Home Life Sciences The number of regulatory B cells is increased in mice with collagen-induced arthritis
Article Open Access

The number of regulatory B cells is increased in mice with collagen-induced arthritis

  • Li Luo , Qing Liu , Shanshan Peng , Yan Meng , Wenjing Du , Demei Luo , Qian Wang , Jianbing Ding , Xunan Dong EMAIL logo and Xiumin Ma EMAIL logo
Published/Copyright: March 20, 2019

Abstract

The aim of this study is to investigate changes in regulatory B cells (Bregs) and the expression of related cytokines such as interleukin-10 (IL-10) and transforming growth factor (TGF)-β in a mouse model of collagen-induced arthritis (CIA). A total 20 DBA/1 mice (6-8 weeks old) were randomly divided into control and CIA disease groups. For the CIA disease group, animals were injected intradermally with chicken collagen type II and complete Freund's adjuvant. The calculated arthritis index score of the CIA group was significantly higher than that in control group. Hematoxylin and eosin staining showed tumid synovial cells with irregular arrangement and obvious hyperplasia, with a high degree of inflammatory cell infiltration in CIA model group. Cytometric bead array technology and quantitative RT-PCR indicated that the levels of IL-10 and TGF-β in serum, and synovial cells were significantly increased in the CIA group. The proportion of Bregs in the spleen of the CIA group was significantly increased compared to the control group. In conclusion, our findings demonstrate that the number of Bregs and the expression of TGF-β and IL-10 are enhanced in mice with CIA.

1 Introduction

Rheumatoid arthritis (RA) is a common autoimmune disease, which involves multiple organs but is most commonly manifest by joint inflammation [1]. RA tends to occur in women, and the incidence of RA peaks at 45 to 50 years old [2]. The disease is characterized by repeated episodes and high morbidity, and it is difficult to be cured [3]. Without proper treatment, joints in patients with RA can become deformed and even lose function [1, 2]. The pathogenesis of RA is complicated. B cells are among the most important cells in humoral regulation, and can influence the reaction of CD4 T cells, and function as antigen presenting cells, secreting an abundance of cytokines such as interleukin (IL)-4, IL-6, IL-10 and transforming growth factor (TGF)-β, etc. [4]. TNF-α induces apoptosis and necrosis [5]. In addition to the above listed cytokines, TNF-α is a significant contributor to the development of rheumatoid arthritis. Consequently, there are therapies that block TNF-α activity [6]. For a long time, researchers believed that B cells participated in immune regulation mainly by stimulating antibody secretion by downstream cells. However, special B cell subsets also have the function of regulating immune responses. B cells that exert a protective effect and inhibit immune responses are named regulatory B cells (Bregs). Bregs are a new kind of immune regulatory cell that have been discovered in recent years, and their role in autoimmune diseases has become intensively investigated [3, 7, 8, 9, 10]. It has been shown that Bregs can regulate or inhibit the effect of T cells, and that their dysfunction may cause autoimmune disease [11, 12]. Bregs promote immune tolerance and inhibit inflammation through a receptor mediated process [13]. Mizoguchi et al. report a subgroup of Bregs displaying a CD1d+CD5+CD19+ phenotype that produces IL–10, and is named B10. IL-10 is also understood to be important in maintaining Tregs in the body [14, 15]. Bregs are thought to maintain the balance of pro-inflammatory and antiinflammatory suppression, as well as regulate homeostasis via high expression of TGF-β and low expression of IL-6 [16, 17, 18]. Collagen-induced arthritis (CIA) produces a similar set of clinical symptoms and pathological features as RA, and the animal model of CIA is now the most commonly used model to study RA [19, 20, 21, 22]. In the present study, we explore the correlation between Bregs and RA immune inflammation, and examine the immune regulation and function mechanism of Bregs in RA.

2 Materials and methods

2.1 Animals

A total of 20 male DBA/1 mice (6-8 weeks old, 18-22 g weight) were bought from Beijing Weitong Lihua Experimental Animal Technical Co., Ltd. (Beijing, China), and housed in an environmentally controlled room with constant temperature and a 12-hour light/dark cycle. Mice were acclimated for fifteen days prior to experiment initiation. The mice were numbered, and randomly and evenly divided into experimental (CIA disease group) and control groups. Chicken CII (100 μg/mouse; Chondrex, Redmond, WA, USA) was emulsified in equal volumes of complete Freund’s adjuvant (Chondrex, Redmond, WA, USA) on ice to obtain 2 mg/ml solution. Each mouse in the CIA group was injected intradermally at the base of the tail with 100 μl of solution, while animals in control group received an equal volume of physiological saline. Immunization was repeated 21 days after the first injection. Arthritis development was monitored and scored in a blinded manner every second or third day.

The mice were sacrificed by cervical dislocation on day 42. Spleen and joint synovial tissues were snap frozen in liquid nitrogen and stored at -80°C. Joints were fixed in 4% paraformaldehyde for 24 hours, and transferred to decalcification buffer, and stored 4°C. Decalcification buffer was replaced every other day, for 7 to 10 days, until the bone was soft. The decalcified specimens were washed with phosphate-buffered saline, and dehydrated for paraffin-embedding. Then, 4-μm sections were prepared for histological examination.

Ethical approval The research related to animals use has been complied with all the relevant national regulations and institutional policies for the care and use of animals.

2.2 Evaluation of arthritis

According to the degree of joint swelling, mice in treatment groups were assessed every second or third day in a blinded manner. Standards were defined as follows: 0 points, normal joint without swelling or erythema; 1 point, slight swelling or redness; 2 points, moderate swelling at ankle or wrist joints; 3 points, severe erythema and swelling affecting the entire paw; 4 points, deformed paw or joint with ankylosis. The total scores for the four limbs ranged from 0 to 16 points.

2.3 Hematoxylin and eosin (HE) staining

Synovial tissues were collected from mice for HE staining. Synovial tissues were observed to determine whether inflammatory cell infiltration existed, whether synovial tissues were deformed, and whether articular cartilage was damaged.

2.4 Cytometric beads array (CBA) technology

The level of IL-10 expression in the serum of mice was tested by CBA technology. The results were analyzed by flow cytometry (BD Biosciences, Franklin Lakes, NJ, USA). Corresponding standard curve was plotted, and then the data were read according to the standard curve to calculate the level of IL-10.

2.5 Quantitative real-time polymerase chain reaction (qRT-PCR)

Before total RNA extraction, tissues (100 mg) were ground into powder using liquid nitrogen before addition of 1 ml Trizol (Thermo Fisher Scientific, Waltham, MA, USA) for lysis. After lysis, total RNA was extracted using the phenol chloroform method. The purity of RNA was determined by A260/A280 using ultraviolet spectrophotometry (Nanodrop ND1000, Thermo Scientific, Waltham, MA, USA). Then, cDNA was obtained by reverse transcription using PrimeScript RT Reagent Kit (Takara, Dalian, China) from 1 μg RNA and stored at -20°C. To measure TGF-β and IL-10 expression in tissues, SYBR Green qRT-PCR kit (Takara, Dalian, China) was employed. The full genetic sequences of TGF-β and IL-10 were acquired from GeneBank, and GAPDH was used as internal reference (Table 1).

Table 1

Primers and fragment lengths

GenesGenbank accession No.PrimersFragment length (bp)
TGF-βM13177.1Forward: 5’GAGTTCACATGCGCCTTGAT3’199
Reverse: 5’TCGCTTTGTACAACAGCACC3’
IL-10NM_010548.2Forward: 5’TGCTATGCTGCCTGCTCTTA3’243
Reverse: 5’TCATTTCCGATAAGGCTTGG3’
GAPDHAY618199.1Forward: 5’AACTTTGGCATTGTGGAAGG3’222
Reverse: 5’CACATTGGGGGTAGGAACAC3’

The PCR system (20 μl) included 10 μl 2 × SYBR Green PCR Premix, 0.5 μl upstream primer, 0.5 μl downstream primer, 2 μl cDNA template, and 7 μl ddH2O. PCR conditions were: initial denaturation at 95°C for 3 min; 40 cycles of denaturation at 95°C for 10 s, annealing at 55°C for 30 s and elongation at 72°C for 30 s. Fluorescence signals were determined to plot dissolution curve. Each sample was tested in triplicate.

2.6 Flow cytometry

Flow cytometry was used to determine the number of Bregs in the spleen of mice in CIA group. First, mononuclear cells were isolated from mouse spleen, and fluorescent tags of cell surface-specific antigen CD1d-PE mu (1 μl) antibody, CD5-PECy5 mu (1 μl) antibody, and CD19-FITC mu (1 μl) antibody were added. Then, 500 μl fixation / permeabilization solution was added. Flow cytometry (FACSVerse; BD Biosciences, Franklin Lakes, NJ, USA) was used to detect the number of Bregs after staining. Acquired flow cytometry data were analysed by software (BD Biosciences, Franklin Lakes, NJ, USA).

2.7 Statistical analysis

Results were analyzed using SPSS v17.0 software (IBM, Armonk, NY, USA). All data were expressed as means ± standard deviation. Data were tested for normality. Multigroup measurement data were analyzed using one-way ANOVA. In the case of homogeneity of variance, Least Significant Difference and Student-Newman-Keuls methods were used; in case of heterogeneity of variance, Tamhane’s T2 or Dunnett’s T3 method was used. Group t-test was used for comparative analysis between two groups, and differences were considered statistically significant if P < 0.05.

3 Results

3.1 Arthritis in the CIA group was more severe than that in the control group

To evaluate the severity of disease, arthritis index scores were calculated. Mice in the control group exhibited no joint swelling, while those in CIA group had paw redness and swelling, joint swelling, and restricted movement. In addition, the difference in arthritis scoring between the CIA and control groups was statistically significant (Table 2). This result suggests that arthritis in CIA group was more severe than that in control group.

Table 2

Arthritis index scores

GroupsWeight (g)Swelling (paw)Thickening (paw)Limitation of activityScores
Control group16.3 ± 2.20000
CIA model group15.8 ± 2.43.4 ± 0.6*3.5 ± 0.5*1.9 ± 0.9*11.9 ± 1.9*
  1. Note: *, P < 0.05 compared with control group.

3.2 Mice in the CIA group show increased inflammatory cells in synovial fluid of the joint

To observe synovial inflammatory cells, HE staining was performed. In the control group, synovial fluid contained 1-2 layers of synovial cells that were arranged neatly without hyperplasia, and no inflammatory cell infiltration was observed. In the CIA group, synovial cell edema, 3-5 layers of cells and obvious hyperplasia existed. Additionally, inflammatory cell infiltration and new blood vessels were observed (Figure 1). These results indicate that mice in CIA group have a large amount of inflammatory cells in synovial fluid of the joint.

Figure 1 Inflammatory cells in synovial fluid of the joint. Hematoxylin and eosin staining was used to visualize the cells in control and CIA model groups. Magnification, ×400.
Figure 1

Inflammatory cells in synovial fluid of the joint. Hematoxylin and eosin staining was used to visualize the cells in control and CIA model groups. Magnification, ×400.

3.3 Expression of IL-10 and TGF-β in diseased mice is enhanced

To compare the abundance of IL-10 and TGF-β in the serum between the CIA and control groups, CBA technology was used. The data showed that serum levels of IL-10 and TGF-β in the CIA group were significantly higher as compared to the control group (P < 0.05) (Table 3). This result suggests that the expression of IL-10 and TGF-β in the CIA group of mice is enhanced.

Table 3

Expression of IL-10 and TGF-β in serum

GroupsIL-10 (pg/ml)TGF-β (pg/ml)
Control group55.35 ± 6.3422.96 ± 5.31
CIA model group90.01 ± 9.61*62.95 ± 11.21*
  1. Note: *, P < 0.05 compare with control group.

3.4 High expression of IL-10 and TGF-β mRNA exists in the synovial membrane of mice with CIA

To detect the expression of IL-10 and TGF-β mRNA, qRT-PCR was carried out. The mRNA levels of IL-10 and TGF-β in synovial tissue from mice in the control group were 0.99 ± 0.52 and 1.45 ± 0.53, respectively, while those in synovial tissue of mice in the CIA group were 2.43 ± 0.62 and 2.39 ± 0.64, respectively. Differences between the two groups were statistically significant (Figure 1Figure 2). These result suggest that high expression of IL-10 and TGF-β mRNA exists in the synovial membrane of mice with CIA.

3.5 The frequency of Bregs in the spleens of mice with CIA is elevated

To determine the number of Bregs in the spleen, flow cytometry was employed. As the phenotype of Breg cells in mice was CD1dhighCD5 + CD19high, the proportion of Bregs in the spleen from the control group was 2.98 ± 0.93%, while that in CIA model group was 8.88 ± 2.17%. The difference was statistically significant (P < 0.05) (Figure 3). This result indicates that the number of Bregs in the spleens of mice with CIA is elevated.

Figure 2 Relative expression of IL-10 and TGF-β mRNA in synovial membrane of CIA model mice. Quantitative real-time polymerase chain reaction was used to measure mRNA expression. ***, P < 0.05 compared with control.
Figure 2

Relative expression of IL-10 and TGF-β mRNA in synovial membrane of CIA model mice. Quantitative real-time polymerase chain reaction was used to measure mRNA expression. ***, P < 0.05 compared with control.

Figure 3 The percentage of Bregs in mouse spleen of control and CIA groups. Flow cytometry was employed to measure the number of Bregs in the spleens of mice in control and CIA model groups. Mononuclear cells were isolated from mouse spleen, and fluorescent tags of cell surface-specific antigen CD1d-PE mu (1 μl) antibody, CD5-PECy5 mu (1 μl) antibody, and CD19-FITC mu (1 μl) antibody were added. Then, 500 μl fixation / permeabilization solution was added.
Figure 3

The percentage of Bregs in mouse spleen of control and CIA groups. Flow cytometry was employed to measure the number of Bregs in the spleens of mice in control and CIA model groups. Mononuclear cells were isolated from mouse spleen, and fluorescent tags of cell surface-specific antigen CD1d-PE mu (1 μl) antibody, CD5-PECy5 mu (1 μl) antibody, and CD19-FITC mu (1 μl) antibody were added. Then, 500 μl fixation / permeabilization solution was added.

4 Discussion and Conclusions

RA is a complicated autoimmune disease with relatively high morbidity, causing a heavy burden to families and the society. RA is characterized by elevated expression of auto-antibodies such as rheumatoid factor and ring citrulline peptide antibodies [23]. Numerous studies have demonstrated that both cellular immunity and humoral immunity play important roles in the development of RA [24, 25]. It has been shown that the role of T cells and their cytokines play vital roles in RA pathogenesis [26, 27]. It is believed that B cells are involved in the immune response through production of antibodies and a variety of cytokines such as IFN-gamma, TNF-alpha, IL-4, and IL-13. In addition, B cells also play an important role in humoral immune system. Bregs are a newly discovered type of cell [28, 29], and are thought to influence the disease immune response and inflammatory reactions [30, 31, 32] by playing a suppressive role in the body’s immune response. Bregs promote immunosuppression mainly through the secretion of IL-10 and TGF-β [33, 34] by inhibiting or reducing the activation of T cells, and enhancing the production of related cytokines. This suggests that Bregs can reduce pathogen elimination capacity and increase immunologic tolerance. Bregs alleviate severe autoimmune diseases, including contact hypersensitivity, experimental autoimmune encephalomyelitis (EAE), chronic enteritis and collagen-induced arthritis [35,36]. The influence of Bregs on the secretion of IL-10 is found in models of contact dermatitis and EAE Bregs. A subset of B cells, known as B10, arise in the spleen and other lymphoid tissues, and are marked as CD1dhiCD5+CD19hi. The development of Bregs influences disease through secreting IL-10 to regulate T cell differentiation. Mice with defective Bregs secret less IL-10, which leads to elevated Th1 responses [37, 38].

By detecting Bregs and specific cytokines in a mouse model of CIA, the present study shows the dynamic trends of Bregs in the process of RA pathogenesis. The CIA group showed a large number of infiltrated inflammatory cells found in affected joints, as well as new blood vessel formation. Concordantly, the mRNA expression of TGF-β and IL-10 in the synovial membrane of CIA mice was significantly increased. In addition, the frequency of Bregs in splenic lymphocytes was increased in CIA mice. The presence of TGF-β and IL-10 in the serum was also markedly elevated in CIA mice. IL-10 secreted by Bregs is known to reduce cell surface expression of class II major histocompatibility complex molecules [39, 40, 41], and the expression of cytokines such as TNF-alpha [42], reduce effector function in T cells and/or regulatory T cells [43], regulate Th1/Th2 balance that inhibits positive immune response, and dampen inflammatory responses in CIA synovial injury. Meanwhile, excessive expression of IL-10 can also restrain the secretion of IL-12 from macrophages and dendritic cells. Consequently, the proliferation and differentiation of T cells and positive immune responses are inhibited. The present study has also discovered that IL-10 levels in CIA mice is increased significantly, being consistent with the report by Mizoguchi [44]. T cells can be induced to CD4+CD25+Foxp3+ regulatory T cells (iTreg) by TGF-β that is produced by Bregs. In addition, iTreg maintains stability in inflammatory conditions, inhibiting effector T cells through by expression of Foxp3, and also suppresses Th2 and Th17 cells, thereby inhibiting the destructive immune response in joints of CIA mice. In addition, iTreg signaling pathways inhibit osteoclasts by contacting NF-kB cells in a dose-dependent manner, and reduce bone erosion and damage caused by osteoclasts [45]. The present study shows that TGF-β in a CIA mouse model is increased through the induction of iTreg cells which regulate negative immune responses, finally leading to the occurrence of RA. In conclusion, Bregs and the expression of related factors are important in the pathogenesis of CIA. After being activated, Bregs can produce a large amount of TGF-β and IL-10, which can lower specific immune response levels and limit inflammatory reactions.

Acknowledgements

This work was supported by the Scientific Research Project of the Science Department of Xinjiang Uygur Autonomous Region (No. 2015211C042).

  1. Conflict of interest Authors state no conflict of interest.

References

[1] Cope AP. T cells in rheumatoid arthritis. Arthritis research & therapy 2008; 10 Suppl 1: S1.10.1186/ar2412Search in Google Scholar PubMed PubMed Central

[2] Maksymowych WP, van der Heijde D, Allaart CF, Landewe R, Boire G, Tak PP et al. 14-3-3eta is a novel mediator associated with the pathogenesis of rheumatoid arthritis and joint damage. Arthritis research & therapy 2014;16:R99.10.1186/ar4547Search in Google Scholar PubMed PubMed Central

[3] DiLillo DJ, Hamaguchi Y, Ueda Y, Yang K, Uchida J, Haas KM et al. Maintenance of long-lived plasma cells and serological memory despite mature and memory B cell depletion during CD20 immunotherapy in mice. Journal of immunology (Baltimore, Md : 1950) 2008;180:361-371.10.4049/jimmunol.180.1.361Search in Google Scholar PubMed

[4] Yanaba K, Bouaziz JD, Haas KM, Poe JC, Fujimoto M, Tedder TF. A regulatory B cell subset with a unique CD1dhiCD5+ phenotype controls T cell-dependent inflammatory responses. Immunity 2008;28:639-650.10.1016/j.immuni.2008.03.017Search in Google Scholar PubMed

[5] Jurisic V, Srdic-Rajic T, Konjevic G, Bogdanovic G, Colic M. TNF-α induced apoptosis is accompanied with rapid CD30 and slower CD45 shedding from K-562 cells. J Membr Biol 2011;239:115-122.10.1007/s00232-010-9309-7Search in Google Scholar PubMed

[6] Cuchacovich M, Bueno D, Carvajal R, Bravo N, Aguillon JC, Catalan D, Soto L. Clinical parameters and biomarkers for anti-TNF treatment prognosis in rheumatoid arthritis patients, Clin Rheumatol 2014;33:1707-1714.10.1007/s10067-014-2756-2Search in Google Scholar PubMed

[7] Blair PA, Chavez-Rueda KA, Evans JG, Shlomchik MJ, Eddaoudi A, Isenberg DA et al. Selective targeting of B cells with agonistic anti-CD40 is an efficacious strategy for the generation of induced regulatory T2-like B cells and for the suppression of lupus in MRL/lpr mice. Journal of immunology (Baltimore, Md : 1950) 2009;182:3492-3502.10.4049/jimmunol.0803052Search in Google Scholar PubMed PubMed Central

[8] Mauri C, Ehrenstein MR. The ‘short’ history of regulatory B cells. Trends in immunology 2008;29:34-40.10.1016/j.it.2007.10.004Search in Google Scholar PubMed

[9] Yanaba K, Bouaziz JD, Matsushita T, Tsubata T, Tedder TF. The development and function of regulatory B cells expressing IL-10 (B10 cells) requires antigen receptor diversity and TLR signals. Journal of immunology (Baltimore, Md : 1950) 2009;182:7459-7472.10.4049/jimmunol.0900270Search in Google Scholar PubMed PubMed Central

[10] Qian L, Bian GR, Zhou Y, Wang Y, Hu J, Liu X et al. Clinical significance of regulatory B cells in the peripheral blood of patients with oesophageal cancer. Central-European journal of immunology 2015;40:263-265.10.5114/ceji.2015.52840Search in Google Scholar PubMed PubMed Central

[11] Selmi C. Autoimmunity in 2012. Clinical reviews in allergy & immunology 2013;45:290-301.10.1007/s12016-013-8386-7Search in Google Scholar

[12] Walker LS. Treg and CTLA-4: two intertwining pathways to immune tolerance. Journal of autoimmunity 2013;45:49-57.10.1016/j.jaut.2013.06.006Search in Google Scholar

[13] Peterson RA. Regulatory T-cells: diverse phenotypes integral to immune homeostasis and suppression. Toxicologic pathology 2012;40:186-204.10.1177/0192623311430693Search in Google Scholar

[14] Yang M, Rui K, Wang S, Lu L. Regulatory B cells in autoimmune diseases. Cellular & molecular immunology 2013;10:122-132.10.5353/th_b4807983Search in Google Scholar

[15] Mizoguchi A, Bhan AK. A case for regulatory B cells. Journal of immunology (Baltimore, Md : 1950) 2006;176:705-710.10.4049/jimmunol.176.2.705Search in Google Scholar

[16] Wolf SD, Dittel BN, Hardardottir F, Janeway CAJ. Experimental autoimmune encephalomyelitis induction in genetically B cell-deficient mice. . J Exp Med 1996;184:2271-2278.10.1084/jem.184.6.2271Search in Google Scholar

[17] Fillatreau S, Sweenie CH, McGeachy MJ, Gray D, Anderton SM. B cells regulate autoimmunity by provision of IL-10. Nature immunology 2002;3:944-950.10.1038/ni833Search in Google Scholar

[18] Bettelli E, Carrier Y, Gao W, Korn T, Strom TB, Oukka M et al. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 2006;441:235-238.10.1038/nature04753Search in Google Scholar

[19] Tsuji M, Fujii K, Nakano T, Nishii Y. 1 alpha-hydroxyvitamin D3 inhibits type II collagen-induced arthritis in rats. FEBS letters 1994;337:248-250.10.1016/0014-5793(94)80201-7Search in Google Scholar

[20] Tagawa N, Muraoka K, Okamoto Y, Nishida M, Katagiri M, Kobayashi Y. 17alpha-hydroxylase/C17-20 lyase cytochrome P450 mRNA expressions and enzyme activities during the development of arthritis in collagen-induced arthritis mice. Biological & pharmaceutical bulletin 2004;27:1663-1665.10.1248/bpb.27.1663Search in Google Scholar PubMed

[21] Wang H, Xu D, Tao R, Ni X, Shen A, Wang Y. beta1,4-galactosyltransferase-I in synovial tissue of collagen-induced rat model of rheumatoid arthritis. Clinical and experimental medicine 2011;11:147-154.10.1007/s10238-010-0121-6Search in Google Scholar PubMed

[22] Zhang L, Dong Y, Zou F, Wu M, Fan C, Ding Y. 11beta-Hydroxysteroid dehydrogenase 1 inhibition attenuates collagen-induced arthritis. International immunopharmacology 2013;17:489-494.10.1016/j.intimp.2013.07.015Search in Google Scholar PubMed

[23] Luo J, Wen H, Guo H, Cai Q, Li S, Li X. 1,25-dihydroxyvitamin D3 inhibits the RANKL pathway and impacts on the production of pathway-associated cytokines in early rheumatoid arthritis. BioMed research international 2013;2013:101805.10.1155/2013/101805Search in Google Scholar PubMed PubMed Central

[24] Cohen S. 2012 challenges in rheumatoid arthritis care. Rheumatology (Oxford, England) 2012;51 Suppl 6:vi3-4.Search in Google Scholar

[25] Rendas-Baum R, Wallenstein GV, Koncz T, Kosinski M, Yang M, Bradley J et al. Evaluating the efficacy of sequential biologic therapies for rheumatoid arthritis patients with an inadequate response to tumor necrosis factor-alpha inhibitors. Arthritis research & therapy 2011;13:R25.10.1186/ar3249Search in Google Scholar PubMed PubMed Central

[26] Schleinitz N, Vely F, Harle JR, Vivier E. Natural killer cells in human autoimmune diseases. Immunology 2010;131:451-458.10.1111/j.1365-2567.2010.03360.xSearch in Google Scholar PubMed PubMed Central

[27] Zhang J, Zhang Y, Jin J, Li M, Xie K, Wen C et al. The -1082A/G polymorphism in the Interleukin-10 gene and the risk of rheumatoid arthritis: a meta-analysis. Cytokine 2011;56:351-355.10.1016/j.cyto.2011.05.022Search in Google Scholar PubMed

[28] Rosser EC, Mauri C. Regulatory B cells: origin, phenotype, and function. Immunity 2015;42:607-612.10.1016/j.immuni.2015.04.005Search in Google Scholar PubMed

[29] Kinnunen T, Chamberlain N, Morbach H, Choi J, Kim S, Craft J et al. Accumulation of peripheral autoreactive B cells in the absence of functional human regulatory T cells. Blood 2013;121:1595-1603.10.1182/blood-2012-09-457465Search in Google Scholar PubMed PubMed Central

[30] Nouel A, Simon Q, Jamin C, Pers JO, Hillion S. Regulatory B cells: an exciting target for future therapeutics in transplantation. Frontiers in immunology 2014;5:11.10.3389/fimmu.2014.00011Search in Google Scholar PubMed PubMed Central

[31] Watanabe R, Ishiura N, Nakashima H, Kuwano Y, Okochi H, Tamaki K et al. Regulatory B cells (B10 cells) have a suppressive role in murine lupus: CD19 and B10 cell deficiency exacerbates systemic autoimmunity. Journal of immunology (Baltimore, Md : 1950) 2010;184:4801-4809.10.4049/jimmunol.0902385Search in Google Scholar PubMed PubMed Central

[32] Yanaba K, Kamata M, Ishiura N, Shibata S, Asano Y, Tada Y et al. Regulatory B cells suppress imiquimod-induced, psoriasis-like skin inflammation. Journal of leukocyte biology 2013;94:563-573.10.1189/jlb.1112562Search in Google Scholar PubMed PubMed Central

[33] Wu H, Li P, Shao N, Ma J, Ji M, Sun X et al. Aberrant expression of Treg-associated cytokine IL-35 along with IL-10 and TGF-beta in acute myeloid leukemia. Oncology letters 2012;3:1119-1123.10.3892/ol.2012.614Search in Google Scholar PubMed PubMed Central

[34] Lievens D, Habets KL, Robertson AK, Laouar Y, Winkels H, Rademakers T et al. Abrogated transforming growth factor beta receptor II (TGFbetaRII) signalling in dendritic cells promotes immune reactivity of T cells resulting in enhanced atherosclerosis. European heart journal 2013;34:3717-3727.10.1093/eurheartj/ehs106Search in Google Scholar PubMed PubMed Central

[35] Holan V, Zajicova A, Javorkova E, Trosan P, Chudickova M, Pavlikova M et al. Distinct cytokines balance the development of regulatory T cells and interleukin-10-producing regulatory B cells. Immunology 2014;141:577-586.10.1111/imm.12219Search in Google Scholar PubMed PubMed Central

[36] Randall KL, Lambe T, Johnson AL, Treanor B, Kucharska E, Domaschenz H et al. Dock8 mutations cripple B cell immunological synapses, germinal centers and long-lived antibody production. Nature immunology 2009;10:1283-1291.10.1038/ni.1820Search in Google Scholar PubMed PubMed Central

[37] Jin G, Hamaguchi Y, Matsushita T, Hasegawa M, Le Huu D, Ishiura N et al. B-cell linker protein expression contributes to controlling allergic and autoimmune diseases by mediating IL-10 production in regulatory B cells. The Journal of allergy and clinical immunology 2013;131:1674-1682.10.1016/j.jaci.2013.01.044Search in Google Scholar PubMed

[38] Lund FE, Randall TD. Effector and regulatory B cells: modulators of CD4+ T cell immunity. Nature reviews Immunology 2010;10:236-247.10.1038/nri2729Search in Google Scholar PubMed PubMed Central

[39] Crawford A, Macleod M, Schumacher T, Corlett L, Gray D. Primary T cell expansion and differentiation in vivo requires antigen presentation by B cells. Journal of immunology (Baltimore, Md : 1950) 2006;176:3498-3506.10.4049/jimmunol.176.6.3498Search in Google Scholar PubMed

[40] Kalampokis I, Yoshizaki A, Tedder TF. IL-10-producing regulatory B cells (B10 cells) in autoimmune disease. Arthritis research & therapy 2013;15 Suppl 1:S1.10.1186/ar3907Search in Google Scholar PubMed PubMed Central

[41] Matsushita T, Tedder TF. Identifying regulatory B cells (B10 cells) that produce IL-10 in mice. Methods in molecular biology (Clifton, NJ) 2011;677:99-111.10.1007/978-1-60761-869-0_7Search in Google Scholar PubMed

[42] Agbanoma G, Li C, Ennis D, Palfreeman AC, Williams LM, Brennan FM. Production of TNF-alpha in macrophages activated by T cells, compared with lipopolysaccharide, uses distinct IL-10-dependent regulatory mechanism. Journal of immunology (Baltimore, Md : 1950) 2012;188:1307-1317.10.4049/jimmunol.1100625Search in Google Scholar PubMed

[43] Cantaert T, Doorenspleet ME, Francosalinas G, Paramarta JE, Klarenbeek PL, Tiersma Y et al. Increased numbers of CD5+ B lymphocytes with a regulatory phenotype in spondylarthritis. Arthritis and rheumatism 2012;64:1859-1868.10.1002/art.34364Search in Google Scholar PubMed

[44] Maseda D, Candando KM, Smith SH, Kalampokis I, Weaver CT, Plevy SE et al. Peritoneal cavity regulatory B cells (B10 cells) modulate IFN-gamma+CD4+ T cell numbers during colitis development in mice. Journal of immunology (Baltimore, Md : 1950) 2013;191:2780-2795.10.4049/jimmunol.1300649Search in Google Scholar PubMed PubMed Central

[45] Lenert P, Brummel R, Field EH, Ashman RF. TLR-9 activation of marginal zone B cells in lupus mice regulates immunity through increased IL-10 production. Journal of clinical immunology 2005;25:29-40.10.1007/s10875-005-0355-6Search in Google Scholar PubMed

Received: 2018-07-30
Accepted: 2018-11-19
Published Online: 2019-03-20

© 2019 Li Luo et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Articles in the same Issue

  1. Plant Sciences
  2. Extended low temperature and cryostorage longevity of Salix seeds with desiccation control
  3. Genome-wide analysis of the WRKY gene family and its response to abiotic stress in buckwheat (Fagopyrum tataricum)
  4. Differential expression of microRNAs during root formation in Taxus chinensis var. mairei cultivars
  5. Metabolomics Approach for The Analysis of Resistance of Four Tomato Genotypes (Solanum lycopersicum L.) to Root-Knot Nematodes (Meloidogyne incognita)
  6. Beneficial Effects of Salt on Halophyte Growth: Morphology, Cells, and Genes
  7. Phosphate-solubilizing bacteria from safflower rhizosphere and their effect on seedling growth
  8. Anatomy and Histochemistry of the Roots and Shoots in the Aquatic Selenium Hyperaccumulator Cardamine hupingshanensis (Brassicaceae)
  9. Effects of LED light on Acacia melanoxylon bud proliferation in vitro and root growth ex vitro
  10. Ecology and Environmental Sciences
  11. Intensity of stripping and sugar content in the bark and the bast of European beech (Fagus sylvatica)
  12. Influence of monometallic and bimetallic phytonanoparticles on physiological status of mezquite
  13. Loci identification of a N-acyl homoserine lactone type quorum sensing system and a new LysR-type transcriptional regulator associated with antimicrobial activity and swarming in Burkholderia gladioli UAPS07070
  14. Bacillus methylotrophicus has potential applications against Monilinia fructicola
  15. Evaluation of Heavy Metals and Microbiological Contamination of Selected herbals from Palestine
  16. The effect of size of black cherry stumps on the composition of fungal communities colonising stumps
  17. Effect of rhamnolipids on microbial biomass content and biochemical parameters in soil contaminated with coal tar creosote
  18. Effects of foliar trichomes on the accumulation of atmospheric particulates in Tillandsia brachycaulos
  19. Isolation and characterisation of the agarolytic bacterium Pseudoalteromonas ruthenica
  20. Comparison of soil bioconditioners and standard fertilization in terms of the impact on yield and vitality of Lolium perenne and soil biological properties
  21. Biomedical Sciences
  22. The number of regulatory B cells is increased in mice with collagen-induced arthritis
  23. Lactate overload inhibits myogenic activity in C2C12 myotubes
  24. Diagnostic performance of serum CK-MB, TNF-α and hs-CRP in children with viral myocarditis
  25. Correlation between PPARGC1A gene rs8192678 G>A polymorphism and susceptibility to type-2 diabetes
  26. Improving the Detection of Hepatocellular Carcinoma using serum AFP expression in combination with GPC3 and micro-RNA miR-122 expression
  27. The ratio of neutrophil to lymphocyte is a predictor in endometrial cancer
  28. Expression of HER2/c-erbB-2, EGFR protein in gastric carcinoma and its clinical significance
  29. Clinical significance of neuropeptide Y expression in pelvic tissue in patients with pelvic floor dysfunction
  30. Overexpression of RASAL1 indicates poor prognosis and promotes invasion of ovarian cancer
  31. The effect of adrenaline on the mineral and trace element status in rats
  32. Effects of Ischemic Post-Conditioning on the Expressions of LC3-II and Beclin-1 in the Hippocampus of Rats after Cerebral Ischemia and Reperfusion
  33. Long non-coding RNA DUXAP8 regulates the cell proliferation and invasion of non-small-cell lung cancer
  34. Risk factors of regional lymph node metastasis in patients with cervical cancer
  35. Bullous prurigo pigmentosa
  36. Association of HIF-1α and NDRG2 expression with EMT in gastric cancer tissues
  37. Decrease in the level of nervonic acid and increased gamma linolenic acid in the plasma of women with polycystic ovary syndrome after a three-month low-glycaemic index and caloric reduction diet
  38. Depletion of VAX2 restrains the malignant progression of papillary thyroid carcinoma by modulating ERK signaling pathway
  39. Insulin resistance is a risk factor for mild cognitive impairment in elderly adults with T2DM
  40. Nurr1 promotes lung cancer apoptosis via enhancing mitochondrial stress and p53-Drp1 pathway
  41. Predictive significance of serum MMP-9 in papillary thyroid carcinoma
  42. Agmatine prevents oxidative-nitrative stress in blood leukocytes under streptozotocin-induced diabetes mellitus
  43. Effect of platelet-rich plasma on implant bone defects in rabbits through the FAK/PI3K/AKT signaling pathway
  44. The diagnostic efficacy of thrombelastography (TEG) in patients with preeclampsia and its association with blood coagulation
  45. Value of NSE and S100 Protein of Kawasaki Disease with aseptic meningitis in Infant
  46. CB2 receptor agonist JWH133 activates AMPK to inhibit growth of C6 glioma cells
  47. The effects of various mouthwashes on osteoblast precursor cells
  48. Co-downregulation of GRP78 and GRP94 induces apoptosis and inhibits migration in prostate cancer cells
  49. SKA3 up-regulation promotes lung adenocarcinoma growth and is a predictor of poor prognosis
  50. Protective effects and mechanisms of microRNA-182 on oxidative stress in RHiN
  51. A case of syphilis with high bone arsenic concentration from early modern cemetery (Wroclaw, Poland)
  52. Study of LBHD1 Expression with Invasion and Migration of Bladder Cancer
  53. 1-Hydroxy-8-methoxy-anthraquinon reverses cisplatin resistance by inhibiting 6PGD in cancer cells
  54. Andrographolide as a therapeutic agent against breast and ovarian cancers
  55. Accumulation of α-2,6-sialyoglycoproteins in the muscle sarcoplasm due to Trichinella sp. invasion
  56. Astragalus polysaccharides protects thapsigargin-induced endoplasmic reticulum stress in HT29 cells
  57. IGF-1 via PI3K/Akt/S6K signaling pathway protects DRG neurons with high glucose-induced toxicity
  58. Intra-arterial tirofiban in a male nonagenarian with acute ischemic stroke: A case report
  59. Effects of Huaiqihuang Granules adjuvant therapy in children with primary nephrotic syndrome
  60. Immune negative regulator TIPE2 inhibits cervical squamous cancer progression through Erk1/2 signaling
  61. Asymptomatic mediastinal extra-adrenal paraganglioma as a cause of sudden death: a case Report
  62. Primary mucinous adenocarcinoma of appendix invading urinary bladder with a fistula: a case report
  63. Minocycline attenuates experimental subarachnoid hemorrhage in rats
  64. Neural Remodeling of the Left Atrium in rats by Rosuvastatin following Acute Myocardial Infarction
  65. Protective effects of emodin on lung injuries in rat models of liver fibrosis
  66. RHOA and mDia1 promotes apoptosis of breast cancer cells via a high dose of doxorubicin treatment
  67. Bacteria co-colonizing with Clostridioides difficile in two asymptomatic patients
  68. A allele of ICAM-1 rs5498 and VCAM-1 rs3181092 is correlated with increased risk for periodontal disease
  69. Treatment of hepatic cystic echinococcosis patients with clear cell renal carcinoma: a case report
  70. Edaravone exerts brain protective function by reducing the expression of AQP4, APP and Aβ proteins
  71. Correlation between neutrophil count and prognosis in STEMI patients with chronic renal dysfunction: a retrospective cohort study
  72. Bioinformatic analysis reveals GSG2 as a potential target for breast cancer therapy
  73. Nuciferine prevents hepatic steatosis by regulating lipid metabolismin diabetic rat model
  74. Analysis of SEC24D gene in breast cancer based on UALCAN database
  75. Bioengineering and Biotechnology
  76. Co-cultured Bone-marrow Derived and Tendon Stem Cells: Novel Seed Cells for Bone Regeneration
  77. Animal Sciences
  78. Comparative analysis of gut microbiota among the male, female and pregnant giant pandas (Ailuropoda Melanoleuca)
  79. Adaptive immunity and skin wound healing in amphibian adults
  80. Hox genes polymorphism depicts developmental disruption of common sole eggs
  81. The prevalence of virulence genes and multidrug resistance in thermophilic Campylobacter spp. isolated from dogs
  82. Agriculture
  83. Effect of Lactobacillus plantarum supplementation on production performance and fecal microbial composition in laying hens
  84. Identification of Leaf Rust Resistance Genes in Selected Wheat Cultivars and Development of Multiplex PCR
  85. Determining Potential Feed Value and Silage Quality of Guar Bean (Cyamopsis tetragonoloba) Silages
  86. Food Science
  87. Effect of Thermal Processing on Antioxidant Activity and Cytotoxicity of Waste Potato Juice
Downloaded on 6.3.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2019-0002/html
Scroll to top button