evidence from a population-based cross-sectional survey in Canada
  11. Educational case report
  12. Management of patients with pain and severe side effects while on intrathecal morphine therapy: A case study
  13. Clinical pain research
  14. Behavioral inhibition, maladaptive pain cognitions, and function in patients with chronic pain
  15. Observational study
  16. Comparison of patients diagnosed with “complex pain” and “somatoform pain”
  17. Original experimental
  18. Patient perspectives on wait times and the impact on their life: A waiting room survey in a chronic pain clinic
  19. Topical review
  20. New evidence for a pain personality? A critical review of the last 120 years of pain and personality
  21. Clinical pain research
  22. A multi-facet pain survey of psychosocial complaints among patients with long-standing non-malignant pain
  23. Clinical pain research
  24. Pain patients’ experiences of validation and invalidation from physicians before and after multimodal pain rehabilitation: Associations with pain, negative affectivity, and treatment outcome
  25. Observational study
  26. Long-term treatment in chronic noncancer pain: Results of an observational study comparing opioid and nonopioid therapy
  27. Clinical pain research
  28. COMBAT study – Computer based assessment and treatment – A clinical trial evaluating impact of a computerized clinical decision support tool on pain in cancer patients
  29. Original experimental
  30. Quantitative sensory tests fairly reflect immediate effects of oxycodone in chronic low-back pain
  31. Editorial comment
  32. Spatial summation of pain and its meaning to patients
  33. Original experimental
  34. Effects of validating communication on recall during a pain-task in healthy participants
  35. Original experimental
  36. Comparison of spatial summation properties at different body sites
  37. Editorial comment
  38. Behavioural inhibition in the context of pain: Measurement and conceptual issues
  39. Clinical pain research
  40. A randomized study to evaluate the analgesic efficacy of a single dose of the TRPV1 antagonist mavatrep in patients with osteoarthritis
  41. Editorial comment
  42. Quantitative sensory tests (QST) are promising tests for clinical relevance of anti–nociceptive effects of new analgesic treatments
  43. Educational case report
  44. Pregabalin as adjunct in a multimodal pain therapy after traumatic foot amputation — A case report of a 4-year-old girl
  45. Editorial comment
  46. Severe side effects from intrathecal morphine for chronic pain after repeated failed spinal operations
  47. Editorial comment
  48. Opioids in chronic pain – Primum non nocere
  49. Editorial comment
  50. Finally a promising analgesic signal in a long-awaited new class of drugs: TRPV1 antagonist mavatrep in patients with osteoarthritis (OA)
  51. Observational study
  52. The relationship between chronic musculoskeletal pain, anxiety and mindfulness: Adjustments to the Fear-Avoidance Model of Chronic Pain
  53. Clinical pain research
  54. Opioid tapering in patients with prescription opioid use disorder: A retrospective study
  55. Editorial comment
  56. Sleep, widespread pain and restless legs — What is the connection?
  57. Editorial comment
  58. Broadening the fear-avoidance model of chronic pain?
  59. Observational study
  60. Identifying characteristics of the most severely impaired chronic pain patients treated at a specialized inpatient pain clinic
  61. Editorial comment
  62. The burden of central anticholinergic drugs increases pain and cognitive dysfunction. More knowledge about drug-interactions needed
  63. Editorial comment
  64. A case-history illustrates importance of knowledge of drug-interactions when pain-patients are prescribed non-pain drugs for co-morbidities
  65. Editorial comment
  66. Why can multimodal, multidisciplinary pain clinics not help all chronic pain patients?
  67. Topical review
  68. Individual variability in clinical effect and tolerability of opioid analgesics – Importance of drug interactions and pharmacogenetics
  69. Editorial comment
  70. A new treatable chronic pain diagnosis? Flank pain caused by entrapment of posterior cutaneous branch of intercostal nerves, lateral ACNES coined LACNES
  71. Clinical pain research
  72. PhKv a toxin isolated from the spider venom induces antinociception by inhibition of cholinesterase activating cholinergic system
  73. Clinical pain research
  74. Lateral Cutaneous Nerve Entrapment Syndrome (LACNES): A previously unrecognized cause of intractable flank pain
  75. Editorial comment
  76. Towards a structured examination of contextual flexibility in persistent pain
  77. Clinical pain research
  78. Context sensitive regulation of pain and emotion: Development and initial validation of a scale for context insensitive avoidance
  79. Editorial comment
  80. Is the search for a “pain personality” of added value to the Fear-Avoidance-Model (FAM) of chronic pain?
  81. Editorial comment
  82. Importance for patients of feeling accepted and understood by physicians before and after multimodal pain rehabilitation
  83. Editorial comment
  84. A glimpse into a neglected population – Emerging adults
  85. Observational study
  86. Assessment and treatment at a pain clinic: A one-year follow-up of patients with chronic pain
  87. Clinical pain research
  88. Randomized, double-blind, placebo-controlled, dose-escalation study: Investigation of the safety, pharmacokinetics, and antihyperalgesic activity of L-4-chlorokynurenine in healthy volunteers
  89. Clinical pain research
  90. Prevalence and characteristics of chronic pain: Experience of Niger
  91. Observational study
  92. The use of rapid onset fentanyl in children and young people for breakthrough cancer pain
  93. Original experimental
  94. Acid-induced experimental muscle pain and hyperalgesia with single and repeated infusion in human forearm
  95. Original experimental
  96. Swearing as a response to pain: A cross-cultural comparison of British and Japanese participants
  97. Clinical pain research
  98. The cognitive impact of chronic low back pain: Positive effect of multidisciplinary pain therapy
  99. Clinical pain research
  100. Central sensitization associated with low fetal hemoglobin levels in adults with sickle cell anemia
  101. Topical review
  102. Targeting cytokines for treatment of neuropathic pain
  103. Original experimental
  104. What constitutes back pain flare? A cross sectional survey of individuals with low back pain
  105. Original experimental
  106. Coping with pain in intimate situations: Applying the avoidance-endurance model to women with vulvovaginal pain
  107. Clinical pain research
  108. Chronic low back pain and the transdiagnostic process: How do cognitive and emotional dysregulations contribute to the intensity of risk factors and pain?
  109. Original experimental
  110. The impact of the Standard American Diet in rats: Effects on behavior, physiology and recovery from inflammatory injury
  111. Educational case report
  112. Erector spinae plane (ESP) block in the management of post thoracotomy pain syndrome: A case series
  113. Original experimental
  114. Hyperbaric oxygenation alleviates chronic constriction injury (CCI)-induced neuropathic pain and inhibits GABAergic neuron apoptosis in the spinal cord
  115. Observational study
  116. Predictors of chronic neuropathic pain after scoliosis surgery in children
  117. Clinical pain research
  118. Hospitalization due to acute exacerbation of chronic pain: An intervention study in a university hospital
  119. Clinical pain research
  120. A novel miniature, wireless neurostimulator in the management of chronic craniofacial pain: Preliminary results from a prospective pilot study
  121. Clinical pain research
  122. Implicit evaluations and physiological threat responses in people with persistent low back pain and fear of bending
  123. Original experimental
  124. Unpredictable pain timings lead to greater pain when people are highly intolerant of uncertainty
  125. Original experimental
  126. Initial validation of the exercise chronic pain acceptance questionnaire
  127. Clinical pain research
  128. Exploring patient experiences of a pain management centre: A qualitative study
  129. Clinical pain research
  130. Narratives of life with long-term low back pain: A follow up interview study
  131. Observational study
  132. Pain catastrophizing, perceived injustice, and pain intensity impair life satisfaction through differential patterns of physical and psychological disruption
  133. Clinical pain research
  134. Chronic pain disrupts ability to work by interfering with social function: A cross-sectional study
  135. Original experimental
  136. Evaluation of external vibratory stimulation as a treatment for chronic scrotal pain in adult men: A single center open label pilot study
  137. Observational study
  138. Impact of analgesics on executive function and memory in the Alzheimer’s Disease Neuroimaging Initiative Database
  139. Clinical pain research
  140. Visualization of painful inflammation in patients with pain after traumatic ankle sprain using [11C]-D-deprenyl PET/CT
  141. Original experimental
  142. Developing a model for measuring fear of pain in Norwegian samples: The Fear of Pain Questionnaire Norway
  143. Topical review
  144. Psychoneuroimmunological approach to gastrointestinal related pain
  145. Letter to the Editor
  146. Do we need an updated definition of pain?
  147. Narrative review
  148. Is acetaminophen safe in pregnancy?
  149. Book Review
  150. Physical Diagnosis of Pain
  151. Book Review
  152. Advances in Anesthesia
  153. Book Review
  154. Atlas of Pain Management Injection Techniques
  155. Book Review
  156. Sedation: A Guide to Patient Management
  157. Book Review
  158. Basics of Anesthesia
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 29.12.2025 from https://www.degruyterbrill.com/document/doi/10.1016/j.sjpain.2017.08.014/html
Scroll to top button