Startseite The prevalence of virulence genes and multidrug resistance in thermophilic Campylobacter spp. isolated from dogs
Artikel Open Access

The prevalence of virulence genes and multidrug resistance in thermophilic Campylobacter spp. isolated from dogs

  • Marek Selwet EMAIL logo
Veröffentlicht/Copyright: 31. Dezember 2019

Abstract

The aim of the study was to determine the role of dogs as a potential reservoir of Campylobacter spp. At the next stage of the research the frequency of occurrence of selected virulence genes, i.e. cadF, flaA and iam as well as genes responsible for the formation the cytolethal distending toxin (CDT), i.e. cdtA, cdtB and cdtC was determined. The isolates obtained in the research were tested for their resistance to selected antibiotics: ciprofloxacin (CIP), enrofloxacin (EF), erythromycin (E) and tetracycline (TE). Campylobacter spp. was found in 63 (12.6%) out of a total number of 500 isolates. 61 (12.2%) isolates were identified as C. jejuni. The number of C. jejuni isolates found in the younger animals was smaller (p <0.05) than in the older ones. The frequency of occurrence of virulence genes and the genes responsible for the formation of CDT was significantly (p <0.05) higher in the older dogs. A comparison of the effect of antibiotics showed that the isolates obtained from both age groups exhibited low resistance to erythrosine (13.5% in the group aged under 1 year and 8.6% in the group aged over 1 year). Both groups exhibited the highest resistance to ciprofloxacin and enrofloxacin.

1 Introduction

Thermotolerant bacteria of the Campylobacter genus (mainly Campylobacter jejuni and Campylobacter coli) are part of the natural intestinal flora in mammals and birds. They can also be found in water and soil contaminated with animal faeces [1]. As these bacteria are so common, animal products, especially red meat and poultry, are at risk of contamination. Close contact with a sick animal and lack of hygiene may cause campylobacteriosis in humans and become a serious epidemiological problem in the 21st century [2, 3]. The incidence of this disease in humans has been increased in Europe since 2005 [4]. In 2015 the overall incidence of infections in the EU was 65.5 cases per 100.000 inhabitants [5]. 20-40% of human infections were caused by contact with poultry or poultry meat [6]. The most common clinical symptoms are diarrhea, fever and abdominal pain. The infection usually disappears spontaneously, although there may be complications such as arthritis [7]. According to the latest EFSA report [8], each year about 200.000 cases of campylobacteriosis infections diagnosed in humans were caused by the consumption of contaminated food. The actual number of infections is estimated at 9 million per annum. According to the EFSA estimates, the annual costs generated by the incidence of campylobacteriosis in public healthcare in the EU amount to 2.4 billion Euros (€). Due to the fact that Campylobacter spp. isolates from humans are increasingly often resistant to quinolone chemotherapeutics [9], aminoglycosides and macrolide antibiotics, they pose a threat to public health [10]. The development of resistance is often associated with spontaneous point mutations of the genes encoding enzymes synthesised by Campylobacter spp. [11]. The bacteria were proved to have various pathogenic properties resulting from high genetic diversity of their strains. The pathogenicity of bacteria is caused by the genes that determine their motility, adhesion, invasiveness and synthesis of a cytolethal distending toxin (CDT), which is encoded by three genes – cdtA, cdtB and cdtC. This cytotoxin causes cell cycle arrest at the G2/M phase [12]. Other virulence genes are: fla, cad, rac, vir, cia, pld, iam. The fla genes (flaA and flaB) are responsible for bacterial motility. They encode flagellin – the ciliary

protein which enables Campylobacter spp. cells to move. The cadF gene encodes the fibronectin binding protein of enterocytes, which participate in adherence. Many researchers believe that this gene, which is necessary to induce symptoms of campylobacteriosis, is a conservative gene in C. jejuni and C. coli. The vir gene, which can be found in the Campylobacter spp. plasmid (the plasmid is not always present), also encodes proteins responsible for pathogenicity. The iam sequence, which is responsible for adhesion and invasiveness, is found in C. coli more often than in C. jejuni [13]. In consequence, it may disorder intestinal absorption.

The aim of the study was to determine the frequency of occurrence of Campylobacter bacteria in dogs, to identify species within the Campylobacter genus, selected virulence genes in isolated strains and genes determining the occurrence of CDT, and to determine resistance to selected antibiotics.

2 Materials and methods

2.1 Sampling

Swab samples (swabs with transport medium, Stuart swabs. Sterile, product No. 300295, Deltalab, Spain) collected from the rectum of 500 dogs (n = 250 dogs younger than 1 year and n = 250 dogs older than 1 year) from shelters located in the Wielkopolska region were used as material for the tests. No dog showed gastrointestinal symptoms. The samples were collected on three consecutive days and transported to a laboratory within 6 hours while stored at 4°C.

Ethical approval: The research related to animals use has been complied with all the relevant national regulations and institutional policies for the care and use of animals.

2.2 Isolation and identification of Campylobacter spp. from swab samples (PN EN ISO10272 under modification)

Swab samples were initially placed in 3 cm3 of liquid selective medium Preston Broth No. 2 (product No. CM067, Lysed Horse Blood product No. SR0048, Preston Campylobacter Selective Supplement product No. SR0117 and Campylobacter Growth Supplement product No. SR0232, Oxoid). Next, they were incubated in a CampyGen anaerostat (product No. CN0025, Oxoid) at 41.5 °C/24 h (5% O2, 10% CO2, 85% N2). After incubation the bacterial cultures were centrifuged (4.000 x g/15 min), the supernatant was poured and the sediment was added to 1 cm3 of Karmali agar. 200 μL of the suspension was spread with a spreader on a selective Karmali agar (product No. CM0935, Oxoid) and incubated in an anaerostat at 41.5 °C/48 h. An API Campy biochemical test, product No. 20800 (Biomérieux) was used to confirm the presence of Campylobacter spp. The identity of the colonies grown on the agar was determined by observation of their morphological features and motility (Axio Imager.A2 microscope, Zeiss). The following tests were carried out: oxidase (OXI detection strip, product No. 2001, Diagnostics Inc., Slovak Republic), catalase (API ID colour catalase, product No. 55561, Biomérieux) and the hydrolysis capacity of hippurate and indoxyl acetate (HIP , product No. 2006 and HIP reagent, product No. 3006; INDOXYL, product No. 2007, Diagnostics Inc., Slovak Republic). A selective mCCDA medium (Oxoid) was used for a confirmatory test, where colonies grown after incubation at 41.5 °C/48 h were counted. Campylobacter spp. was also distinguished from other gram-negative bacteria by means of an O.B.I.S. Campy test (product No. ID0800M, Oxoid). Real-time PCR (Biorad) with the BAX System Real-Time PCR Assay for Campylobacter (product No. D12683449 KIT2018, Hygiena) was used for species identification.

2.3 Identification of genes determining CDT occurrence by means of multiplex PCR

The primers shown in Table 1 were used to identify the cdtA, cdtB, and cdtC genes. A 25μL reaction mixture was used. It was composed of: 2.5 μL 10 x PCR buffer, 6 x 1 μL primers (5 μM), 1 μL dNTP (2.5 mM), 0.2μL Taq polymerase, 1.8 μL DNA, 13.5 μL water. The thermal conditions of the reaction were as follows: initial denaturation at 94 °C/2 min. It was followed by 30 cycles, each of which consisted of: denaturation (94 °C/0.5 min), primer attachment (50 °C/0.5 min) and extension (72 °C/1 min and 72 °C/5 min). The resulting products were analysed by means of electrophoresis in 1.5% agarose gel.

Table 1

Sequences of primers used to detect genes cdtA, cdtB, cdtC.

PrimerSequences 5 →3Product size (bp)References
cdtA-FCTA TTA CTC CTA TTA CCC CAC C422[14]
cdtA-RAAT TTG AAC CGC TGT ATT GCT C
cdtB-FAGG AAC TTT ACC AAG AAC AGC C531
cdtB-RGGT GGA GTA TAG GTT TGT TGT C
cdtC-FACT CCT ACT GGA GAT TTG AAA G339
cdtC-RCAC AGC TGA AGT TGT TGT TGG C

2.4 Identification of virulence genes

cadF, flaA, and iam genes were identified by means of the primers shown in Table 2. The reaction was carried out in a total volume of 25μL. The mixture was composed of: 2.5 μL 10 x PCR buffer, 2.5 μL MgCl2 (25 mM), 1 μL dNTP (2.5 mM), 1 μL primers (5 μM), 0.2 μL (1U ) U Taq

Table 2

Sequences of primers used to detect genes cadF, flaA, iam.

PrimerSequences 5 →3Product size (bp)References
cad F-FTGGAGGGTAATTTAGATATTG400[15]
cad F-RCTAATACCTAAAGTTGAAAC
fla A-FGGATTTCGTATTAACACAAATGGTGC1728[16]
fla A-RCTGTAGTAATCTTAAAACATTTTG
iam-FGCGCAAAATATTATCACCC518[17]
iam-RTTCACGACTACTATGCGG

DNA polymerase (Promega Corporation), 2 μL DNA, 15, 5 μL water. The thermal conditions of the reaction were as follows: initial denaturation (94 °C/1 min). It was followed by 30 cycles, each of which consisted of: denaturation (94 °C/0.5 min), primer attachment (45 °C/1 min), extension (72 °C/2 min and 72 °C/5 min). The resulting products were analysed by means of electrophoresis in 1.5% agarose gel.

2.5 Assessment of sensitivity to antibiotics

The isolated Campylobacter bacterial strains were tested for sensitivity to antibiotics by means of the Kirby-Bauer disc diffusion test and E-test. The method was compatible with the EUCAST [18] Disc Diffusion Method for Antimicrobial Susceptibility Testing and Clinical and Laboratory Standards Institute (CLSI). Bacterial colonies were grown on lysogeny broth (LB) (product No. L3522, Merck). After 24 h incubation at 37 °C the culture was diluted to a density of 0.5 on the McFarland scale. The suspension was diluted at a ratio of 1:10 again and a surface culture was prepared on Mueller-Hinton Agar (product No. 70191, Merck) with 20 mg/L ß-NAD (product No. 10127981001, Merck). The discs were then coated with antibiotics: ciprofloxacin (CIP) 5 μg, erythromycin (E) 15 μg, tetracycline (TE) 30 μg and enfofloxacin (EF) 5 μg and incubated at 41 ± 1 °C/24 h. An analogous procedure was applied in the E test, where strips coated with antibiotics were used to determine the MIC on the scale of a NEMA 88 device (product No. 559804, Biomérieux).

C. jejuni ATCC 33291 and C. coli ATCC 33559 (DSMZ Germany) were used as reference strains in the study.

2.6 Statistical analysis

The counts of microorganisms measured in the investigations were analysed statistically using the GLM procedure of the SAS program. The significance of differences was verified with Duncan’s test (α=0.05).

3 Results

3.1 Isolation and identification of Campylo-bacter spp

Campylobacter spp. was found in 63 (12.6%) out of the total number of 500 isolates. 61 (12.2%) isolates were identified as C. jejuni (Table 3). There were 2 isolates (0.4%) that should not pose a threat to human health, so they were not further differentiated. There were no C. coli or C. lari strains detected. The total number of positive isolates found in the dogs aged under 1 year was lower (n = 27; 10.8%) than the number of positive isolates found in the dogs aged over 1 year (n = 36; 14.4%). The analysis of the species composition of the isolates (n = 61; 100%) showed that all of them belonged to C. jejuni. There were 26 (10.4%) C. jejuni isolates found in the dogs aged under 1 year. This number was lower than in the group of dogs aged over 1 year (n = 35, 14.0%). The differences were statistically significant (p <0.05).

Table 3

The prevalence of Campylobacter isolated from dogs.

AgeC. jejuniC. coliC. lariC. speciesNegativePositiveTotal samples
n%n%n%n%n%n%n%
Dogs<1year26a10.4000010.422389.227a10.825050
>1 year35b14.0000010.421485.636b14.425050
Total6112.2000020.443787.46312.6500100
  1. a, b-means in columns designated with the same letters do not differ significantly at the level of p<0.05.

3.2 Identification of genes determining CDT occurrence

There were 3 dogs aged under 1 year (11.5%) and 15 dogs aged over 1 year (42.8%) with the cdtA gene. The cdtB gene was found in 2 dogs aged under 1 year (7.7%) and 17 dogs aged over 1 year (48.6%). The cdtC gene was found in 4 dogs aged under 1 year (15.3%) and 20 dogs aged over 1 year (57.1%). The differences were statistically significant (p <0.05). The frequency of occurrence of the genes determining CDT occurrence was higher in the animals aged over 1 year (Table 4).

Table 4

The number and percentages of virulence genes in C. jejuni isolated from dogs.

AgecadFflaAiamcdtAcdtBcdtC
Dogs<1 year (n=26)16 (61.5)a15 (57.7)a9 (34.6)a3 (11.5)a2 (7.7)a4 (15.3)a
>1 year (n=35)35 (100)b35 (100)b23 (65.7)b15 (42.8)b17 (48.6)b20 (57.1)b
Totaln=6151 (83.6)50(82)32 (52.4)18 (29.5)19 (31.1)24 (39.3)
  1. a, b-means in columns designated with the same letters do not differ significantly at the level of p<0.05.

3.3 Identification of virulence genes

There were 16 dogs aged under 1 year (61.5%) and 35 dogs aged over 1 year (100%) with the cadF gene. The flaA gene was found in 15 dogs aged under 1 year (57.7%) and 35 dogs aged over 1 year (100%). The iam gene was found in 9 dogs aged under 1 year (34.6%) and 23 dogs aged over 1 year (65.7%). The differences were statistically significant (p <0.05). The frequency of occurrence of the sequences of virulence genes was higher in the dogs aged over 1 year (Table 4).

3.4 Sensitivity to antibiotics (the percentage of resistant isolates is the average of two tests)

Tables 5-6 show the results of Campylobacter jejuni sensitivity (S) and resistance (R) to the antibiotics applied in the experiment. The E Test and disc diffusion test were two methods compared in the study. Enrofloxacin was the only antibiotic which resulted in statistically significant differences (p <0.05) between the methods, both in the group of dogs aged under 1 year and in the group of older animals. The isolates from the younger animals exhibited the highest resistance to ciprofloxacin (46%) and enrofloxacin (30.7%). The analysis of resistance of the isolates obtained from the older animals showed that they also exhibited high sensitivity to ciprofloxacin (50%) and enrofloxacin (22.9%) (this was observed only in the disc diffusion test). Both the isolates from the younger and older dogs exhibited low resistance to erythromycin (13.5% and 8.6%) and tetracycline (7.7% and 8.6%).

Table 5

Results of susceptibility testing of 26 isolates C.jejuni by disc diffusion and E test methods for four antibiotics (dogs <1 year).

Antimicrobial agentsE TestDisc diffusion
Ciprofloxacin (5μg)14S (*MIC≤1μg mL-1)14S (≥21 mm)
12R (MIC≥4μg mL-1)12R (≤15 mm)
Enrofloxacin (5μg)16S (MIC≤1μg mL-1)a20S (≥23 mm)b
10R (MIC≥2μg mL-1)a6R (≤16 mm)b
Erythromycin (15μg)22S (MIC≤1μg mL-1)23S (≥23 mm)
4R (MIC≥2μg mL-1)3R (≤13 mm)
Tetracycline (30μg)23S (MIC≤1μg mL-1)25S (≥19 mm)
3R (MIC≥2μg mL-1)1R (≤14 mm)
  1. * Minimum inhibitory concentration (MIC); S-susceptible, R-resistant; a, b-means in rows designated with the same letters do not differ significantly at the level of p<0.05.

Table 6

Results of susceptibility testing of 35 isolates C.jejuni by disc diffusion and E test methods for four antibiotics (dogs >1 year).

Antimicrobial agentsE TestDisc diffusion
Ciprofloxacin (5μg)17S (*MIC≤1μg mL-1)18S (≥21 mm)
18R (MIC≥4μg mL-1)17R (≤15 mm)
Enrofloxacin (5μg)34S (MIC≤1μg mL-1) a20S (≥23 mm) b
1R (MIC≥2μg mL-1) a15R (≤16 mm) b
Erythromycin (15μg)33S (MIC≤1μg mL-1)31S (≥23 mm)
2R (MIC≥2μg mL-1)4R (≤13 mm)
Tetracycline (30μg)32S (MIC≤1μg mL-1)33S (≥19 mm)
3R (MIC≥2μg mL-1)3R (≤14 mm)
  1. * Minimum inhibitory concentration (MIC); S-susceptible, R-resistant; a, b-means in rows designated with the same letters do not differ significantly at the level of p<0.05.

4 Discussion

Initially, biochemical tests were used to detect species such as C. coli and C. jejuni in research on Campylobacter spp. Particular attention was paid to the ability of C. jejuni to hydrolyse sodium hippurate. Since the description of hippurate-negative C. jejuni strains it has seemed more reliable to use the PCR method and the Real-Time PCR system with complementary primers [19]. Our study revealed a low incidence of Campylobacter spp. in the group of dogs (n = 500), i.e. 12.6%. This result stood in opposition to our earlier studies [1, 20] and research conducted by other authors [5, 21]. Chaban et al. [22] analysed a group (n = 70) of healthy dogs and found bacteria of the Campylobacter genus in 58% of the samples. Likewise, the authors did not find C. coli or C. lari, whereas C. jejuni was detected in 7% (n = 5) of the positive samples. Differences in the results of studies conducted by various authors may have been caused by many factors, e.g. the sampling method, the culturing conditions in a laboratory (in vitro) or high species diversity within the Campylobacter genus [23]. Other authors have suggested that the age of animals may affect the population of Campylobacter spp. [24]. Hald et al. [25] noticed a relation between the age of animals and the incidence of thermotolerant Campylobacter spp. The authors observed that the incidence of these bacteria increased from 60% in young animals (3 months old) to 100% in animals aged 12 months, but it then decreased to 67% in dogs aged 24 months.

The C. jejuni genome WCTC 11168, sequenced in 2000, revealed the presence of genes encoding a protein with potential toxic properties [19]. The strain contained cdt genes encoding the CDT protein (cytolethal distending toxin). These were two genes encoding proteins with haemolytic domains and one phospholipase gene. CDT was the first described genotoxin that damages the genetic material of sensitive eukaryotic cells by stopping the cell cycle and causing the death of cells as a consequence [26]. A CDT locus consists of three jointly constitutively transcribed open reading frames (ORFs): cdtA, cdtB and cdtC, which are usually located on the chromosome [27]. All three genes were detected in our study. Hyun-Ho et al. [28] recorded similar results in their study on dogs. It is noteworthy that the frequency of occurrence of these genes in the dogs aged over 1 year was higher than in the younger animals. The cdtB subunit is responsible for the nucleolytic effect. In our study the occurrence of this gene in older dogs was higher than in the younger animals, i.e. 48.6% vs. 7.7%. Other authors have observed higher values. Andrzejewska et al. [29] researched a group of dogs and found that the percentage of animals with cdtB was as high as 72.7% or even 100% [30], whereas Findik et al. [31] noted 97.1%. The role of the cdtA and cdtC subunits should not be neglected either, because they may transport the cdtB subunit into the target cell (Krutkiewicz et al.) [19].

The pathogenesis of campylobacteriosis may be directly related with factors such as: motility, chemotaxis (mutants without these features do not colonise intestinal epithelial cells) as well as adhesion and invasiveness. Many genes and the effects of their expression are thought to be responsible for pathogenicity, e.g. fla – the motility gene, cadF – the adhesion gene and iam – the invasiveness gene [30, 32]. Our study showed a high percentage of the cadF, flaA genes and iam sequence in both groups of dogs. Rodrigues et al. [33] observed a high incidence of the cadF and flaA genes in dogs and noted that these genes may act as reporters in research on the mechanisms of C. jejuni pathogenicity.

The progressive increase in bacterial resistance is closely correlated with the misuse of chemotherapeutics. Apart from that, as a result of the widespread application of antibiotics to animals, often without medical indications, bacteria become selected towards antibiotic resistance. In consequence, they develop multi-drug resistance [34]. Campylobacter spp. strains isolated from animals and food exhibited the highest resistance to ciprofloxacin and tetracycline [8]. The main problem with Campylobacter spp. is the resistance of these bacteria to aminoglycosides (gentamicin), macrolides (erythromycin) and quinolones (ciprofloxacin), which are commonly used to treat campylobacteriosis [4]. Research conducted in Poland between 2003 and 2006 showed that all strains isolated from humans were sensitive to erythromycin. On the other hand, the percentage of clinical strains of Campylobacter jejuni which were resistant to ciprofloxacin was very high, i.e. 58% [35]. Research conducted in the US showed that 99.5% of Campylobacter spp. strains isolated from poultry were resistant to one or more antibiotics. 99.5% of C. jejuni strains and 96.3% of C. coli strains were resistant to tetracycline. Research conducted in Slovenia also showed a high percentage of C. jejuni isolates resistant to enrofloxacin (58.2%). The strains were less resistant to erythromycin (14.5%) and tetracycline (12.7%) [36]. These results are in line with our research findings. Maćkiw et al. [37] observed the highest resistance to ciprofloxacin (97.9%), and lower resistance to tetracycline (64.3%) and erythromycin (9.1%). The authors noted that 7% of 143 resistant isolates exhibited resistance to 3 unrelated antibiotics. Research conducted on dogs in India [36] revealed that all the isolates were resistant to tetracycline (100%), and most of them were resistant to ciprofloxacin and enrofloxacin (97.3%). The values recorded by these authors were higher than the values noted in our study.

5 Conclusions

To sum up, the dogs were identified as asymptomatic carriers of Campylobacter spp. and were found to be vectors carrying and transmitting Campylobacter infections to humans. It is necessary to conduct further research on these bacteria as risk factors to better understand the epidemiology of Campylobacter spp. and to emphasise the dangers of the unreasonable use of antibiotics in both human and animal therapy.

  1. Conflict of interest: Authors state no conflict of interest.

Reference

[1] Selwet M, Galbas M. Monitoring of selected genes in Campylobacter jejuni and Campylobacter coli isolates from domestic animals. B Vet I Pulawy. 2012;56:507-511. http://doi:10.2478/v10213-012-0089-y10.2478/v10213-012-0051-zSuche in Google Scholar

[2] Wieczorek K, Osek J. 2017. Antimicrobial resistance of Campylobacter and Salmonella strains isolated in the European Union Member States in 2015. Życie Weterynaryjne. 2017;92:373-375.Suche in Google Scholar

[3] Szosland-Fałtyn A, Bartodziejska B, Laskarys J, Chmiela M. Campylobacter infections, a significant hygienic epidemiological issue of twenty first century. Postepy Hig Med Dosw (online). 2018;72:678-685.10.5604/01.3001.0012.2056Suche in Google Scholar

[4] Iannino F, Di Donato G, Ruggieri E, Salucci S, De Massis F, Di Giannatale E. Campylobacter infections, a significant issue of veterinary urban hygiene: dogrelated risk factors. Vet Ital. 2017 ;53:11-120. http://doi:10.12834/VetIt.904.4615.2Suche in Google Scholar

[5] Pölzer T, Stüger HP, Lassing H. Prevalence of most common human pathogenic Campylobacter spp. in dogs and cats in Styria, Austria. Vet Med Sci. 2018;4:115-125. http://doi:10.1002/vms3.9310.1002/vms3.93Suche in Google Scholar PubMed PubMed Central

[6] Vellinga A, van Loock F. The dioxin crisis as experiment to determine poultry-related Campylobacter enteritis Emerg Infect Dis. 2002;8:19–22. http://doi:10.3201/eid0801.01012910.3201/eid0801.010129Suche in Google Scholar PubMed PubMed Central

[7] Moore JE, Corcoran D, Dooley JS, Fanning S, Lucey B, Matsuda M, McDowell DA, Mégraud F, Millar BC, O’Mahony R, O’Riordan L, O’Rourke M, Rao JR, Rooney PJ, Sails A, Whyte P. 2005. Campylobacter Vet Res. 2005;36:351-382. HTTP://doi:10.1051/vetres:200501210.1051/vetres:2005012Suche in Google Scholar

[8] EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control), 2018. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2017. EFSA Journal 2018;15(12):5077, 228 pp. https://doi.org/10.2903/j.efsa.2017.507710.2903/j.efsa.2017.5077Suche in Google Scholar PubMed PubMed Central

[9] Dalhoff A. Global Fluoroquinolone Resistance Epidemiology and Implictions for Clinical Use. Interdiscip Perspect Infect Dis. 2012 Article ID 976273, 37 pages. http://doi:org/10.1155/2012/97627310.1155/2012/976273Suche in Google Scholar PubMed PubMed Central

[10] Di Giannatale E, Di Serafino G, Zilli K, Alessiani A, Sacchini L, Garofolo G, Aprea G, Marotta F. 2014. Characterization of Antimicrobial Resistance Patterns and Detection of Virulence Genes in Campylobacter Isolates in Italy. Sensors. 2014;14:3308–3322. http://doi:10.3390/s14020330810.3390/s140203308Suche in Google Scholar PubMed PubMed Central

[11] Mahdavi J, Pirinccioglu N, Oldfield NJ, Carlsohn E, Stoof J, Aslam A, Self T, Cawthraw SA, Petrovska L, Colborne N, Sihlbom C, Borén T, Wooldridge KG, Ala’Aldeen DAA. A novel O-linked glycan modulates Campylobacter jejuni major outer membrane protein-mediated adhesion to human histo-blood group antigens and chicken colonization. Open Biol. 2016;4:130202. http://doi:10.1098/rsob.13020210.1098/rsob.130202Suche in Google Scholar PubMed PubMed Central

[12] Lara-Tejero M, Galan JE. CdtA, CdtB, and CdtC form a tripartite complex that is required for cytolethal distending toxin activity. Infect Immun. 2001;69:4358–4365. http://doi:10.1128/IAI.69.7.4358-4365.200110.1128/IAI.69.7.4358-4365.2001Suche in Google Scholar PubMed PubMed Central

[13] Ge Z, Schauer DB, Fox JG. In vivo virulence properties of bacterial cytolethal distending toxin. Cell Microbiol. 2008;10:1599–1607. http://doi:10.1111/j.1462-5822.2008.01173.x10.1111/j.1462-5822.2008.01173.xSuche in Google Scholar PubMed

[14] Carvalho AF, Silva DM, Azevedo SS, Piatti RM, Genovez ME, Scarcelli E. 2010. Detecção dos genes da toxina citoletal distensiva em estirpes de Campylobacter jejuni isoladas de carcaças de frangos. Arq Bras Med Vet Zoo. 2010;62:1054-1061. http://doi:org/10.1590/S0102-0935201000050000610.1590/S0102-09352010000500006Suche in Google Scholar

[15] Konkel M, Gray SA, Kim BJ, Gravis SG, Yoon J. Identification of enteropathogens Campylobacter jejuni and Campylobacter coli based on the cadF virulence gene and its product. J Clin Microbiol. 1999;37:510-517.10.1128/JCM.37.3.510-517.1999Suche in Google Scholar PubMed PubMed Central

[16] Nachamkin I, Bohachic K, Patton CM. Flagellin gene typing of Campylobacter jejuni by restriction fragment length polymorphism analysis. J Clin Microbiol. 1993;31:1531-1536.10.1128/jcm.31.6.1531-1536.1993Suche in Google Scholar PubMed PubMed Central

[17] Carvalho AC, Ruiz-Palacios GM, Ramos-Cervantes P, Cervantes LE, Jiang X, Pickering LK. 2001. Molecular characterization of invasive and noninvasive Campylobacter jejuni and Campylobacter coli isolates. J Clin Microbiol. 2001;39:1353-1359. http://doi:10.1128/JCM.39.4.1353-1359.200110.1128/JCM.39.4.1353-1359.2001Suche in Google Scholar PubMed PubMed Central

[18] EUCAST. Disk Diffusion Method for Antimicrobial Susceptibility Testing. 2018 www.eucast.orgSuche in Google Scholar

[19] Krutkiewicz A. Campylobacteriosis in humans and animals. Życie Weterynaryjne. 2008;83:285-288.Suche in Google Scholar

[20] Selwet M, Cłapa T, Galbas M, Słomski R, Porzucek F. 2015. The prevalence of Campylobacter spp. and occurence of virulence genes isolated from dogs. Pol J Microbiol. 2015;64:73-76.10.33073/pjm-2015-011Suche in Google Scholar

[21] Olkkola S, Kovanen S, Roine J, Hänninen ML, Hielm-Björkman A, Kivistö R. Population genetics and antimicrobial susceptibility of canine Campylobacter isolates collected before and after a raw feeding experiment. PLoS ONE. 2015;10, E132660.10.1371/journal.pone.0132660Suche in Google Scholar PubMed PubMed Central

[22] Chaban B, Ngeleka M, Hill JE. Detection and quantification of 14 Campylobacter species in pet dogs reveals an increase in species richness in feces of diarrheic animals. BMC Microbiol. 2010;10:73. http://doi:10.1186/1471-2180-10-7310.1186/1471-2180-10-73Suche in Google Scholar PubMed PubMed Central

[23] Acke E, McGill K, Golden O, Jones BR, Fanning S, Whyte P. Prevalence of thermophilic Campylobacter species in household cats and dogs in Ireland. Vet Rec. 2009;164,:44–47.10.1136/vr.164.2.44Suche in Google Scholar PubMed

[24] Holmberg M, Rosendal T, Engvall EO, Ohlsen A, Lindberg A. 2015. Prevalence of thermophilic Campylobacter species in Swedish dogs and characterization of C. jejuni Acta Vet Scan. 2015;57: 19.10.1186/s13028-015-0108-0Suche in Google Scholar PubMed PubMed Central

[25] Hald B, Pedersen K, Waino M, Jorgensen JC, Madsen M. Longitudinal study of the excretion patterns of Thermophilic Campylobacter spp. in young pet dogs in Denmark. J Clin Microbiol. 2004;42:2003–2012.10.1128/JCM.42.5.2003-2012.2004Suche in Google Scholar PubMed PubMed Central

[26] Kobierecka P, Wyszyńska A, Jagusztyn-Krynicka EK. Characterization of CDT (cytolethal distending toxin) genotoxins. Postep Mikrobiol. 2013;52:315–324.Suche in Google Scholar

[27] Lindmark B, Rompikuntal PK, Vaitkevicius K, Song T, Mizunoe Y, Uhlin BE, Guerry P, Wai SN. Outer membrane vesicle-mediated release of cytolethal distending toxin (CDT) from Campylobacter jejuni BMC Microbiol. 2009;9:220.10.1186/1471-2180-9-220Suche in Google Scholar PubMed PubMed Central

[28] Hyun-Ho Ch, Sang-Hyun K, Wongi M, Bok-Kyung K, Yong-Hwan K. Prevalence of virulence and cytolethal distending toxin (CDT) genes in thermophilic Campylobacter spp. from dogs and humans in Gyeongnam and Busan, Korea. Korean J Vet Res. 2014;54:39-48. http://dx.doi.org/10.14405/kjvr.2014.54.1.3910.14405/kjvr.2014.54.1.39Suche in Google Scholar

[29] Andrzejewska M, Szczepańska B, Klawe JJ, Śpica D, Chudzińska M. Prevalence of Campylobacter jejuni and Campylobacter coli species in cats and dogs from Bydgoszcz (Poland) region. Pol J Vet Sci. 2013;16:115–120. http://doi:10.2478/pjvs-2013-001610.2478/pjvs-2013-0016Suche in Google Scholar PubMed

[30] Andrzejewska M, Klawe JJ, Szczepańska B, Śpica D. Occurrence of virulence genes among Campylobacter jejuni and Campylobacter coli isolates from domestic animals and children. Pol J Vet Sci. 2011;14:207-211. http://doi:10.2478/v10181-011-0031-x10.2478/v10181-011-0031-xSuche in Google Scholar PubMed

[31] Findik A, Ica T, Onuk EE, Percin D, Kevenk TO, Ciftci A. Molecular typing and cdt genes prevalence of Campylobacter jejuni isolates from various sources. Trop Anim Health Pro. 2011;43:711–719. http://doi:10.1007/s11250-010-9758-010.1007/s11250-010-9758-0Suche in Google Scholar PubMed

[32] Rizal A, Kumar A, Vidyarthi AS. Prevalence of pathogenic genes in Campylobacter jejuni isolated from poultry and human. Int J Food Saf. 2010;12,:29-34.Suche in Google Scholar

[33] Rodrigues CG, Melo RT, Fonseca BB, Martins PA, Ferreira FA, Araújo MBJ, Rossi DA. 2015. Occurrence and characterization of Campylobacter spp. isolates in dogs, cats and children. Pesqui Vet Brasil. 2015;35:365-370. http://dio:10.1590/S0100-736X201500040000910.1590/S0100-736X2015000400009Suche in Google Scholar

[34] Prządka P, Osiński B. Antibiotic perioperative treatment in prevention of surgical sites bacterial infections in dogs and cats. Życie Weterynaryjne. 2013;88:628-632.Suche in Google Scholar

[35] Wardak S, Szych J, Zasada AA, Gierczyński R. Antibiotic resistance of Campylobacter jejuni and Campylobacter coli clinical isolates from Poland. Antimicrob agents chemother. 2007;3:1123-5. http://doi:10.1128/AAC.01187-06 PMID:1721077610.1128/AAC.01187-06Suche in Google Scholar PubMed PubMed Central

[36] Goni MD, Muhammad IJ, Goje M, Abatcha MG, Bitrus AA, Abbas MA. Campylobacter in Dogs and Cats; Its detection and Public Health Significance. Adv Anim Vet Sci. 2017;5:239-248. http://dx.doi.org/10.17582/journal.aavs/2017/5.6.239.248Suche in Google Scholar

[37] Maćkiw E, Korsak D, Rzewuska K, Tomczuk K, Rożynek E. Antibiotic resistance in Campylobacterjejuni and Campylo-bactercoli isolated from food in Poland. Food Control. 2012;23:297-301.10.1016/j.foodcont.2011.08.022Suche in Google Scholar

Received: 2019-09-16
Accepted: 2019-12-16
Published Online: 2019-12-31

© 2019 Marek Selwet published by De Gruyter

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Artikel in diesem Heft

  1. Plant Sciences
  2. Extended low temperature and cryostorage longevity of Salix seeds with desiccation control
  3. Genome-wide analysis of the WRKY gene family and its response to abiotic stress in buckwheat (Fagopyrum tataricum)
  4. Differential expression of microRNAs during root formation in Taxus chinensis var. mairei cultivars
  5. Metabolomics Approach for The Analysis of Resistance of Four Tomato Genotypes (Solanum lycopersicum L.) to Root-Knot Nematodes (Meloidogyne incognita)
  6. Beneficial Effects of Salt on Halophyte Growth: Morphology, Cells, and Genes
  7. Phosphate-solubilizing bacteria from safflower rhizosphere and their effect on seedling growth
  8. Anatomy and Histochemistry of the Roots and Shoots in the Aquatic Selenium Hyperaccumulator Cardamine hupingshanensis (Brassicaceae)
  9. Effects of LED light on Acacia melanoxylon bud proliferation in vitro and root growth ex vitro
  10. Ecology and Environmental Sciences
  11. Intensity of stripping and sugar content in the bark and the bast of European beech (Fagus sylvatica)
  12. Influence of monometallic and bimetallic phytonanoparticles on physiological status of mezquite
  13. Loci identification of a N-acyl homoserine lactone type quorum sensing system and a new LysR-type transcriptional regulator associated with antimicrobial activity and swarming in Burkholderia gladioli UAPS07070
  14. Bacillus methylotrophicus has potential applications against Monilinia fructicola
  15. Evaluation of Heavy Metals and Microbiological Contamination of Selected herbals from Palestine
  16. The effect of size of black cherry stumps on the composition of fungal communities colonising stumps
  17. Effect of rhamnolipids on microbial biomass content and biochemical parameters in soil contaminated with coal tar creosote
  18. Effects of foliar trichomes on the accumulation of atmospheric particulates in Tillandsia brachycaulos
  19. Isolation and characterisation of the agarolytic bacterium Pseudoalteromonas ruthenica
  20. Comparison of soil bioconditioners and standard fertilization in terms of the impact on yield and vitality of Lolium perenne and soil biological properties
  21. Biomedical Sciences
  22. The number of regulatory B cells is increased in mice with collagen-induced arthritis
  23. Lactate overload inhibits myogenic activity in C2C12 myotubes
  24. Diagnostic performance of serum CK-MB, TNF-α and hs-CRP in children with viral myocarditis
  25. Correlation between PPARGC1A gene rs8192678 G>A polymorphism and susceptibility to type-2 diabetes
  26. Improving the Detection of Hepatocellular Carcinoma using serum AFP expression in combination with GPC3 and micro-RNA miR-122 expression
  27. The ratio of neutrophil to lymphocyte is a predictor in endometrial cancer
  28. Expression of HER2/c-erbB-2, EGFR protein in gastric carcinoma and its clinical significance
  29. Clinical significance of neuropeptide Y expression in pelvic tissue in patients with pelvic floor dysfunction
  30. Overexpression of RASAL1 indicates poor prognosis and promotes invasion of ovarian cancer
  31. The effect of adrenaline on the mineral and trace element status in rats
  32. Effects of Ischemic Post-Conditioning on the Expressions of LC3-II and Beclin-1 in the Hippocampus of Rats after Cerebral Ischemia and Reperfusion
  33. Long non-coding RNA DUXAP8 regulates the cell proliferation and invasion of non-small-cell lung cancer
  34. Risk factors of regional lymph node metastasis in patients with cervical cancer
  35. Bullous prurigo pigmentosa
  36. Association of HIF-1α and NDRG2 expression with EMT in gastric cancer tissues
  37. Decrease in the level of nervonic acid and increased gamma linolenic acid in the plasma of women with polycystic ovary syndrome after a three-month low-glycaemic index and caloric reduction diet
  38. Depletion of VAX2 restrains the malignant progression of papillary thyroid carcinoma by modulating ERK signaling pathway
  39. Insulin resistance is a risk factor for mild cognitive impairment in elderly adults with T2DM
  40. Nurr1 promotes lung cancer apoptosis via enhancing mitochondrial stress and p53-Drp1 pathway
  41. Predictive significance of serum MMP-9 in papillary thyroid carcinoma
  42. Agmatine prevents oxidative-nitrative stress in blood leukocytes under streptozotocin-induced diabetes mellitus
  43. Effect of platelet-rich plasma on implant bone defects in rabbits through the FAK/PI3K/AKT signaling pathway
  44. The diagnostic efficacy of thrombelastography (TEG) in patients with preeclampsia and its association with blood coagulation
  45. Value of NSE and S100 Protein of Kawasaki Disease with aseptic meningitis in Infant
  46. CB2 receptor agonist JWH133 activates AMPK to inhibit growth of C6 glioma cells
  47. The effects of various mouthwashes on osteoblast precursor cells
  48. Co-downregulation of GRP78 and GRP94 induces apoptosis and inhibits migration in prostate cancer cells
  49. SKA3 up-regulation promotes lung adenocarcinoma growth and is a predictor of poor prognosis
  50. Protective effects and mechanisms of microRNA-182 on oxidative stress in RHiN
  51. A case of syphilis with high bone arsenic concentration from early modern cemetery (Wroclaw, Poland)
  52. Study of LBHD1 Expression with Invasion and Migration of Bladder Cancer
  53. 1-Hydroxy-8-methoxy-anthraquinon reverses cisplatin resistance by inhibiting 6PGD in cancer cells
  54. Andrographolide as a therapeutic agent against breast and ovarian cancers
  55. Accumulation of α-2,6-sialyoglycoproteins in the muscle sarcoplasm due to Trichinella sp. invasion
  56. Astragalus polysaccharides protects thapsigargin-induced endoplasmic reticulum stress in HT29 cells
  57. IGF-1 via PI3K/Akt/S6K signaling pathway protects DRG neurons with high glucose-induced toxicity
  58. Intra-arterial tirofiban in a male nonagenarian with acute ischemic stroke: A case report
  59. Effects of Huaiqihuang Granules adjuvant therapy in children with primary nephrotic syndrome
  60. Immune negative regulator TIPE2 inhibits cervical squamous cancer progression through Erk1/2 signaling
  61. Asymptomatic mediastinal extra-adrenal paraganglioma as a cause of sudden death: a case Report
  62. Primary mucinous adenocarcinoma of appendix invading urinary bladder with a fistula: a case report
  63. Minocycline attenuates experimental subarachnoid hemorrhage in rats
  64. Neural Remodeling of the Left Atrium in rats by Rosuvastatin following Acute Myocardial Infarction
  65. Protective effects of emodin on lung injuries in rat models of liver fibrosis
  66. RHOA and mDia1 promotes apoptosis of breast cancer cells via a high dose of doxorubicin treatment
  67. Bacteria co-colonizing with Clostridioides difficile in two asymptomatic patients
  68. A allele of ICAM-1 rs5498 and VCAM-1 rs3181092 is correlated with increased risk for periodontal disease
  69. Treatment of hepatic cystic echinococcosis patients with clear cell renal carcinoma: a case report
  70. Edaravone exerts brain protective function by reducing the expression of AQP4, APP and Aβ proteins
  71. Correlation between neutrophil count and prognosis in STEMI patients with chronic renal dysfunction: a retrospective cohort study
  72. Bioinformatic analysis reveals GSG2 as a potential target for breast cancer therapy
  73. Nuciferine prevents hepatic steatosis by regulating lipid metabolismin diabetic rat model
  74. Analysis of SEC24D gene in breast cancer based on UALCAN database
  75. Bioengineering and Biotechnology
  76. Co-cultured Bone-marrow Derived and Tendon Stem Cells: Novel Seed Cells for Bone Regeneration
  77. Animal Sciences
  78. Comparative analysis of gut microbiota among the male, female and pregnant giant pandas (Ailuropoda Melanoleuca)
  79. Adaptive immunity and skin wound healing in amphibian adults
  80. Hox genes polymorphism depicts developmental disruption of common sole eggs
  81. The prevalence of virulence genes and multidrug resistance in thermophilic Campylobacter spp. isolated from dogs
  82. Agriculture
  83. Effect of Lactobacillus plantarum supplementation on production performance and fecal microbial composition in laying hens
  84. Identification of Leaf Rust Resistance Genes in Selected Wheat Cultivars and Development of Multiplex PCR
  85. Determining Potential Feed Value and Silage Quality of Guar Bean (Cyamopsis tetragonoloba) Silages
  86. Food Science
  87. Effect of Thermal Processing on Antioxidant Activity and Cytotoxicity of Waste Potato Juice
Heruntergeladen am 9.9.2025 von https://www.degruyterbrill.com/document/doi/10.1515/biol-2019-0077/html
Button zum nach oben scrollen