Startseite Medizin Molecular cloning and in silico characterization of two alpha-like neurotoxins and one metalloproteinase from the maxilllipeds of the centipede Scolopendra subspinipes mutilans
Artikel Öffentlich zugänglich

Molecular cloning and in silico characterization of two alpha-like neurotoxins and one metalloproteinase from the maxilllipeds of the centipede Scolopendra subspinipes mutilans

  • Xichao Xia ORCID logo EMAIL logo , Yang Liu , Jianxin Huang , Xiaozhu Yu , Zhiguo Chen , Xinhua Zheng , Fuan Wang , Junfeng Zhang , Shipeng Xue und Zhaofei Cheng
Veröffentlicht/Copyright: 28. März 2018
Artikel downloaden (PDF)
Turkish Journal of Biochemistry
Aus der Zeitschrift Turkish Journal of Biochemistry Band 43 Heft 6

Abstract

Aims

In order to shed light of characterizations of centipede Scolopendra subspinipes mutilans venom, a two novel full-lengths of alpha-like-neurotoxin and one metalloproteinase cDNAs derived from the maxilllipeds RNA of centipede S. subspinipes mutilans were isolated, and, respectively, named as SsuTA1, SsuTA2 and SsuMPs.

Materials and methods

The SsuTA1, SsuTA2 and SsuMPs were cloned from the S. subspinipes mutilans using the rapid amplification of cDNA ends methods.

Results

In the current study, SsuTA1 and SsuTA2 were, respectively, composed of 82 amino acid residues and 106 amino acid residues. Deduced protein sequence of SsuTA1 shared high homology with that of SsuTA2, one major difference was the C-terminal 24-residue extension in SsuTA2. An abundance of cysteine residues and several adjacent beta-sheets were observed in SsuTA1 and SsuTA2. SsuMPs had 594 amino acid residues containing with a molecular mass of 68.29 kDa. The primary sequence analysis indicated that the SsuMPs contains a zinc-binding motif (HEIGHSLGLAHS) and methionine-turn motif (YIM). Phylogenetic analysis revealed early divergence and independent evolution of SsuTA1 and SsuTA2 from other α-neurotoxins.

Conclusion

The results suggested that centipede S. subspinipes mutilans is an ancient member of venomous arthropods, but its venom exhibits novel scenario.

Özet

Amaçlar

Kırkayak çağı scolopendra subspinipes mutilans venomunun karakterizasyonlarının ışığında, iki adet tam uzunlukta alfa-benzeri-nörotoksin ve santrifüj S. subspinipes mutilansının maksilllipre RNA’sından türetilmiş bir metalloproteinaz cDNA’sı izole edildi ve sırasıyla SsuTA1, SsuTA2 ve SsuMPs.

Gereç ve Yöntemler

SsuTA1, SsuTA2 ve SsuMP’ler, S. subspinipes mutilanslarından cDNA uçlarının hızlı amplifikasyonu kullanılarak klonlanmıştır.

Bulgular

Mevcut çalışmada SsuTA1 ve SsuTA2 sırasıyla 82 amino asit artığı ve 106 amino asit kalıntısından oluşmaktadır. SsuTA1’in indirgenmiş protein sekansı, SsuTA2’ninki ile yüksek benzerlik paylaştı, önemli bir fark SsuTA2’deki C-terminali 24-artık uzantısıydı. SsuTA1 ve SsuTA2’de çok sayıda sistein kalıntısı ve birkaç bitişik p-tabaka gözlenmiştir. SsuMPs, 68.29 kDa’lık bir moleküler kütle içeren 594 amino asit tortusuna sahipti. Birincil dizi analizi SsuMP’lerin bir çinko bağlayıcı motif (HEIGHSLGLAHS) ve metiyonin dönüş motifi (YIM) içerdiğini göstermiştir. Filogenetik analizler SsuTA1 ve SsuTA2’nin diğer α-nörotoksinlerden erken ayrışmasını ve bağımsız evrimini ortaya çıkardı.

Sonuç

Sonuçlar sentipede S. subspinipes mutilans’ın eski bir zehirli artropod üyesi olduğunu, ancak zehirinin yeni bir senaryo sergilediğini ortaya koymuştur.

Keywords: Deduced protein sequences; Alpha-like-neurotoxin; Metalloproteinase; Scolopendra subspinipes mutilans; Neglect group
Anahtar Kelimeler: Ortaya çıkan protein dizileri; Alfa benzeri nörotoksin; Metalloproteinaz; Scolopendra subspinipes mutilans; İhmal grubu

Introduction

Venomous animals are an important group of animal kingdom. Their venomous glands can generate a variety of toxins composed of small polypeptides which can act on multiple sites of preys and/or predators [1], [2]. In addition, these glands produce few water-soluble enzymes which are contribute to digested of food and facilitate the action of other toxic components of the venom [3]. Interestingly, these small polypeptides and enzymes also function as important role on the neuromuscular system, the vascular system, the blood coagulation cascade and membrane integrity and so on [4], [5]. Therefore, some enzymes and polypeptides have also been attained great concern and their functions are gradually been shed light [6], [7].

Centipedes, one important group of arthropods, are belong to the chilopod class. The body is composed of head and thorax. Each thorax segment has one pair of ambulatory legs besides of the one in the hindmost segment where these structures are involved into mechanical defense and/or sensory purposes [8]. Another pair of modified legs is named the forcipules and sited at the post-cephalic segment. A venom gland is located at the femoral part of the forcipule. The venom is used to subjugate prey and defense against predators [9]. Unlike scorpions, spider and insect, venom systems of them are extensively studied, a few studies are reported about the ancient venom system of centipedes.

Alpha-neurotoxins are classified into different groups based on the preferential toxicity to mammals or insects as well as their differential binding properties (classical alpha-mammal, alpha-like neurotoxins and alpha-insect neurotoxins) [10]. A number of alpha-neurotoxin sequences had been cloned and characterized from snake, scorpion and spider [11], [12], [13]. Venom metalloprotease is an important part of venom and generally regarded as a hemorrhagic factor that is associated with degrading extracellular matrix and preventing blood clot formation [14], [15]. Now, metalloproteases have been reported on various venomous animals, these enzymes seems to act primarily as haemorrhagins [16], [17]. As to out known, the full alpha-neurotoxin and metalloprotease sequences from centipede venom are not reported [8].

An important way in understanding the increased functional diversity of secretions is to identify and characterize these proteins and small polypeptides from different organisms [18], [19]. In the previous study, we have isolated metalloprotease and hyaluronidase from venom of scorpion Buthus martensi [20], [21]. Centipede Scolopendra subspinipes mutilans is a traditional Chinese medicine and has been successfully used to treat immune-related diseases, especially rheumatoid arthritis [22], [23], [24]. In the current study, two novel sequences of alpha-like-neurotoxin and one metalloprotease sequence were cloned from the centipede S. subspinipes mutilans venom for the first time, and molecular structures of these sequences were elucidated by bioinformatic methods.

Materials and methods

Venom

Centipedes were brought from special animal farm of Nanyang and identified as S. subspinipes mutilans which is also named as S. subspinipes subspinipes by current taxonomy. The fresh centipede maxillipeds were dissected, snap frozen in liquid nitrogen and stored at −80°C until use.

Total RNA isolation and reverse transcription

Total RNA was isolated from maxillipeds using TRIzol (Takara, Dalian, China) according to the manufacturer’s protocol. The integrity of RNA was monitored by 1.2% agarose gel electrophoresis. The concentration of RNA was accurately calculated by the ratio of the OD260/OD280. The reverse transcription was carried out based on M-MLV First-Strand cDNA synthesis Kit (Takara, Dalian, China) instructions using the DNase I (Takara, Dalian, China)-treated total RNA as template and Oligo (dT18)-adaptor as primer (Takara, Dalian, China). The reaction mixtures were treated at 72°C for15 min, next incubated at 42°C for 1 h, and last terminated by heating at 72°C for 10 min. The reverse transcription product was diluted to 1:50 and stored at −80°C for following use.

Cloning of S. subspinipes mutilans alpha-like-neurotoxin and metalloproteinase

Degenerate primers of Ssu1 and Ssu2, Sp1 and Sp2 (Table 1) were designed according to alpha-neurotoxin gene sequences and used to amplify alpha-like-neurotoxin and metalloproteinases derived from snake Trimeresurus stejnegeri and Agkistrodon piscivorus leucostoma, spider Loxosceles intermedia and scorpion Buthus martensii and Mesobuthus eupeus, respectively. PCR were performed in 25 μL using 3 μL buffer (1.5 mM MgCl2), 0.5 U Taq polymerase (Takara, Dalian, China), 1 μL primer (100 nM, each), 1 μL of reverse transcription products, 2 μL dNTPs (250 μM each), and 17.5 μL water. The cycle parameters were as follows: an initial denaturation at 94°C for 4 min, 35 cycles of 94°C for 40 s, 48°C for 30 s, 72°C for 45 s and 72°C for 8 min. The PCR product was subcloned into the pMDT-19 vector (Takara, Dalian, China), sequenced from both directions (Takara, Dalian, China) and identified alpha-like-neurotoxin and metalloproteinases partial cDNA sequences.

Table 1:

Sequences of PCR primers.

PrimerSequence (5′–3′)
Ssu1CTTCNBCTNATGANAGGTNTGG
Ssu2GCACCANCAGGCNTTNCNGTAT
SP1GANGAAGACGGTCCTCTAAC
SP2ATGNGCCGNTTCGTGAGC
5′ Race InnerprimerCATGGCTACATGCTGACAGCCTA
5′ Race OuterprimerCGCGGATCCACAGCCTACTGATGATCAGTCGATG
Ssu5-1GTAACCTTCGTCCATCGTCTGC
Ssu5-2CAAACCGAACCGAGCGAGA
MP5-1G CAAACCGAACCGAGCGAGA
MP5-2TAACCTTCGTCCATCGTCTGC
3′ Race OuterprimerTACCGTCGTTCCACTAGTGATTT
3′ Race InnerprimerCGCGGATCCTCCACTAGTGATTTCACTATAGG
Ssu3-1GAGAACGGTGCTGATAGTGG
Ssu3-2ACAGGTGTGGTGAGTGGAC
MP3-1GATGGATTCTCGGGAAACG
MP3-2GTATGCGATTGTGAAGGAAG

Highly stringent primers were designed from the partial cDNA sequences and used to characterize the 5′ and 3′ regions of the alpha-like-neurotoxin and metalloproteinase cDNAs by RACE-PCR (Takara, Dalian, China) following the manufacturer’s protocol. 5′ Raceouter primer and Ssu5-1 (Table 1) were used for the first-round PCR of 5′ RACE, 3′ Raceouter primer and Ssu3-1 (Table 1) for the first-round PCR of 3′ RACE, respectively. Next, the first-round PCR products were used as the template to perform the nested PCR using Raceinner primers (5′ iner, 3′ iner) included in the kit, and gene specific primers Ssu5-2, Ssu3-2 (Table 1). Last, the 5′ RACE and 3′ RACE PCR products were cloned and five clones were sequenced using the method described above. Based on mentioned methods, MP5-1 and MP5-2 as well as MP3-1 and MP3-2 were used to isolate the 5′ RACE and 3′ RACE PCR products of metalloproteinase.

Sequence and phylogenetic analysis

The alpha-like-neurotoxin and metalloproteinase gene sequences from S. subspinipes mutilans were analyzed and compared using the BLASTX and BLASTP programs with a GenBank database search (www. ncbi.nlm.nih.gov/blast). The signal peptide was predicted by SignalP program (http://www.cbs.dtu.dk/services/SignalP). The multiple sequence alignment was performed using the DANMEN analysis program. The theoretical amino acid composition, isoelectric point and molecular weight (Mw) were computed using the Expasy ProtParam Tool (http://web.expasy.org/protparam/). N-glycosylation sites (N-X-S/T) were predicted with the NetNGlyc1.0 Server (http://www.cbs.dtu.dk/services/NetNGlyc/). Phosphorylation sites were performed with the NetPhos 2.0 Server (http://www.cbs.dtu.dk/services/NetPhos/). Prediction of secondary structure was fulfilled by CLC Protein Workbench 6 software as well as SMART research tool (http://smart.embl.de/). The tertiary structure was predicted by SWISS-MODEL software (http://www.swissmodel.expasy.org/). The phylogenetic tree constructed from the alignment was generated by the neighbor-joining method using MEGA5.0 software. The reliability of the tree obtained was assessed by bootstrapping, using 1000 bootstrap replications.

Results

cDNA and the deduced protein characterizations of alpha-like-neurotoxin and metalloproteinase

Two novel alpha-like-neurotoxins from S. subspinipes mutilans were cloned and, respectively, named as SsuTA1 (accession number AAF2075864) and SsuTA2 (accession number AAF2075860). Full length cDNA of SsuTA1 was 491 bp in length containing 20 bp of 5′ untranslated region (UTR), 246 bp of open reading frame (ORF) contained 82 amino acids with a calculated molecular mass of 9.16 kDa and a theoretical pI of 8.75, and 225 bp of 3′ UTR (Figure 1). A termination signal (AATAAA) was located at the positions 439–441 in the 3′ UTR. SsuTA2 was 566 bp cDNA sequence including 318 bp of ORF contained 106 amino acids with a calculated molecular mass of 11.9 kDa and a theoretical pI of 9.0, and a termination signal (AATAAA) in 3′ UTR (Figure 1). Characterization of cysteine-rich was observed in both of them, in which seven Cys residues in SsuTA1 account for 21% of the sequence and seven Cys residues in SsuTA2 for 13% of the sequence. A signal peptide composed of 33 deduced amino acids in 5′ UTR were, respectively, observed in the SsuTA1 and SsuTA2. No N-glycosylation site was observed in SsuTA1 and SsuTA2. Analysis of potential phosphorylation sites with NetPhos 2.0 showed that SsuTA1 and SsuTA2 contained five serine phosphorylation sites, two threonine phosphorylation sites, and four tyrosine phosphorylation sites (Figure 1).

Figure 1: Complete cDNA and deduced amino acid sequences of SsuTA1 and SsuTA2.(A) shows the sequence of SsuTA1, (B) the sequence of SsuTA2. Start and stop codons are marked with bold. The signal region is indicated with single underlined. Putative polyadenylation signal “AATAAA” is shown with wavy line. Putative phosphorylation sites are marked with blue and underline.
Figure 1:

Complete cDNA and deduced amino acid sequences of SsuTA1 and SsuTA2.

(A) shows the sequence of SsuTA1, (B) the sequence of SsuTA2. Start and stop codons are marked with bold. The signal region is indicated with single underlined. Putative polyadenylation signal “AATAAA” is shown with wavy line. Putative phosphorylation sites are marked with blue and underline.

The full length metalloproteinase was isolated from S. subspinipes mutilans and named SsuMPs. cDNA of SsuMPs was 2015 bp in length comprising 134 bp of 5′ untranslated region (UTR), 1782 bp of open reading frame encoded a protein of 594 amino acids, and 99 bp of 3′ UTR (accession number AAF2075872) (Figure 2). A termination signal (AATAAA) was detected at the positions 1986–1991 in the 3′ UTR (Figure 2). After analysis of deduced protein sequence by SignalP program, it consists of a 15-residue signal region containing the initial ATG cordon was detected in the 5′ UTR (Figure 2). Conserved motif HEXXHXXGXXHS in metalloproteinase was also observed in SsuMPs, in which variable amino acid X including Ile residue, Gly residue, Ser residue, Ala and 2 Leu residues (Figure 2). Five N-glycosylation sites was observed in SsuMPs. Analysis of potential phosphorylation sites with NetPhos 2.0 showed that SsuMPs contained 27 serine phosphorylation sites, 41 threonine phosphorylation sites, and 10 tyrosine phosphorylation sites (Figure 2).

Figure 2: Complete cDNA and deduced amino acid sequences of ScsuMPs.Start and stop codons are marked with bold. The signal region is indicated with single underline. The zinc-binding motif is marked with yellow and boxed. The methionine-turn motifs are marked by a wavy underline. Putative polyadenylation signal “AATAAA” is shown with with dot. Putative phosphorylation sites are marked with bold and underline.
Figure 2:

Complete cDNA and deduced amino acid sequences of ScsuMPs.

Start and stop codons are marked with bold. The signal region is indicated with single underline. The zinc-binding motif is marked with yellow and boxed. The methionine-turn motifs are marked by a wavy underline. Putative polyadenylation signal “AATAAA” is shown with with dot. Putative phosphorylation sites are marked with bold and underline.

Multiple sequence alignment of alpha-like-neurotoxin and metalloproteinase

Deduced protein sequence of SsuTA1 showed 75% identity with that of SsuTA2, the major difference was occurred in the C-terminal (Figure 3). Conserved resides of amino acids Leu25, Gly29, Val30, Ser31, Asp35, Ile38 in N-terminal was observed and showed a high homology with that of scorpions (Figure 3).

Figure 3: Comparison of deduced amino acid sequences of SsuTA1 and SsuTA2 with other members of alpha-neurotoxins.The result of homology with less than or equal to 75% is showed with pink. The result of homology with less than or equal to 50% is marked with green. Mesobuthus eupeus (accession number ABR21068), Mesobuthus martensii (accession number AAA69557), Hottentotta judaicus (accession number CBW45614), Buthus occitanus israelis (accession number ACJ23095), Apis mellifera (accession number NP_001011612.1), Haplopelma schmidti (accession number AAP33077.1), Micrurus corallinus (accession number AAF13252.1), Micrurus laticollaris (accession number AFU76493.1).
Figure 3:

Comparison of deduced amino acid sequences of SsuTA1 and SsuTA2 with other members of alpha-neurotoxins.

The result of homology with less than or equal to 75% is showed with pink. The result of homology with less than or equal to 50% is marked with green. Mesobuthus eupeus (accession number ABR21068), Mesobuthus martensii (accession number AAA69557), Hottentotta judaicus (accession number CBW45614), Buthus occitanus israelis (accession number ACJ23095), Apis mellifera (accession number NP_001011612.1), Haplopelma schmidti (accession number AAP33077.1), Micrurus corallinus (accession number AAF13252.1), Micrurus laticollaris (accession number AFU76493.1).

Our previous study showed that methionine-turn motif of metalloproteinase in scorpion venom is YIM not CIM. Here, similar phenomenon was also observed. Like metalloproteinase of B. martensi, YIM was also located at HEXXHXXGXXHS downstream in where a turn motif was formed from secondary structure (Figure 4).

Figure 4: Comparison of the deduced amino acid sequence of ScsuMPs with other members of metalloproteinase.The result of homology with less than or equal to 75% is showed with pink. The result of homology with less than or equal to 50% is marked with green. Buthus martensii (accession number KF492696.1), Mesobuthus eupeus (accession number ABR20110.1), Hottentotta judaicus (accession number ADY39479.1), Nasonia vitripennis (accession number XP_008212814.1), Acromyrmex echinatior (accession number ACV83935.1).
Figure 4:

Comparison of the deduced amino acid sequence of ScsuMPs with other members of metalloproteinase.

The result of homology with less than or equal to 75% is showed with pink. The result of homology with less than or equal to 50% is marked with green. Buthus martensii (accession number KF492696.1), Mesobuthus eupeus (accession number ABR20110.1), Hottentotta judaicus (accession number ADY39479.1), Nasonia vitripennis (accession number XP_008212814.1), Acromyrmex echinatior (accession number ACV83935.1).

Second and 3D structures of alpha-like-neurotoxin and metalloproteinase

Results of predicted secondary structure showed that six beta-sheets are successively formed in SsuTA1 and six beta-sheets in SsuTA2 (Figure 5), assuming SsuTA1 and SsuTA2 possesses the three-finger feature of alpha-toxins. Notably, one alpha-helix was observed in the predicted secondary structure of SsuTA2. The alignments of SsuTA1 and SsuTA2 3D structure of showed a potential similarity with that of alpha-neurotoxins (Figure 6). The alignments of SsuMPs secondary and 3D structures of showed a similarity with that of metalloproteinases and collagenases (Figures 7 and 8).

Figure 5: Predicted secondary structures of SsuTA1 and SsuTA2 from S. subspinipes mutilans.(A) shows the predicted secondary structure of SsuTA1 by CLC Protein Workbench 6 software. (B) shows the predicted secondary structure of SsuTA2 by SMART research tool.
Figure 5:

Predicted secondary structures of SsuTA1 and SsuTA2 from S. subspinipes mutilans.

(A) shows the predicted secondary structure of SsuTA1 by CLC Protein Workbench 6 software. (B) shows the predicted secondary structure of SsuTA2 by SMART research tool.

Figure 6: Predicted 3D structures of SsuTA1 and SsuTA2.(A) shows the predicted 3D structure of SsuTA1 by Swiss-model, (B) shows the predicted 3D structure of SsuTA2 by Swiss-model. Formation of 3D structures of SsuTA1 and SsuTA2 is mainly based on the insecticidal alpha scorpion toxin (PDB ID:1LQH).
Figure 6:

Predicted 3D structures of SsuTA1 and SsuTA2.

(A) shows the predicted 3D structure of SsuTA1 by Swiss-model, (B) shows the predicted 3D structure of SsuTA2 by Swiss-model. Formation of 3D structures of SsuTA1 and SsuTA2 is mainly based on the insecticidal alpha scorpion toxin (PDB ID:1LQH).

Figure 7: Predicted secondary structure of ScsuMPs.The secondary structure is predicted by SMART research tool.
Figure 7:

Predicted secondary structure of ScsuMPs.

The secondary structure is predicted by SMART research tool.

Figure 8: Predicted 3D structure of ScsuMPs from S. subspinipes.3D structure is predicted by Swiss-model. Formation of 3D structure of ScsuMPs is mainly based on the metalloproteinase-9 (PDB ID:5UE3).
Figure 8:

Predicted 3D structure of ScsuMPs from S. subspinipes.

3D structure is predicted by Swiss-model. Formation of 3D structure of ScsuMPs is mainly based on the metalloproteinase-9 (PDB ID:5UE3).

Sequence homology and phylogenetic analysis of alpha-like-neurotoxin and metalloproteinase

Similarity analysis by NCBI BLAST program showed that the deduced amino acid sequence of SsuTA2 share a high similarities with alpha-neurotoxin of scorpion, such as 64% Mesobuthus martensii (accession number AAA69557), 59% Buthus occitanus Israelis (accession number ACJ23095), 57% Mesobuthus eupeus (accession number ABR21068), and 52% Hottentotta judaicusthe (accession number CBW45614). Similar phenomenon was also detected in SsuTA1. It was showed that 65% of bootstrap value is observed between SsuTA1 and SsuTA2, and scorpion such as M. martensii (accession number AAA69557), H. judaicusthe (accession number CBW45614) and M. eupeus (accession number ABR21068), 90% bootstrap values find between B. occitanus Israelis (accession number ACJ23095) and species above mentioned. These species among of centipede and scorpion have only 28% of bootstrap value with others including of insect, snake and spider. The results suggest that a high probability of monophyly is supported by available data presented from SsuTA1 and SsuTA2, and scorpion. Phylogenetic analysis of sequences provides evidence that SsuTA1 and SsuTA2 were closest to the alpha-neurotoxin of scorpion (Figure 9).

Figure 9: A molecular phylogenic tree of different species alpha-neurotoxin based on the neighbor-joining method.The α-toxins of S. subspinipes mutilans were underlined. Buthus occitanus israelis (accession number ACJ23095), Mesobuthus martensii (accession number AAA69557), Mesobuthus eupeus (accession number ABR21068), Hottentotta judaicus (accession number CBW45614), Apis mellifera (accession number NP_001011612.1), Laticauda semifasciata (accession number CAA26373.1), Aipysurus laevis (accession number CAA31747 ), Micrurus altirostris (accession number AED89566.1), Micrurus laticollaris (accession number AFU76493.1), Micrurus corallinus (accession number AAF13252.1), Haplopelma schmidti (accession number AAP33077.1), Rhodnius prolixus (accession number JAA77161.1), Phoneutria nigriventer (accession number AAC26166).
Figure 9:

A molecular phylogenic tree of different species alpha-neurotoxin based on the neighbor-joining method.

The α-toxins of S. subspinipes mutilans were underlined. Buthus occitanus israelis (accession number ACJ23095), Mesobuthus martensii (accession number AAA69557), Mesobuthus eupeus (accession number ABR21068), Hottentotta judaicus (accession number CBW45614), Apis mellifera (accession number NP_001011612.1), Laticauda semifasciata (accession number CAA26373.1), Aipysurus laevis (accession number CAA31747 ), Micrurus altirostris (accession number AED89566.1), Micrurus laticollaris (accession number AFU76493.1), Micrurus corallinus (accession number AAF13252.1), Haplopelma schmidti (accession number AAP33077.1), Rhodnius prolixus (accession number JAA77161.1), Phoneutria nigriventer (accession number AAC26166).

Similarity analysis of NCBI BLAST showed the deduced amino acid sequence of SsuMPs has different-degree similarities with various metalloproteinases families, such as 42% homology with matrix metalloproteinase-14 of Apis dorsata (accession number XP_006610526.1), 41% with matrix metalloproteinase-24 of Nasonia vitripennis (accession number XP_008212814.1), 38% with matrix metalloproteinase-16 of Ceratitis capitata (accession number XP_004520956.1), 40% with matrix metalloproteinase-17 of Danio rerio (accession number XP_698601.6). Available data from phylogenetic analysis revealed that SsuMPs sequence is most closed to insect Culex quinquefasciatus (accession number XP_001843240) and Zootermopsis nevadensis (accession number KDR20064), next to vertebrate metalloproteinase Danio rerio (accession number XP_698601.6) and Bos taurus (accession number XP_590696.3), third to scorpion Hottentotta judaicus (accession number ADY39479.1) and B. martensii (accession number KF492696), last to snake Trimeresurus stejnegeri (accession number ABC73079.1) and Agkistrodon piscivorus (accession number ACV83935.1) (Figure 10). However, the bootstrap is only 54% between SsuMPs and others of metalloproteinases (Figure 10). The result reflects early divergence and independent evolution of SsuMPs from other metalloproteinases. Notably, SsuMPs only shares 8.44% and 9.82% similarities with scorpion B. martensii (accession number KF492696) and H. judaicus (accession number ADY39479.1), and 12.19% with insects Acromyrmex echinatior (accession number EGI70348.1), respectively (Figure 10).

Figure 10: A molecular phylogenic tree of different species metalloprotease based on the neighbor-joining method.The ScsuMPs were underlined. Zootermopsis nevadensis (accession number KDR20064), Culex quinquefasciatus (accession number XP_001843240), Nasonia vitripennis (accession number XP_008212814.1), Apis dorsata (accession number XP_006610526.1), Ceratitis capitata (accession number XP_004520956.1), Ixodes scapularis (accession number XM_002413437), Danio rerio (accession number XP_698601.6), Lepisosteus oculatus (accession number XP_006640454.1), Bos taurus (accession number XP_590696.3), Trimeresurus stejnegeri (accession number ABC73079.1), Agkistrodon piscivorus leucostoma (accession number ACV83935.1), Hottentotta judaicus (accession number ADY39479.1), Buthus martensii (KF492696).
Figure 10:

A molecular phylogenic tree of different species metalloprotease based on the neighbor-joining method.

The ScsuMPs were underlined. Zootermopsis nevadensis (accession number KDR20064), Culex quinquefasciatus (accession number XP_001843240), Nasonia vitripennis (accession number XP_008212814.1), Apis dorsata (accession number XP_006610526.1), Ceratitis capitata (accession number XP_004520956.1), Ixodes scapularis (accession number XM_002413437), Danio rerio (accession number XP_698601.6), Lepisosteus oculatus (accession number XP_006640454.1), Bos taurus (accession number XP_590696.3), Trimeresurus stejnegeri (accession number ABC73079.1), Agkistrodon piscivorus leucostoma (accession number ACV83935.1), Hottentotta judaicus (accession number ADY39479.1), Buthus martensii (KF492696).

Discussion

Close inspection of SsuTA1 and SsuTA2 sequences showed characterizations of cysteine-rich was observed in both of them, it greeting with that of spider and snake alpha-neurotoxins [13], [25]. Generally, the profile of C1X6C2X3C3XC4C5X4C6XC7XmC8XC9XnC10 derived from three-terminal is considers as one common folding pattern in snake alpha-neurotoxins [26]. Notably, distributions of Cys residue in SsuTA1 and SsuTA2 was consistent with alpha-neurotoxins of scorpionida Buthus occitanus Israelis, Mesobuthus martensii, Mesobuthus eupeus, and Hottentotta judaicus, but not with snake Micrurus altirostris and spider Phoneutria nigriventer, reveals that is likely associated with the adaptive evolution. Scorpion alpha-neurotoxins are classified into three major groups based on the preferential toxicity to mammals or insects as well as their differential binding properties (classical alpha-mammal, alpha-insect neurotoxins and alpha-like neurotoxins). Classical alpha-mammal neurotoxins bind with high affinity to rat brain (voltage-gated sodium channels, VGSCs) and are highly toxic to mammals, while they are practically non-toxic to insects. Alpha-insect Neurotoxins bind to insect VGSCs with high affinity and are very active in insects but less potent in mammals. Alpha-like Neurotoxins, which could not bind to rat brain synaptosomes, are active in both mammal and insect nervous systems [27]. Adaptive evolution of scorpion neurotoxins and ion channels have also been constructed on the basis of genomic organization, structure and pharmacology of toxin and ion channels, as well as scorpion species distribution [27], [28]. The difference of function and components in scorpion venom may reflect the positive selectivity and adaptive evolution process of scorpion species under environmental pressure. Toxins of centipede are beneficial for catching their prey and defending against their predators. Base on apparent difference of structural properties, these findings suggest that SsuTA1 and SsuTA2 are likely evolutionary intermediate neurotoxins for alpha-toxin.

In the SsuTA1 and SsuTA2, the amino acids Leu25, Gly29, Val30, Ser31, Asp35, Ile38 of N-Terminal showed a high homology with that of scorpions. In snakes, it is defined that conserved residues of Gln7, Ser8, Gln10, Trp29, Asp31, His32, Val47 and Lys48 in the N-terminal derived from alpha-neurotoxin function as a crucial player to bind the acetylcholine receptor [13], [25], [29], [30]. Replacement of these amino acids results in decline of affinity of toxin to the acetylcholine receptor. It is speculated that these conserved residues in SsuTA1 and SsuTA1 likely play a potential role in binding acetylcholine receptor, but this hypothesis need be elucidated in the future.

Secondary structure showed six beta-sheets are successively formed in SsuTA1 and seven beta-sheets in SsuTA2, assuming SsuTA1 and SsuTA2 possesses the three-finger feature of alpha-toxins. It is suggested that the three-finger alpha-toxins share a similar structural scaffold formed by three adjacent (generally referred to as fingers) beta-sheets stabilized by four conserved disulfide bridges [31], [32]. Amazingly, SsuTA2 had eight Cys residues which contribute to form four conserved disulfide bridges except of adjacent beta-sheets. However, the deduced protein sequence of SsuTA1 only contain seven Cys residues and does not equate to the mature peptide. Undoubetdly, this phenomena is need be elucidated in the next study. An additional feature of resemblance to the alpha-toxins is revealed by SsuTA1 and SsuTA2 spatial arrangement, as obtained using a 3D structure. They possess the basic formation composed of a alpha-helix located on one face of the molecule and antiparallel beta-strands on the opposite face that is similar with those of alpha-toxins from scorpion [28], [33].

As to arthropod, venom of scorpions, spiders and centipedes are beneficial for catching their prey and defending against their predators [34]. Our previous study showed that the protein sequence of B. martensi metalloproteinase share a high identify with snakes, insects and spiders [20]. In the present work, it is expected that the centipede metalloproteinase sequences would resemble sequences from other venomous arthropods, such as arachnids (spiders and scorpions) and insects. However, this was proven otherwise. Notably, SsuMPs only shares 8.44% and 9.82% similarities with scorpion B. martensii and H. judaicus, and 12.19% with insects Acromyrmex echinatior, respectively. The lack of observed similarities between SsuMPs and metalloproteinases from other arthropods might be partly explained the ancient and independent evolutionary history of the centipede venom system [35]. It has been estimated that the myriapod group diverged from the chelicerata at 642±63 million years ago [24]. Moreover, the venom apparatus of centipedes can be regarded as an invaginated cuticle and epidermis, consisting of numerous epithelial secretory units each with its own unique valve-like excretory system, and have evolved from non-homologous structures [8].

Meanwhile, it also assuming that SsuMPs likely do not primarily function as haemorrhagins. Similar views have also been reported. It has found that centipede S. morsitans maxilliped extract had fibrinolytic activity, while centipede O. pradoi and S. viridicornis venoms both showed weak fibrinogenolytic activity [24]. However, based on a skin test, it was showed that only S. viridicornis exhibited hemorrhagic activity, which was still very low compared to that of snake Bothrops jararaca [8]. Recurrent symptoms associated with centipede bites showed that centipede venom metalloproteinase is likely involved in skin damage, edema, blister formation, myonecrosis and inflammation. Meanwhile, venom of centipede S. subspinipes has a strong anticoagulant activity [36]. Interestingly, a set of human bioactive peptides are the targets acted by venom of scorpion Tityus serrulatus [37]. In this way, it is suggested that these venom metallopeptidases contribute to the envenomation process [37]. In the snake, inflammatory effect induced by B. jararaca venom has been shown to be mainly due to the activity of metalloproteinases [38]. A non-hemorrhagic metalloprotease with strong myotoxicity has been described from the venom of snake Macrovipera lebetina. In addition, the snake venom metalloproteinases derived from (SVMP) have been classified in three classes (PI, PII and PIII) on the basis of their domain composition. In the mature protein, PI SVMPs comprise the metalloproteinase domain only, whereas PII SVMPs present a disintegrin (Dis) domain in addition to the catalytic domain. On the other hand, PIII SVMPs present metalloproteinase, disintegrin-like (Dis-like), and cysteine-rich (Cys-rich) domains [39], [40]. In our previous study, high-conserved cysteinyl residues are mainly observed in the C-terminus of metalloproteinases of scorpion B. martensi (BumaMPs1) assuming BumaMPs1 is likely one member of PIII [20]. Here, these characterizations are not detected in the SsuMPs. Therefore, we postulate that SsuMPs is likely one member of PI metalloproteinase family although the exact classical standard of metalloproteinase in invertebrate is not available. Considering here, great efforts are required to elucidate the functions of SsuMPs in the future.

Acknowledgement

This research was funded by the National Natural Science Foundation of Henan (No. 18A330004, PXY-BSQD-2018009, 17A180010, PXY-PYJJ-2018005) and China Postdoctoral Science Foundation Funded Project (2016M590143).

  1. Conflict of interest statement: The authors declare that there are no conflicts of interest.

References

1. Fry BG. Structure-function properties of venom components from Australian elapids. Toxicon 1999;37:11–32.10.1016/S0041-0101(98)00125-1Suche in Google Scholar

2. Kochva E. The origin of snakes and evolution of the venom apparatus. Toxicon 1987;25:65–106.10.1016/0041-0101(87)90150-4Suche in Google Scholar PubMed

3. Kordis D, Gubensek F. Adaptive evolution of animal toxin multigene families. Gene 2000;261:43–52.10.1016/S0378-1119(00)00490-XSuche in Google Scholar PubMed

4. Rodríguez de la Vega RC, Schwartz EF, Possani LD. Mining on scorpion venom biodiversity. Toxicon 2010;56:1155–61.10.1016/j.toxicon.2009.11.010Suche in Google Scholar PubMed

5. Sunagar K, Undheim EA, Chan AH, Koludarov I, Muñoz-Gómez SA, Antunes A, et al. Evolution stings: the origin and diversification of scorpion toxin peptide scaffolds. Toxins 2013;5:2456–87.10.3390/toxins5122456Suche in Google Scholar PubMed PubMed Central

6. Mearini L, Giannantoni A. Botulinum toxin A in prostate disease: a venom from bench to bed-side. Curr Drug Deliv 2012;9:85–94.10.2174/156720112798375970Suche in Google Scholar PubMed

7. Jackson TN, Sunagar K, Undheim EA, Koludarov I, Chan AH, Sanders K, et al. Venom down under: dynamic evolution of Australian elapid snake toxins. Toxins 2013;5:2621–55.10.3390/toxins5122621Suche in Google Scholar PubMed PubMed Central

8. Undheim EA, King GF. On the venom system of centipedes (Chilopoda), a neglected group of venomous animals. Toxicon 2011;57:512–24.10.1016/j.toxicon.2011.01.004Suche in Google Scholar PubMed

9. Lewis JGE. The scolopendromorph centipedes of Mauritius and Rodrigues and their adjacent islets (Chilopoda: Scolopendromorpha). J Nat Hist 2002;36:79–106.10.1080/00222930110098508Suche in Google Scholar

10. Luo S, Zhangsun D, Wu Y, Zhu X, Hu Y, McIntyre M, et al. Characterization of a novel α-conotoxin from conus textile that selectively targets α6/α3β2β3 nicotinic acetylcholine receptors. J Biol Chem 2013;288:894–902.10.1074/jbc.M112.427898Suche in Google Scholar PubMed PubMed Central

11. Graudins A, Little MJ, Pineda SS, Hains PG, King GF, Broady KW, et al. Cloning and activity of a novel α-latrotoxin from red-back spider venom. Biochem Pharmacol 2012;83:170–83.10.1016/j.bcp.2011.09.024Suche in Google Scholar PubMed

12. Silveira de Oliveira J, Rossan de Brandão Prieto da Silva A, Soares MB, Stephano MA, de Oliveira Dias W, Raw I, et al. Cloning and characterization of an alpha-neurotoxin-type protein specific for the coral snake Micrurus corallinus. Biochem Biophys Res Commun 2000;267:887–91.10.1006/bbrc.1999.2033Suche in Google Scholar PubMed

13. Carbajal-Saucedo A, López-Vera E, Bénard-Valle M, Smith EN, Zamudio F, de Roodt AR, et al. Isolation, characterization, cloning and expression of an alpha-neurotoxin from the venom of the Mexican coral snake Micrurus laticollaris (Squamata: Elapidae). Toxicon 2013;66:64–74.10.1016/j.toxicon.2013.02.006Suche in Google Scholar PubMed

14. Gutiérrez JM, Rucavado A. Snake venom metalloproteinases: their role in the pathogenesis of local tissue damage. Biochimie 2000;82:841.10.1016/S0300-9084(00)01163-9Suche in Google Scholar

15. Hamza L, Girardi T, Castelli S, Gargioli C, Cannata S, Patamia M, et al. Isolation and characterization of a myotoxin from the venom of Macrovipera lebetina transmediterranea. Toxicon 2010;56:381–90.10.1016/j.toxicon.2010.04.001Suche in Google Scholar PubMed

16. Nagaraju S, Girish KS, Fox JW, Kemparaju K. “Partitagin” a hemorrhagic metalloprotease from Hippasapartita spider venom: role in tissue necrosis. Biochimie 2007;89:1322–31.10.1016/j.biochi.2007.04.005Suche in Google Scholar PubMed

17. Trevisan-Silva D, Gremski LH, Chaim OM, da Silveira RB, Meissner GO, Mangili OC, et al. Astacin-like metalloproteases are a gene family of toxins present in the venom of different species of the brown spider (genus Loxosceles). Biochimie 2010;92:21–32.10.1016/j.biochi.2009.10.003Suche in Google Scholar PubMed

18. Aird SD, Watanabe Y, Villar-Briones A, Roy MC, Terada K, Mikheyev AS. Quantitative high-throughput profiling of snake venom gland transcriptomes and proteomes (Ovophis okinavensis and Protobothrops flavoviridis). BMC Genomics 2013;14:790.10.1186/1471-2164-14-790Suche in Google Scholar PubMed PubMed Central

19. Li R, Zhang L, Fang Y, Han B, Lu X, Zhou T, et al. Proteome and phosphoproteome analysis of honeybee (Apis mellifera) venom collected from electrical stimulation and manual extraction of the venom gland. BMC Genomics 2013;14:766.10.1186/1471-2164-14-766Suche in Google Scholar PubMed PubMed Central

20. Xia X, Liu R, Li Y, Xue S, Liu Q, Jiang X, et al. Cloning and molecular characterization of scorpion Buthus martensi venom hyaluronidases: a novel full-length and diversiform noncoding isoforms. Gene 2014;547:338–45.10.1016/j.gene.2014.06.045Suche in Google Scholar PubMed

21. Xia X, Ma Y, Xue S, Wang A, Tao J, Zhao Y, et al. Cloning and molecular characterization of BumaMPs1, a novel metalloproteinases from the venom of scorpion Buthus martensi Karsch. Toxicon 2013;76:234–8.10.1016/j.toxicon.2013.10.006Suche in Google Scholar PubMed

22. Choi H, Hwang JS, Lee DG. Identification of a novel antimicrobial peptide, scolopendin 1, derived from centipede Scolopendra subspinipes mutilans and its antifungal mechanism. Insect Mol Biol 2014;23:788–99.10.1111/imb.12124Suche in Google Scholar PubMed

23. Yoo WG, Lee JH, Shin Y, Shim JY, Jung M, Kang BC, et al. Antimicrobial peptides in the centipede Scolopendra subspinipes mutilans. Funct Integr Genomics 2014;14:275–83.10.1007/s10142-014-0366-3Suche in Google Scholar PubMed

24. Rates B, Bemquerer MP, Richardson M, Borges MH, Morales RA, De Lima ME, et al. Venomic analyses of Scolopendra viridicornis nigra and Scolopendra angulata (Centipede, Scolopendromorpha): shedding light on venoms from a neglected group. Toxicon 2007;49:810–26.10.1016/j.toxicon.2006.12.001Suche in Google Scholar PubMed

25. Vassilevski AA, Sachkova MY, Ignatova AA, Kozlov SA, Feofanov AV, Grishin EV. Spider toxins comprising disulfide-rich and linear amphipathic domains: a new class of molecules identified in the lynx spider Oxyopes takobius. FEBS J 2013;280:6247–61.10.1111/febs.12547Suche in Google Scholar PubMed

26. Kozlov S, Malyavka A, McCutchen B, Lu A, Schepers E, Herrmann R, et al. A novel strategy for the identification of toxinlike structures in spider venom. Proteins 2005;59:131–40.10.1002/prot.20390Suche in Google Scholar PubMed

27. Chai ZF, Zhu MM, Bai ZT, Liu T, Tan M, Pang XY, et al. Chinese-scorpion (Buthus martensi Karsch) toxin BmK alphaIV, a novel modulator of sodium channels: from genomic organization to functional analysis. Biochem J 2006;399:445–53.10.1042/BJ20060035Suche in Google Scholar PubMed PubMed Central

28. Arnon T, Potikha T, Sher D, Elazar M, Mao W, Tal T, et al. BjalphaIT: a novel scorpion alpha-toxin selective for insects – unique pharmacological tool. Insect Biochem Mol Biol 2005;35:187–95.10.1016/j.ibmb.2004.11.005Suche in Google Scholar PubMed

29. Murakami MT, Kini RM, Arni RK. Crystal structure of bucain, a three-fingered toxin from the venom of the Malayan krait (Bungarus candidus). Protein Pept Lett 2009;16:1473–77.10.2174/092986609789839304Suche in Google Scholar PubMed

30. Zhu L, Peigneur S, Gao B, Tytgat J, Zhu S. Two recombinant α-like scorpion toxins from Mesobuthus eupeus with differential affinity toward insect and mammalian Na(+) channels. Biochimie 2013;95:1732–40.10.1016/j.biochi.2013.05.009Suche in Google Scholar PubMed

31. de Abreu VA, Leite GB, Oliveira CB, Hyslop S, Furtado Mde F, Simioni LR. Neurotoxicity of Micrurus altirostris (Uruguayan coral snake) venom and its neutralization by commercial coral snake antivenom and specific antiserum raised in rabbits. Clin Toxicol (Phila) 2008;46:519–27.10.1080/15563650701647405Suche in Google Scholar PubMed

32. Blacklow B, Kornhauser R, Hains PG, Loiacono R, Escoubas P, Graudins A, et al. α-Elapitoxin-Aa2a, a long-chain snake α-neurotoxin with potent actions on muscle (α1)2βγδ nicotinic receptors, lacks the classical high affinity for neuronal α7 nicotinic receptors. Biochem Pharmacol 2011;81:314–25.10.1016/j.bcp.2010.10.004Suche in Google Scholar PubMed

33. Gilles N, Krimm I, Bouet F, Froy O, Gurevitz M, Lancelin JM, et al. Structural implications on the interaction of scorpion alpha-like toxins with the sodium channel receptor site inferred from toxin iodination and pH-dependent binding. J Neurochem 2000;75:1735–45.10.1046/j.1471-4159.2000.0751735.xSuche in Google Scholar PubMed

34. Hoyle CH. Evolution of neuronal signalling: transmitters and receptors. Auton Neurosci 2011;165:28–53.10.1016/j.autneu.2010.05.007Suche in Google Scholar PubMed

35. Nischwitz S, Wolf C, Andlauer TF, Czamara D, Zettl UK, Rieckmann P, et al. MS susceptibility is not affected by single nucleotide polymorphisms in the MMP9 gene. J Neuroimmunol 2015;279:46–9.10.1016/j.jneuroim.2015.01.008Suche in Google Scholar PubMed

36. Bush SP, King BO, Norris RL, Stockwell SA. Centipede envenomation. Wilderness Environ Med 2001;12:93–9.10.1580/1080-6032(2001)012[0093:CE]2.0.CO;2Suche in Google Scholar

37. Cajado Carvalho D, Kuniyoshi AK, Kodama RT, Oliveira AK, Serrano SM, Tambourgi DV, et al. Neuropeptide Y family-degrading metallopeptidases in the Tityus serrulatus venom partially blocked by commercial antivenoms. Toxicol Sci 2014;142:418–26.10.1093/toxsci/kfu193Suche in Google Scholar

38. Zychar BC, Dale CS, Demarchi DS, Gonçalves LR. Contribution of metalloproteases, serine proteases and phospholipases A2 to the inflammatory reaction induced by Bothrops jararaca crude venom in mice. Toxicon 2010;55:227–34.10.1016/j.toxicon.2009.07.025Suche in Google Scholar

39. Hamza L, Gargioli C, Castelli S, Rufini S, Laraba-Djebari F. Purification and characterization of a fibrinogenolytic and hemorrhagic metalloproteinase isolated from Vipera lebetina venom. Biochimie 2010;92:797–805.10.1016/j.biochi.2010.02.025Suche in Google Scholar

40. Gutiérrez JM, Escalante T, Rucavado A, Herrera C. Hemorrhage caused by snake venom metalloproteinases: a journey of discovery and understanding. Toxins 2016;8:93.10.3390/toxins8040093Suche in Google Scholar

Received: 2017-11-27
Accepted: 2018-02-13
Published Online: 2018-03-28

©2018 Walter de Gruyter GmbH, Berlin/Boston

Artikel in diesem Heft

  1. Frontmatter
  2. Research Articles
  3. Effects of calcium hydroxide and N-acetylcysteine on MMP-2, MMP-9, TIMP-1 and TIMP-2 in LPS-stimulated macrophage cell lines
  4. Synthesis of fused 1,4-dihydropyridines as potential calcium channel blockers
  5. Optimization of fermentation conditions for efficient ethanol production by Mucor hiemalis
  6. Covalent immobilization of an alkaline protease from Bacillus licheniformis
  7. Major biological activities and protein profiles of skin secretions of Lissotriton vulgaris and Triturus ivanbureschi
  8. Optimized production, purification and molecular characterization of fungal laccase through Alternaria alternata
  9. Adsorption of methyl violet from aqueous solution using brown algae Padina sanctae-crucis
  10. Protective effect of dexpanthenol (vitamin B5) in a rat model of LPS-induced endotoxic shock
  11. Purification and biochemical characterization of a β-cyanoalanine synthase expressed in germinating seeds of Sorghum bicolor (L.) moench
  12. Molecular cloning and in silico characterization of two alpha-like neurotoxins and one metalloproteinase from the maxilllipeds of the centipede Scolopendra subspinipes mutilans
  13. Improvement of delta-endotoxin production from local Bacillus thuringiensis Se13 using Taguchi’s orthogonal array methodology
  14. Enhancing vitamin B12 content in co-fermented soy-milk via a Lotka Volterra model
  15. Species and number of bacterium may alternate IL-1β levels in the odontogenic cyst fluid
  16. Rheo-chemical characterization of exopolysaccharides produced by plant growth promoting rhizobacteria
  17. Benzo(a)pyrene degradation pathway in Bacillus subtilis BMT4i (MTCC 9447)
  18. Indices
  19. Reviewers 2018
  20. Yazar Dizini/Author Index
https://doi.org/10.1515/tjb-2018-0009
Schlagwörter für diesen Artikel
Deduced protein sequences; Alpha-like-neurotoxin; Metalloproteinase; Scolopendra subspinipes mutilans; Neglect group

Artikel in diesem Heft

  1. Frontmatter
  2. Research Articles
  3. Effects of calcium hydroxide and N-acetylcysteine on MMP-2, MMP-9, TIMP-1 and TIMP-2 in LPS-stimulated macrophage cell lines
  4. Synthesis of fused 1,4-dihydropyridines as potential calcium channel blockers
  5. Optimization of fermentation conditions for efficient ethanol production by Mucor hiemalis
  6. Covalent immobilization of an alkaline protease from Bacillus licheniformis
  7. Major biological activities and protein profiles of skin secretions of Lissotriton vulgaris and Triturus ivanbureschi
  8. Optimized production, purification and molecular characterization of fungal laccase through Alternaria alternata
  9. Adsorption of methyl violet from aqueous solution using brown algae Padina sanctae-crucis
  10. Protective effect of dexpanthenol (vitamin B5) in a rat model of LPS-induced endotoxic shock
  11. Purification and biochemical characterization of a β-cyanoalanine synthase expressed in germinating seeds of Sorghum bicolor (L.) moench
  12. Molecular cloning and in silico characterization of two alpha-like neurotoxins and one metalloproteinase from the maxilllipeds of the centipede Scolopendra subspinipes mutilans
  13. Improvement of delta-endotoxin production from local Bacillus thuringiensis Se13 using Taguchi’s orthogonal array methodology
  14. Enhancing vitamin B12 content in co-fermented soy-milk via a Lotka Volterra model
  15. Species and number of bacterium may alternate IL-1β levels in the odontogenic cyst fluid
  16. Rheo-chemical characterization of exopolysaccharides produced by plant growth promoting rhizobacteria
  17. Benzo(a)pyrene degradation pathway in Bacillus subtilis BMT4i (MTCC 9447)
  18. Indices
  19. Reviewers 2018
  20. Yazar Dizini/Author Index
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 26.12.2025 von https://www.degruyterbrill.com/document/doi/10.1515/tjb-2018-0009/html
Button zum nach oben scrollen