Identification of Leaf Rust Resistance Genes in Selected Wheat Cultivars and Development of Multiplex PCR
-
Agnieszka Tomkowiak
, Roksana Skowrońska
, Alicja Buda , Danuta Kurasiak-Popowska , Jerzy Nawracała , Przemysław Łukasz Kowalczewski , Mateusz Pluta and Dominika Radzikowska
Abstract
Ten leading wheat cultivars originating from the Plant Breeding and Acclimatization Institute (IHAR) - National Research Institute (Poland) and the Department of Gene Bank (Czech Republic) were used to establish a field experiment in 2017 and 2018 at the Dłoń Experimental Farm. The analyzed wheat genotypes were characterized by diversified field resistance to leaf rust. Jubilatka, Thatcher and Sparta were the most resistant cultivars in field conditions in both 2017 and 2018. The aim of the work was to identify the Lr11, L13, Lr16 and Lr26 genes encoding resistance to leaf rust using molecular SSR markers (wmc24, wmc261, Xgwm630, Xwmc764 and P6M12) and to develop multiplex PCR conditions to accelerate identification of these genes. Markers of three leaf rust resistance genes have been identified simultaneously in these cultivars. Jubilatka, Thatcher and Sparta cultivars may serve as a good source of the analyzed leaf rust resistance genes. In addition, multiplex PCR conditions have been developed for the simultaneous identification of the Lr11 and Lr16 and Lr11 and Lr26 gene pairs.
1 Introduction
Common wheat (Triticum aestivum ssp. vulagare) is the most commonly cultivated plant based on the surface area of crops. Wheat is mainly grown for consumption and industrial purposes [1, 2]. In 2017, cereals in the European Union covered 56 million ha from which nearly 300 million tons of grain were harvested. In Poland, the area of wheat cultivation amounted to almost 2.5 million ha while the average yield was almost 5 tons from one ha [3].
Leaf rust caused by Puccinia recondita f. sp. tritici and stripe (yellow) rust caused by Puccinia striiformis f. sp. tritici are the most common types of rust that affect cereal crops in Poland. Losses in the yield that resulting from grain heterogeneity caused by this disease, amount to 15%, but may reach even 30-60% under favorable conditions [4]. Wheat genes responsible for resistance to pathogens and pests are divided into 25 classes and described in the Catalogue of Gene Symbols for Wheat. The largest group constitutes of genes that determine resistance to leaf rust. Currently, 88 Lr (leaf rust) genes that encode the resistance to leaf rust have been identified [5]. Most of them are R genes (Major Resistance Genes) that determine monogenic resistance according to the Flor ‘gene-for-gene’ theory [6] in which pathogen avirulence gene products interact directly or indirectly with the main products [7, 8]. In hexaploid wheat, leaf rust resistance genes are widely distributed across the genome, being present on nearly every one of the 42 chromosome arms. Different resistance genes condition characteristic resistance phenotypes or infection types. Race-specific resistance responses such as those conditioned by wheat lines with Lr3ka, Lr3bg and Lr11 are manifested by small uredinia surrounded by chlorosis, and lines with Lr16 have small uredinia surrounded by necrosis. For a number of resistance genes, the expression (dominant or recessive) and number of genes that conditioned avirulence are diferent between different segregating populations of Puccinia recondita f. sp. tritici. It can be conditioned by one gene or two genes in different populations at loci which condition avirulence / virulence for Lr1, Lr3, Lr10, Lr11, Lr29 and Lr30. Avirulence in Puccinia recondita f. sp. Tritici for Lr16 and Lr26 are conditioned by the two dominant genes, and the avirulence for the Lr10, Lr18 and Lr23 genes is conditioned by a single dominant gene in some segregating populations or recessive genes in other populations [9].
The systematic appearance of new pathogen genotypes is a problem in resistance breeding. Puccinia recondita f. sp. tritici is characterized by high genetic variability; it also demonstrates adaptability to climatic conditions, and its spores can migrate over long distances with air currents. For this reason, it is necessary to constantly search for and select sources of resistance to create new resistant wheat cultivars [4, 10]. In plant pathogenic fungi, the mechanism of their variability are: recombination occurring during combining of gametes and meiosis. Variability of pathogens may refer to appearance, structure or function, however, the most important is the variability of pathogenicity. There may be variants more or less pathogenic, variants capable of attacking plants that have not been hosts of a given pathogenic species yet and finally variants capable of attacking specific cultivars of the host plant (so-called variants with specific virulence). According to the theory of complementarity of genes, pathogens have specific virulence genes corresponding to the genes of resistance in plants and are thus able to overcome plant resistance to disease. In recent years a reverse theory has been proclaimed that certain pathogenic variants have avirulence genes, the expression of which is based on inducing immune reactions in plants. The effect of pathogen variability is the instability of plant resistance to disease. The resistance obtained in the bred varieties is overcome by the pathogen due to the emergence of new variants and their dissemination in the population as a result of selective pressure.
Multiplex PCR is one of the techniques that employs molecular markers. The advantage of the method is the possibility of simultaneous application of several primer pairs in the reaction mixture. Because of it, it is possible to identify several markers in one analysis. Markers with a similar primer annealing temperature to the DNA template should be used for their amplification to be possible. This technique allows reduction of the costs of analyses, labor time and the risk of contamination [8]. Tomkowiak et. al. [11] identified the Pm2, Pm3a, Pm4b and Pm6 genes for ten wheat varieties and developed multiplex PCR reaction conditions to reduce the time and limit analysis costs. The following molecular markers were used for gene identification: Xcfd81, Whs350 and Xgwm205 (for Pm2), Pm3a (for Pm3a), STS_241 and Xgwm382 (for Pm4b), NAU/BCDSTS 135-2 (for Pm6).
The aim of the study was to identify the Lr11, Lr13, Lr16 and Lr26 leaf rust resistance genes in 10 wheat cultivars originating from the Plant Breeding and Acclimatization Institute (IHAR) - National Research Institute (Poland) and the Department of Gene Bank (Czech Republic) as well as to develop multiplex PCR conditions to accelerate the identification of these genes.
2 Materials and methods
Ten wheat cultivars from Plant Breeding and Acclimatization Institute (IHAR) - National Research Institute (Poland) and the Department of Gene Bank (Czech Republic) that contained leaf rust resistance genes (Lr11, Lr13, Lr16 and Lr26) were tested (Tab. 1). Field experiment was performed at the Department of Genetic and Plant Breeding Experimental Station housed in the Dłoń Agricultural Experimental Farm of the Poznań University of Life Sciences (51°41’23.835”N 17°4’1.414”E) in 2017 and 2018. Genotypes were sown on 10 m2 plots in a randomized block system in triplicate. The assessment of the degree of leaf infection by Puccinia recondita f. sp. tritici was carried out in the milky maturity phase (BBCH 71-77) on 40 flag and subflag leaves of randomly selected plants from each plot. The field assessment was carried out in accordance with the recommendations of the European and Mediterranean Plant Protection Organization (EPPO) on the 9° scale (1°-0.1% of infected area, 9°-60% of infected area).
The degree of resistance to Puccinia recondita f. sp. tritici infection under field conditions (Dłoń Agricultural Experimental Farm) and the identification of the Lr11, Lr13, Lr16 and Lr26 genes by means of SSR markers.
| No. | Genotype | Field conditions | Molecular analysis | |||||
|---|---|---|---|---|---|---|---|---|
| Lr11 Wmc24 | Lr11 Wmc261 | Lr13 Xgwm630 | Lr16 Xwmc764 | Lr26 P6M12 | ||||
| 2017 | 2018 | |||||||
| 1 | Hussar | 5 | 4 | + | + | - | - | + |
| 2 | Wilga | 8 | 7 | - | + | - | - | - |
| 3 | Rialto | 6 | 5 | - | + | - | + | + |
| 4 | Apollo | 7 | 6 | - | + | - | + | - |
| 5 | Opata | 8 | 6 | + | + | + | - | - |
| 6 | Jubilatka | 4 | 2 | + | + | - | + | + |
| 7 | Thatcher | 3 | 1 | - | + | + | + | - |
| 8 | Sparta | 3 | 1 | - | + | - | + | + |
| 9 | Frontana | 5 | 5 | - | + | - | - | - |
| 10 | Brigadier | 7 | 3 | + | + | - | - | + |
9° scale: 1°-0.1% of infected area, 9°-60% of infected area
“+” indicates the presence of a given DNA fragment characteristic of the marker locus
“–” indicates the absence of a given DNA fragment characteristic of the marker locus
DNA was isolated from the leaves of 10-day-old seedlings with the use of Genomic Mini AX PLANT DNA collection kit (A&A Biotechnology, Poland) following the protocol provided with the kit. DNA concentration was determined using a DeNovix spectrophotometer. The samples were diluted with Tris buffer to obtain a uniform concentration of 70 ng μL.
PCR was carried out in a TProfesional Basic gradient thermocycler (Polygen sp. z o.o., Poland). The identification of the Lr11 gene was carried out with the use of wmc24 and wmc261 primers. The following markers were used to determine the presence of the Lr13, Lr16 and Lr26 genes: Xgwm630, Xwmc764 and P6M12. The primers were synthesized by IDT – Integrated DNA Technologies. The primer sequences were derived from the Grain Genes database (https://wheat.pw.usda.gov) and are presented in Table 2. The 12.75 μL reaction mixture consisted of: water – 5 μL, DreamTaq™ Green PCR Master Mix – 6.26 μL, primers – 2 × 0.25 μL (final concentration was 20 μM), DNA template – 1 μL. After optimization, PCR was carried out under the same conditions regardless of the marker being identified. The profile differed only in the primer annealing temperature, determined based on their melting temperature: initial denaturation for 5 minutes at 94°C, 40 cycles (denaturation – 45 sec at 94°C, primer annealing – 1 min at 53°C, 54°C), 56°C, 57°C, 58°C, synthesis – 1 min at 72°C), final synthesis – 5 min at 72°C, storage at -4°C max. for 24 hours.
Primer sequences and their annealing temperature in the detection of the Lr11, Lr13, Lr16, Lr26 genes.
| No. | Gene – Marker | Primer sequence | Annealing temperature |
|---|---|---|---|
| 1 | Lr11 – wmc24 | F:5’GTGAGCAATTTTGATTATACTG3’ | 53°C |
| R:5’TACCCTGATGCTGTAATATGTG3’ | |||
| 2 | Lr11 – wmc261 | F:5’GATGTGCATGTGAATCTCAAAAGTA3’ | 54°C |
| R:5’AAAGAGGGTCACAGAATAACCTAAA3’ | |||
| 3 | Lr13 – Xgwm630 | F:5’GTGCCTGTGCCATCGTC3’ | 58°C |
| R:5’CGAAAGTAACAGCGCAGTGA3’ | |||
| 4 | Lr16 – Xwmc764 | F:5’ CCTCGAACCTGAAGCTCTGA3’ | 57°C |
| R:5’TTCGCAAGGACTCCGTAACA3’ | |||
| 5 | Lr26 – P6M12 | F:5’GTACTAGTATCCAGAGGTCACAAG3’ | 56°C |
| R:5’CAGACAAACAGAGTACGGGC3’ |
Simultaneous identification of the Lr11 gene marker (wmc261) and the Lr16 gene marker (Xwmc764) was carried out in a volume of 25 μL. Composition of the reaction mixture was as follows: water – 10 μL, DreamTaq MM Master Mix – 12.5 μL, wmc261 primer – 2 × 0.25 μL, P6M12 primer – 2 × 0.25 μL, DNA template – 1.5 μL. The reaction was based on the thermal profile specific for the identification of the Lr16 gene –primer annealing temperature was 57°C.
Simultaneous identification of the Lr11 (wmc261) and Lr26 gene marker (P6M12) was carried out in a volume of 24.9 μL and its composition was as follows: water – 10 μL, DreamTaq MM Master Mix – 12.5 μL, wmc261 primer – 2 × 0.1 μL, P6M12 primer – 2 × 0.35 μL, DNA template – 1.5 μL. The reaction was based on the thermal profile specific for the identification of the Lr26 gene –primer annealing temperature was 56°C.
To visualize the results, PCR products were separated in a 2.5% agarose gel with 1 μL ethidium bromide immersed in TBE 1x for 1 h at 120 V. To visualize PCR products, a Molecular Imager Gel Doc™ XR UV transilluminator was used with the ImageLab™ Software (Bio-Rad, USA).
Ethical approval: The conducted research is not related to either human or animals use.
3 Results
3.1 Field evaluation
Jubilatka, Thatcher and Sparta were the most resistant cultivars in field conditions in both 2017 and 2018. In 2018, infection degree of these cultivars by Puccinia recondita f. sp. tritici was only 2° (Jubilatka) and 1° (Thatcher and Sparta), meaning that the infection involved no more than 1% of the leaf area in Jubilatka and 0.1% in Thatcher and Sparta (Tab. 1). These cultivars showed lower resistance in 2017, which was caused by very intense precipitation during the entire growing season, which promoted pathogen development. The least resistant in field conditions were the cultivars Wilga (8° – 2017 and 7° – 2018) and Opata (8° – 2017 and 6° – 2018), in which as many as 45% of the leaf area was infested by Puccinia recondita f. sp. tritici in 2017. The remaining cultivars: Hussar, Rialto, Apollo, Frontana, Brigadier were characterized by average resistance to leaf rust both in 2017 and in 2018 (Tab. 1).
3.2 Lr11 gene identification
A specific product of 152 bp was obtained in the following cultivars as a result of the PCR-SSR analyses carried out using the wmc24 marker for the Lr11 gene: Hussar, Opata, Jubilatka and Brigadier. A nonspecific product of 145 bp was obtained in the cultivars Wilga, Rialto, Apollo, Thatcher, Sparta and Frontana, indicating the absence of the Lr11 gene (Tab. 1). The second tested marker for the Lr11 gene was wmc261 that gave a product of 110 bp. The marker was detected in all the analyzed cultivars (Fig. 1, Tab. 1).

Electropherogram showing the presence of the wmc261 marker of the Lr11 gene in wheat cultivars.
3.3 Lr13 gene identification
Analysis of the electrophoretic images after the PCR-SSR reaction in which the Xgwm630 marker linked to the Lr13 gene was used revealed a specific product of 120 bp in the cultivars Opata and Thatcher (Tab. 1).
3.4 Lr16 gene identification
The Xwmc764 marker was used to identify the Lr16 gene. As a result of the analyses, a specific product of 156 bp was amplified in the following cultivars: Rialto, Apollo, Jubilatka, Thatcher and Sparta. A 180-bp product, indicating the absence of the Lr16 gene, was found in the following cultivars: Hussar, Wilga, Opata, Frontana and Brigadier (Fig. 2., Tab. 1).

Electropherogram showing the presence of the Xgwm764 marker of the Lr16 gene in wheat cultivars.
3.5 Lr26 gene identification
The analyses that involved the P6M12 marker, specific to the Lr26 gene, resulted in the detection of 260-bp and 360-bp PCR products that indicate the presence of the Lr26 gene in the following cultivars: Hussar, Rialto, Jubilatka, Sparta and Brigadier. No product was obtained in the cultivars Wilga, Apollo, Opata, Thatcher and Frontana (Fig. 3., Tab. 1).

Electropherogram showing the presence of the P6M12 marker of the Lr26 gene in wheat cultivars.
3.6 DNA amplification for the Lr11 and Lr16 genes using the Multiplex PCR method
Two primer pairs, wmc261 and Xwmc764, were used in the PCR reaction. An amplification product of 110 bp was observed in all tested cultivars which proved the presence of the Lr11 gene. The second marker of the Lr16 gene confirmed the presence of leaf rust resistance genes in the cultivars Rialto, Apollo, Jubilatka, Thatcher and Sparta in which a product with a size of 156 bp was identified. A non-specific product of 180 bp was obtained in the cultivars Hussar, Wilga, Opata, Frontana and Brigadier.
The obtained electrophoretic image was reproducible (Fig. 4.)

Electropherogram showing the presence of the following markers: wmc261 of the Lr11 gene and Xgwm764 of the Lr16 gene in wheat cultivars.
3.7 DNA amplification for the Lr11 and Lr26 genes using the Multiplex PCR method
Three reaction products (110 bp, 260 bp and 360 bp) were obtained after including two primer pairs for the wmc261 and P6M12 markers in the PCR reaction in the Hussar, Jubilatka, Sparta and Brigadier cultivars. This indicated the presence of the Lr11 and Lr26 genes in these cultivars. One product of 110 bp, specific for the Lr11 gene marker was detected in the remaining cultivars. The results of the analyses were repeatable (Fig. 5).

Electrophoregram showing the presence of the following markers: wmc261 of the Lr11 gene and P6M12 of the Lr16 gene in wheat cultivars.
4 Discussion
Cultivars of winter wheat grown in Poland and newly registered ones are evaluated in terms of resistance to infection by the pathogen Puccinia recondita f. sp. tritici [7]. However, after several years, the resistance is often lost. It was found in the USA that 4 years after the introduction of the cultivar ‘Chinese spring’ containing the Lr9 gene, the resistance was overcome by new pathogen races [12]. Currently, research is conducted on changes in the frequency of virulence genes corresponding to resistance genes [10]. Woźniak-Strzembicka [13] showed that the Lr9, Lr19, Lr23, Lr24 and Lr25 genes were effective against the population of the pathogen present in Poland at that time. Liatukas and Ruzgas [14] investigated the effectiveness of the most popular genes in winter wheat occurring in Europe at different growth stages. They showed that the Lr37 gene was the most effective in the tillering and the adult plant stages and when combined with other genes, while the Lr13 gene showed efficacy against 29% of the pathogen isolates in the adult stage of the plant. Czajowski et al. [15] conducted a study in 2008-2011 and showed that the Lr19 gene from Agropyron elongatum was still effective against the pathogen causing leaf rust.
The source of the Lr11 gene is Triticum aestivum, originally located on chromosome 2A. Recent research showed that it is located on chromosome 2D [16]. In the present work, linked wmc24 and wmc261 markers were used to identify Lr11. In the experiments, the wmc24 marker occurred in the cultivars Hussar, Opata, Jubilatka and Brigadier. The wmc261 marker was identified in all the analyzed cultivars.
The Lr13 gene was transferred from Triticum aestivum and is located on the short arm of chromosome 2B. It is considered one of the most common genes in wheat cultivars. It is responsible for resistance in the adult plant stage, and its effectiveness is low. The effectiveness of Lr13 may increase when combined with the Lr34 or Lr16 genes. In Australia, Lr13 and Lr1 combination provided effective protection against leaf rust. Bansal et al. [17] used the Lr13 gene and the Xjsm58 and Xstm773b markers to determine the exact location of the Lr48 gene and proved that these genes were associated and could be used as effective resistance genes in the future. In this study, the Lr13 leaf resistance gene was identified using the Xgwm630 marker in the cultivars Opata and Thatcher.
The Lr16 gene, transferred from Triticum aestivum, is widely used and provides partial resistance at the seedling stage. It was also proven to be more effective than other genes at higher temperatures. The best efficiency of this gene was recorded when it was accompanied by the presence of other genes: Lr13, Lr23 and Lr34. Originally, Lr16 has been assigned to chromosome 4A [18]. Lan et al. [19] investigated the exact location of the Lr16 gene and proved that it is localized on chromosome 2B. The YrF gene, responsible for the resistance to stripe rust (Puccinia striiformis), is also located on the arm of this chromosome. For this purpose, the authors used the Xwmc764 and Xwmc661 markers. According to the study by Liu et al. [20], the Xgwm210, Xwmc661 and Xwmc764 markers can be used to identify the Lr16 gene in wheat breeding programs or to create a pyramid with other genes responsible for leaf rust resistance. In the present work, the Xwmc764 marker was used to identify the Lr16 gene, and depending on the cultivar, it was located at a distance of 1.3 and 9 cM from the gene [21]. Moreover, the Xwmc764 marker of the Lr16 gene was detected in the following cultivars: Rialto, Apollo, Jubilatka, Thatcher and Sparta.
The Lr26 gene is derived from rye (Secale cereale) and is located on chromosome 1BL/1RS. The translocation of this gene into wheat also resulted in the transfer of resistance genes against stem rust (Sr31), stripe rust (Yr9) and powdery mildew (Pm8) [22]. Hanzalová et al. [23] examined 27 cultivars of winter wheat registered in the Czech Republic for the presence of the Lr26 and Lr37 genes. The Lr26 gene was present only in 4 genotypes, but was linked to the other genes tested. In the current study, the P6M12 marker was present in the cultivars Hussar, Rialto Jubilatka, Sparta and Brigadier.
The arguments that supports the choice of the multiplex PCR method to detect the presence of multiple genes are low cost of analysis and ease of implementation. De Froidmont [24] used a multiplex PCR method to identify the 1BL/1RS translocation in wheat breeding lines derived from rye lines and to distinguish homozygotes from heterozygotes. Fraaije et al. [25] identified resistance to four pathogens: Septoria tritici, Stagonospora nodorum, Puccinia striiformis and Puccinia recondita using multiplex PCR. They proved that the above method was effective in recognizing genes responsible for the resistance to pathogens at various stages of plant development. In the present work, multiplex PCR was used to simultaneously identify the Lr11 and Lr16 and Lr11 and Lr26 genes. The results indicate that a multiplex PCR method can be used in breeding programs. Such a method would allow to save time and labor and reduce the cost of analysis.
5 Conclusions
Jubilatka, Thatcher and Sparta were the most resistant cultivars in field conditions in both 2017 and 2018. Markers of three leaf rust resistance genes were detected simultaneously in these cultivars. The Lr11, Lr16 and Lr26 genes were present in Jubilatka and Sparta cultivars, whereas Lr11, Lr13 and Lr16 in the cultivar Thatcher. Markers of three leaf rust resistance genes were also found in the cultivar Rialto. Nonetheless, this cultivar proved not to be resistant to the pathogen Puccinia recondita f. sp. tritici under field conditions. One and two markers of leaf rust resistance genes were detected in Wilga and Opata cultivars, respectively. These cultivars were the least resistant in field conditions. The remaining cultivars: Hussar, Rialto, Apollo, Frontana and Brigadier were characterized by moderate resistance to leaf rust both in 2017 and in 2018. One or two markers of the analyzed Lr genes were present in these cultivars. Based on the results, the cultivars Jubilatka, Thatcher and Sparta can be considered a good source of the analyzed leaf rust resistance genes. In addition, the developed multiplex PCR conditions for the simultaneous identification of Lr11 and Lr16 as well as Lr11 and Lr26 gene pairs can be used in breeding programs in order to shorten the time of molecular analysis.
Conflict of interest: Authors state no conflict of interest
References
[1] Zou J, Huang Y, Chen L, Chen S. Remote Sensing-Based Extraction and Analysis of Temporal and Spatial Variations of Winter Wheat Planting Areas in the Henan Province of China. Open Life Sci. 2018;13(1):533-543.10.1515/biol-2018-0064Search in Google Scholar PubMed PubMed Central
[2] Klikocka H, Marks M, Barczak B, Szostak B, Podleśna A, Podleśny J. Response of spring wheat to NPK and S fertilization. The content and uptake of macronutrients and the value of ionic ratios. Open Chem. 2018;16(1):1059-1065.10.1515/chem-2018-0116Search in Google Scholar
[3] Central Statistical Office. Branch Yearbooks. Statistical Yearbook of Agriculture 2016 Warsaw, Poland: Statistical Publishing Establishment; 2017.Search in Google Scholar
[4] Strzembicka A, Czajowski G, Karska K. Characteristic of the winter wheat breeding materials in respect of resistance to leaf rust Puccinia triticina. Bull Plant Breed Acclim Inst. 2013;268:7-14.Search in Google Scholar
[5] McIntosh RA, Dubcovsky J, Rogers WJ, Morris C, Appels R, Xia XC. Catalogue of Gene Symbols for Wheat. 2012.Search in Google Scholar
[6] Flor HH. Host-parasite interactions in flax rust-its genetics and other implications. Phytopathology. 195AD;45:680-685.Search in Google Scholar
[7] Pietrusińska A. The use of molecular markers for introduction of leaf rust (Puccinia recondita f. sp. tritici) and powdery mildew (Blumeria graminis f. sp. tritici) resistance genes in winter wheat (Triticum aestivum). Bull Plant Breed Acclim Inst. 2010;256:31-44.Search in Google Scholar
[8] Yi YJ, Liu HY, Huang XQ, An LZ, Wang F, Wang XL. Development of molecular markers linked to the wheat powdery mildew resistance gene Pm4b and marker validation for molecular breeding. Plant Breed. 2008;127(2):116-120.10.1111/j.1439-0523.2007.01443.xSearch in Google Scholar
[9] Bolton MD, Kolmer JA, Garvin DF. Wheat leaf rust caused by Puccinia triticina. Mol Plant Pathol. 2008;9(5):563-575.10.1111/j.1364-3703.2008.00487.xSearch in Google Scholar PubMed PubMed Central
[10] Czajowski G, Czembor P, Radecka-Janusik M. Virulence of Puccinia triticina the causal agents of wheat leaf rust in Poland in the years 2013–2015. Bull Plant Breed Acclim Inst. 2016;280:13-21.Search in Google Scholar
[11] Tomkowiak A, Skowrońska R, Weigt D, Kwiatek M, Nawracała J, Kowalczewski PŁ, et al. Identification of Powdery Mildew Blumeria graminis f. sp. tritici Resistance Genes in Selected Wheat Varieties and Development of Multiplex PCR. Open Chem. 2019;17:157-165.10.1515/chem-2019-0024Search in Google Scholar
[12] Leśniowska-Nowak J, Grądzielewska A, Majek M. Identification of the gene resistant to leaf rust in selected European wheat cultivars and Multiplex PCR development. Ann UMCS Sect E. 2013;68(3):20-28.Search in Google Scholar
[13] Woźniak-Strzembicka A. Virulence of Puccinia recondita f. sp. tritici population in Poland in 1998-2001. Bull Plant Breed Acclim Inst. 2001;230:109-117.Search in Google Scholar
[14] Liatukas Ž, Ruzgas V. Effectiveness of Puccinia recondita f. sp. tritici resistance genes at different phenological stages of winter wheat. J Plant Prot Res. 2006;46(2):123-131.Search in Google Scholar
[15] Czajowski G, Strzembicka A, Karska K. Virulence in population of Puccinia triticina, the causal agent of wheat and triticale leaf rust in Poland in 2008–2010. Bull Plant Breed Acclim Inst. 2011;260/261:145-153.Search in Google Scholar
[16] Darino MA, Dieguez MJ, Singh D, Ingala LR, Pergolesi MF, Park RF, et al. Detection and location of Lr11 and other leaf rust resistance genes in the durably resistant wheat cultivar Buck Poncho. Euphytica. 2015;206(1):135-147.10.1007/s10681-015-1486-0Search in Google Scholar
[17] Bansal UK, Hayden MJ, Venkata BP, Khanna R, Saini RG, Bariana HS. Genetic mapping of adult plant leaf rust resistance genes Lr48 and Lr49 in common wheat. Theor Appl Genet. 2008;117(3):307-312.10.1007/s00122-008-0775-6Search in Google Scholar PubMed
[18] Harrison NR, Fritz AK, Glasscock JI, Ahmed S, Messina DN, Amand PS., et al. Using RNA Sequencing and In Silico Subtraction to Identify Resistance Gene Analog Markers for in Wheat. Plant Genome. 2015;8(2).10.3835/plantgenome2014.08.0040Search in Google Scholar PubMed
[19] Lan C, Rosewarne GM, Singh RP, Herrera-Foessel SA, Huerta-Espino J, Basnet BR, et al. QTL characterization of resistance to leaf rust and stripe rust in the spring wheat line Francolin#1. Mol Breed. 2014;34(3):789-803.10.1007/s11032-014-0075-6Search in Google Scholar
[20] Liu S, Banik M, Yu K, Park SJ, Poysa V, Guan Y. Marker-Assisted Selection (MAS) in Major Cereal and Legume Crop Breeding: Current Progress and Future Directions. Int J Plant Breed. 2007;1(2):75-78.Search in Google Scholar
[21] McCartney CA, Somers DJ, McCallum BD, Thomas J, Humphreys DG, Menzies JG, et al. Microsatellite tagging of the leaf rust resistance gene Lr16 on wheat chromosome 2BSc. Mol Breed. 2005;15(4):329-337.10.1007/s11032-004-5948-7Search in Google Scholar
[22] Sumíková T, Hanzalová A. Multiplex PCR assay to detect rust resistance genes Lr26 and Lr37 in wheat. Czech J Genet Plant Breed. 2010;46(2):85-89.10.17221/32/2010-CJGPBSearch in Google Scholar
[23] Hanzalová A, Sumíková T, Bartoš P. Determination of leaf rust resistance genes Lr10, Lr26 and Lr37 by molecular markers in wheat cultivars registered in the Czech Republic. Czech J Genet Plant Breed. 2009;45(2):79-84.10.17221/28/2009-CJGPBSearch in Google Scholar
[24] de Froidmont D. A Co-dominant Marker for the 1BL/1RS Wheat-rye Translocation via Multiplex PCR. J Cereal Sci. 1998;27(3):229-232.10.1006/jcrs.1998.0194Search in Google Scholar
[25] Fraaije BA, Lovell DJ, Coelho JM, Baldwin S, Hollomon DW. PCR-based assays to assess wheat varietal resistance to blotch (Septoria tritici and Stagonospora nodorum) and rust (Puccinia striiformis and Puccinia recondita) diseases. Eur J Plant Pathol. 2001;107(9):905-917.10.1023/A:1013119206261Search in Google Scholar
© 2019 Agnieszka Tomkowiak et al., published by De Gruyter
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
Articles in the same Issue
- Plant Sciences
- Extended low temperature and cryostorage longevity of Salix seeds with desiccation control
- Genome-wide analysis of the WRKY gene family and its response to abiotic stress in buckwheat (Fagopyrum tataricum)
- Differential expression of microRNAs during root formation in Taxus chinensis var. mairei cultivars
- Metabolomics Approach for The Analysis of Resistance of Four Tomato Genotypes (Solanum lycopersicum L.) to Root-Knot Nematodes (Meloidogyne incognita)
- Beneficial Effects of Salt on Halophyte Growth: Morphology, Cells, and Genes
- Phosphate-solubilizing bacteria from safflower rhizosphere and their effect on seedling growth
- Anatomy and Histochemistry of the Roots and Shoots in the Aquatic Selenium Hyperaccumulator Cardamine hupingshanensis (Brassicaceae)
- Effects of LED light on Acacia melanoxylon bud proliferation in vitro and root growth ex vitro
- Ecology and Environmental Sciences
- Intensity of stripping and sugar content in the bark and the bast of European beech (Fagus sylvatica)
- Influence of monometallic and bimetallic phytonanoparticles on physiological status of mezquite
- Loci identification of a N-acyl homoserine lactone type quorum sensing system and a new LysR-type transcriptional regulator associated with antimicrobial activity and swarming in Burkholderia gladioli UAPS07070
- Bacillus methylotrophicus has potential applications against Monilinia fructicola
- Evaluation of Heavy Metals and Microbiological Contamination of Selected herbals from Palestine
- The effect of size of black cherry stumps on the composition of fungal communities colonising stumps
- Effect of rhamnolipids on microbial biomass content and biochemical parameters in soil contaminated with coal tar creosote
- Effects of foliar trichomes on the accumulation of atmospheric particulates in Tillandsia brachycaulos
- Isolation and characterisation of the agarolytic bacterium Pseudoalteromonas ruthenica
- Comparison of soil bioconditioners and standard fertilization in terms of the impact on yield and vitality of Lolium perenne and soil biological properties
- Biomedical Sciences
- The number of regulatory B cells is increased in mice with collagen-induced arthritis
- Lactate overload inhibits myogenic activity in C2C12 myotubes
- Diagnostic performance of serum CK-MB, TNF-α and hs-CRP in children with viral myocarditis
- Correlation between PPARGC1A gene rs8192678 G>A polymorphism and susceptibility to type-2 diabetes
- Improving the Detection of Hepatocellular Carcinoma using serum AFP expression in combination with GPC3 and micro-RNA miR-122 expression
- The ratio of neutrophil to lymphocyte is a predictor in endometrial cancer
- Expression of HER2/c-erbB-2, EGFR protein in gastric carcinoma and its clinical significance
- Clinical significance of neuropeptide Y expression in pelvic tissue in patients with pelvic floor dysfunction
- Overexpression of RASAL1 indicates poor prognosis and promotes invasion of ovarian cancer
- The effect of adrenaline on the mineral and trace element status in rats
- Effects of Ischemic Post-Conditioning on the Expressions of LC3-II and Beclin-1 in the Hippocampus of Rats after Cerebral Ischemia and Reperfusion
- Long non-coding RNA DUXAP8 regulates the cell proliferation and invasion of non-small-cell lung cancer
- Risk factors of regional lymph node metastasis in patients with cervical cancer
- Bullous prurigo pigmentosa
- Association of HIF-1α and NDRG2 expression with EMT in gastric cancer tissues
- Decrease in the level of nervonic acid and increased gamma linolenic acid in the plasma of women with polycystic ovary syndrome after a three-month low-glycaemic index and caloric reduction diet
- Depletion of VAX2 restrains the malignant progression of papillary thyroid carcinoma by modulating ERK signaling pathway
- Insulin resistance is a risk factor for mild cognitive impairment in elderly adults with T2DM
- Nurr1 promotes lung cancer apoptosis via enhancing mitochondrial stress and p53-Drp1 pathway
- Predictive significance of serum MMP-9 in papillary thyroid carcinoma
- Agmatine prevents oxidative-nitrative stress in blood leukocytes under streptozotocin-induced diabetes mellitus
- Effect of platelet-rich plasma on implant bone defects in rabbits through the FAK/PI3K/AKT signaling pathway
- The diagnostic efficacy of thrombelastography (TEG) in patients with preeclampsia and its association with blood coagulation
- Value of NSE and S100 Protein of Kawasaki Disease with aseptic meningitis in Infant
- CB2 receptor agonist JWH133 activates AMPK to inhibit growth of C6 glioma cells
- The effects of various mouthwashes on osteoblast precursor cells
- Co-downregulation of GRP78 and GRP94 induces apoptosis and inhibits migration in prostate cancer cells
- SKA3 up-regulation promotes lung adenocarcinoma growth and is a predictor of poor prognosis
- Protective effects and mechanisms of microRNA-182 on oxidative stress in RHiN
- A case of syphilis with high bone arsenic concentration from early modern cemetery (Wroclaw, Poland)
- Study of LBHD1 Expression with Invasion and Migration of Bladder Cancer
- 1-Hydroxy-8-methoxy-anthraquinon reverses cisplatin resistance by inhibiting 6PGD in cancer cells
- Andrographolide as a therapeutic agent against breast and ovarian cancers
- Accumulation of α-2,6-sialyoglycoproteins in the muscle sarcoplasm due to Trichinella sp. invasion
- Astragalus polysaccharides protects thapsigargin-induced endoplasmic reticulum stress in HT29 cells
- IGF-1 via PI3K/Akt/S6K signaling pathway protects DRG neurons with high glucose-induced toxicity
- Intra-arterial tirofiban in a male nonagenarian with acute ischemic stroke: A case report
- Effects of Huaiqihuang Granules adjuvant therapy in children with primary nephrotic syndrome
- Immune negative regulator TIPE2 inhibits cervical squamous cancer progression through Erk1/2 signaling
- Asymptomatic mediastinal extra-adrenal paraganglioma as a cause of sudden death: a case Report
- Primary mucinous adenocarcinoma of appendix invading urinary bladder with a fistula: a case report
- Minocycline attenuates experimental subarachnoid hemorrhage in rats
- Neural Remodeling of the Left Atrium in rats by Rosuvastatin following Acute Myocardial Infarction
- Protective effects of emodin on lung injuries in rat models of liver fibrosis
- RHOA and mDia1 promotes apoptosis of breast cancer cells via a high dose of doxorubicin treatment
- Bacteria co-colonizing with Clostridioides difficile in two asymptomatic patients
- A allele of ICAM-1 rs5498 and VCAM-1 rs3181092 is correlated with increased risk for periodontal disease
- Treatment of hepatic cystic echinococcosis patients with clear cell renal carcinoma: a case report
- Edaravone exerts brain protective function by reducing the expression of AQP4, APP and Aβ proteins
- Correlation between neutrophil count and prognosis in STEMI patients with chronic renal dysfunction: a retrospective cohort study
- Bioinformatic analysis reveals GSG2 as a potential target for breast cancer therapy
- Nuciferine prevents hepatic steatosis by regulating lipid metabolismin diabetic rat model
- Analysis of SEC24D gene in breast cancer based on UALCAN database
- Bioengineering and Biotechnology
- Co-cultured Bone-marrow Derived and Tendon Stem Cells: Novel Seed Cells for Bone Regeneration
- Animal Sciences
- Comparative analysis of gut microbiota among the male, female and pregnant giant pandas (Ailuropoda Melanoleuca)
- Adaptive immunity and skin wound healing in amphibian adults
- Hox genes polymorphism depicts developmental disruption of common sole eggs
- The prevalence of virulence genes and multidrug resistance in thermophilic Campylobacter spp. isolated from dogs
- Agriculture
- Effect of Lactobacillus plantarum supplementation on production performance and fecal microbial composition in laying hens
- Identification of Leaf Rust Resistance Genes in Selected Wheat Cultivars and Development of Multiplex PCR
- Determining Potential Feed Value and Silage Quality of Guar Bean (Cyamopsis tetragonoloba) Silages
- Food Science
- Effect of Thermal Processing on Antioxidant Activity and Cytotoxicity of Waste Potato Juice
Articles in the same Issue
- Plant Sciences
- Extended low temperature and cryostorage longevity of Salix seeds with desiccation control
- Genome-wide analysis of the WRKY gene family and its response to abiotic stress in buckwheat (Fagopyrum tataricum)
- Differential expression of microRNAs during root formation in Taxus chinensis var. mairei cultivars
- Metabolomics Approach for The Analysis of Resistance of Four Tomato Genotypes (Solanum lycopersicum L.) to Root-Knot Nematodes (Meloidogyne incognita)
- Beneficial Effects of Salt on Halophyte Growth: Morphology, Cells, and Genes
- Phosphate-solubilizing bacteria from safflower rhizosphere and their effect on seedling growth
- Anatomy and Histochemistry of the Roots and Shoots in the Aquatic Selenium Hyperaccumulator Cardamine hupingshanensis (Brassicaceae)
- Effects of LED light on Acacia melanoxylon bud proliferation in vitro and root growth ex vitro
- Ecology and Environmental Sciences
- Intensity of stripping and sugar content in the bark and the bast of European beech (Fagus sylvatica)
- Influence of monometallic and bimetallic phytonanoparticles on physiological status of mezquite
- Loci identification of a N-acyl homoserine lactone type quorum sensing system and a new LysR-type transcriptional regulator associated with antimicrobial activity and swarming in Burkholderia gladioli UAPS07070
- Bacillus methylotrophicus has potential applications against Monilinia fructicola
- Evaluation of Heavy Metals and Microbiological Contamination of Selected herbals from Palestine
- The effect of size of black cherry stumps on the composition of fungal communities colonising stumps
- Effect of rhamnolipids on microbial biomass content and biochemical parameters in soil contaminated with coal tar creosote
- Effects of foliar trichomes on the accumulation of atmospheric particulates in Tillandsia brachycaulos
- Isolation and characterisation of the agarolytic bacterium Pseudoalteromonas ruthenica
- Comparison of soil bioconditioners and standard fertilization in terms of the impact on yield and vitality of Lolium perenne and soil biological properties
- Biomedical Sciences
- The number of regulatory B cells is increased in mice with collagen-induced arthritis
- Lactate overload inhibits myogenic activity in C2C12 myotubes
- Diagnostic performance of serum CK-MB, TNF-α and hs-CRP in children with viral myocarditis
- Correlation between PPARGC1A gene rs8192678 G>A polymorphism and susceptibility to type-2 diabetes
- Improving the Detection of Hepatocellular Carcinoma using serum AFP expression in combination with GPC3 and micro-RNA miR-122 expression
- The ratio of neutrophil to lymphocyte is a predictor in endometrial cancer
- Expression of HER2/c-erbB-2, EGFR protein in gastric carcinoma and its clinical significance
- Clinical significance of neuropeptide Y expression in pelvic tissue in patients with pelvic floor dysfunction
- Overexpression of RASAL1 indicates poor prognosis and promotes invasion of ovarian cancer
- The effect of adrenaline on the mineral and trace element status in rats
- Effects of Ischemic Post-Conditioning on the Expressions of LC3-II and Beclin-1 in the Hippocampus of Rats after Cerebral Ischemia and Reperfusion
- Long non-coding RNA DUXAP8 regulates the cell proliferation and invasion of non-small-cell lung cancer
- Risk factors of regional lymph node metastasis in patients with cervical cancer
- Bullous prurigo pigmentosa
- Association of HIF-1α and NDRG2 expression with EMT in gastric cancer tissues
- Decrease in the level of nervonic acid and increased gamma linolenic acid in the plasma of women with polycystic ovary syndrome after a three-month low-glycaemic index and caloric reduction diet
- Depletion of VAX2 restrains the malignant progression of papillary thyroid carcinoma by modulating ERK signaling pathway
- Insulin resistance is a risk factor for mild cognitive impairment in elderly adults with T2DM
- Nurr1 promotes lung cancer apoptosis via enhancing mitochondrial stress and p53-Drp1 pathway
- Predictive significance of serum MMP-9 in papillary thyroid carcinoma
- Agmatine prevents oxidative-nitrative stress in blood leukocytes under streptozotocin-induced diabetes mellitus
- Effect of platelet-rich plasma on implant bone defects in rabbits through the FAK/PI3K/AKT signaling pathway
- The diagnostic efficacy of thrombelastography (TEG) in patients with preeclampsia and its association with blood coagulation
- Value of NSE and S100 Protein of Kawasaki Disease with aseptic meningitis in Infant
- CB2 receptor agonist JWH133 activates AMPK to inhibit growth of C6 glioma cells
- The effects of various mouthwashes on osteoblast precursor cells
- Co-downregulation of GRP78 and GRP94 induces apoptosis and inhibits migration in prostate cancer cells
- SKA3 up-regulation promotes lung adenocarcinoma growth and is a predictor of poor prognosis
- Protective effects and mechanisms of microRNA-182 on oxidative stress in RHiN
- A case of syphilis with high bone arsenic concentration from early modern cemetery (Wroclaw, Poland)
- Study of LBHD1 Expression with Invasion and Migration of Bladder Cancer
- 1-Hydroxy-8-methoxy-anthraquinon reverses cisplatin resistance by inhibiting 6PGD in cancer cells
- Andrographolide as a therapeutic agent against breast and ovarian cancers
- Accumulation of α-2,6-sialyoglycoproteins in the muscle sarcoplasm due to Trichinella sp. invasion
- Astragalus polysaccharides protects thapsigargin-induced endoplasmic reticulum stress in HT29 cells
- IGF-1 via PI3K/Akt/S6K signaling pathway protects DRG neurons with high glucose-induced toxicity
- Intra-arterial tirofiban in a male nonagenarian with acute ischemic stroke: A case report
- Effects of Huaiqihuang Granules adjuvant therapy in children with primary nephrotic syndrome
- Immune negative regulator TIPE2 inhibits cervical squamous cancer progression through Erk1/2 signaling
- Asymptomatic mediastinal extra-adrenal paraganglioma as a cause of sudden death: a case Report
- Primary mucinous adenocarcinoma of appendix invading urinary bladder with a fistula: a case report
- Minocycline attenuates experimental subarachnoid hemorrhage in rats
- Neural Remodeling of the Left Atrium in rats by Rosuvastatin following Acute Myocardial Infarction
- Protective effects of emodin on lung injuries in rat models of liver fibrosis
- RHOA and mDia1 promotes apoptosis of breast cancer cells via a high dose of doxorubicin treatment
- Bacteria co-colonizing with Clostridioides difficile in two asymptomatic patients
- A allele of ICAM-1 rs5498 and VCAM-1 rs3181092 is correlated with increased risk for periodontal disease
- Treatment of hepatic cystic echinococcosis patients with clear cell renal carcinoma: a case report
- Edaravone exerts brain protective function by reducing the expression of AQP4, APP and Aβ proteins
- Correlation between neutrophil count and prognosis in STEMI patients with chronic renal dysfunction: a retrospective cohort study
- Bioinformatic analysis reveals GSG2 as a potential target for breast cancer therapy
- Nuciferine prevents hepatic steatosis by regulating lipid metabolismin diabetic rat model
- Analysis of SEC24D gene in breast cancer based on UALCAN database
- Bioengineering and Biotechnology
- Co-cultured Bone-marrow Derived and Tendon Stem Cells: Novel Seed Cells for Bone Regeneration
- Animal Sciences
- Comparative analysis of gut microbiota among the male, female and pregnant giant pandas (Ailuropoda Melanoleuca)
- Adaptive immunity and skin wound healing in amphibian adults
- Hox genes polymorphism depicts developmental disruption of common sole eggs
- The prevalence of virulence genes and multidrug resistance in thermophilic Campylobacter spp. isolated from dogs
- Agriculture
- Effect of Lactobacillus plantarum supplementation on production performance and fecal microbial composition in laying hens
- Identification of Leaf Rust Resistance Genes in Selected Wheat Cultivars and Development of Multiplex PCR
- Determining Potential Feed Value and Silage Quality of Guar Bean (Cyamopsis tetragonoloba) Silages
- Food Science
- Effect of Thermal Processing on Antioxidant Activity and Cytotoxicity of Waste Potato Juice