Heterologous expression of a plant WRKY protein confers multiple stress tolerance in E. coli Bir bitkinin heterolog ifadesi WRKY proteini çoklu stres yaratır E. coli’de tolerans

In silico analysis

The OsWRKY71 gene sequence was used as a query in BLAST with NCBI database for homology search. CLUSTALW (http://www.genome.jp/tools/clustalw/) online tool was used to align the protein sequences showing similarity with OsWRKY71 [16].

Plant materials

A stress tolerant variety of rice (Oryza sativa L. ssp. Indica) KS282 was used in present study, derived from Basmati370/CM70 [17]. The rice seeds were received from National Agricultural Research Centre (NARC) Islamabad. KS282 is derived from Basmati370/CM70, salt tolerant variety. Seeds were grown on MS medium (half-strength) and placed at 25°C in plant growth room for 10 days.

Cloning and over-expression of OsWRKY71 in E. coli

Ten-day old rice seedlings were used to extract whole RNA using the RNeasy mini kit from QIAGEN according to the instructions provided by the manufacturer. Then cDNA was synthesized using RevertAid Premium Reverse Transcriptase (Thermo Scientific, Waltham, USA) using commercially synthesized Oligo (dT) 18 primer. DNA binding domain containing region of OsWRKY71 was PCR amplified from cDNA using specific primers [Forward 5’-CGCGGATCCATGCGCATCCGCGAGGAG-3’ (BamHI), reverse 5’-CCGCTCGAGTCAGGCGCTCTTGCCGGA-3’ (XhoI)]. The specific sequence for restriction enzyme is underlined in the primer sequence. The amplified PCR product was gel purified, subjected to restriction digestion with BamH1 and XhoI followed by ligation in between BamHI and XhoI sites of the pGEX4T-1 vector (Amersham Pharmacia Biotech, Little Chalfont, UK). The pGEX4T-1 vector is designed for bacterial expression under the control of the tac promoter. The vector contains lacIq gene, the product of which interacts with the operator region and avoids its expression until its expression is induced by IPTG, hence upholding firm regulation on expression of the sequence inserted into vector. The wanted recombinant plasmids (pGEX4T-OsWKRY71) were recognized by restriction digestion, PCR amplification, and commercial sequencing. The recombinant plasmid (pGEX4T-OsWRKY71) and vector alone (pGEX4T-1) were subjected to transformation in the BL21 cells [18]. The BL21 cells transformed with pGEX4T-1 vector were used as a control. The expression of the recombinant product was encouraged using 1.0 mM IPTG in culture media for 6 h at 37°C and examined by SDS-PAGE.

Functional study of recombinant bacterial cells against multiple abiotic stresses

Spot assay and liquid culture assay were carried out to study the behavior of bacterial cells under different abiotic stresses as described by Yadav et al. [18] with certain alterations as described below.

Stress treatments and real time PCR

To study the expression of the OsWRKY71 gene, 10-day old seedlings were exposed to different abiotic stresses. Six seedlings were used in each stress treatment and the experiment was repeated twice. Untreated seedlings were taken as the experimental control. The following stress treatments were applied on 10-day old seedlings: (1) Drought stress; seedlings were placed on aluminum foil till visible leaf rolling appeared in the plants [19]. (2) Cold stress; the seedlings were transferred to 4°C for 48 h, moved to the control environment, and harvested after 24 h [20]. (3) Salt treatment; the seedlings were immersed in a beaker containing 200 mM NaCl for 3 h at 28±1°C [19]. (4) Heat treatment; the seedlings were subjected to 42°C for 6 h [21]. (5) Wounding stress; the seedlings were cut into pieces and left in water at room temperature [21]. The samples were collected separately and stored at –80°C until analysis.

Total RNA was extracted from control and stress treated rice seedlings using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Brilliant II SYBR Green QRT-PCR Master Mix Kit (Agilent Technologies, CA, USA) was employed in RT-qPCR reactions. RT-qPCR reaction was prepared using OsWRKY71 (F-5′TGGATTAGCACCCAGCCTTC3′, R-5′AGGCTGCTGGTGAAAGAAGT3′) and actin gene primers (F-5′GAAGATCACTGCCTTGCTCC3′ and R-5′CGATAACAGCTCCTCTTGGC3′) on extracted RNA templates. Primer designing and their properties were checked using different bioinformatics tools i.e. Integrated DNA technology oligoanalyzer (www.idtdna.com) and/or Primer BLAST (www.ncbi.nlm.nih.gov/primerBLAST). Sequences spanning the two exons junction were chosen to enhance specificity. PCR conditions used were: one cycle at 50°C for reverse transcription followed by polymerase stimulation at 95°C for 3 min and 40 cycles of PCR at 95°C for 30 s, 53°C for 1 min and 72°C for 30 s. The relative change in transcript level was calculated using 2^−ΔΔCT method [22] with actin as an internal standard to determine relative expression levels [23]. RT-qPCR assays were performed twice (biological replicates), and each sample had three replicates (technical replicates). Student’s t-test was used to detect difference between stress treatments and respective controls.

Cloning and sequence analysis of OsWRKY71

A 327 bp fragment of OsWRKY71 DNA binding domain was amplified from rice cDNA (Figure 1A), purified from gel and ligated with BamHI and XhoI digested pGEX4T-1 vector. Colony PCR was performed on selected 10 colonies and presence of 327 bp band confirmed the positive clones (Figure 1B). Cloned gene was also confirmed by restriction digestion and commercial sequencing. Plasmids extracted from overnight grown cultures of positive colonies were digested with BamHI and XhoI and checked on 1% agarose gel. Presence of 327 bp band demonstrated the successful ligation and transformation (Figure 1C). The upper ~4.5 kb fragment in lane 1 was of linearized pGEX-4T 1. The translated protein sequence of OsWRKY71 gene was subjected to BLAST search for finding homology with already available sequences in NCBI databases. The OsWRKY71 ortholog sequences were retrieved and multiple sequence alignment was carried out using CLUSTALW tool (Figure 2). It was observed that the DNA binding domain sequence is highly conserved in all WRKY proteins. Secondary structure was predicted by using PSIPRED and revealed that the DNA binding domain of OsWRKY71 is made up of ~60 amino acid residues extending from Valine191 to Proline252 and comprises of four β-sheets. It includes a single, highly conserved WRKY domain at the N terminus and zinc finger like structure at its C terminus (C-X₅-C-X₂₃-H-X₁-H) which means that it belongs to group IIA [4] (Figure 2).

Figure 1:

Cloning of OsWRKY71 DNA binding domain.

(A) PCR optimization of OsWRKY71 at 66°C. (B) Colony PCR (Lane M: 1 kb DNA ladder, Lane 1–10: Colonies 1–10, Lane 11: -ve control). (C) Restriction digestion of pGEX-OsWRKY71 (Lane 1: Restricted plasmid, Lane 2: Uncut plasmid).

Figure 2:

Protein sequence alignment of OsWRKY71 (XP_015627417.1) structure of DNA binding domain.

WRKY proteins from different plant members including WRKY from T. aestivum (AFW98256.1; ABC61128.1), H. vulgare (AAS48544.1), S. bicolor (XP_002451666.1), B. distachyon (XP_003570741.1) and Z. mays (PWZ19903.1) were analyzed by TCOFFEE. Conserved residues are shaded in different colors. Green arrows indicate the four β strands of DNA binding domain in the C terminus of OsWRKY71. Arrows represent the key residues involve in making contact with DNA major groove. Arrowheads denote residues that make contact with DNA backbone. Asterisks represent cysteine and histidine residues of zinc finger like motifs in WRKY DNA binding domain.

Expression of OsWRKY71 by SDS PAGE

OsWRKY71 was expressed in fusion with GST protein at the N-terminus having a size of 39 kDa. The expression of recombinant protein (pGEX4T-OsWRKY71) was induced with IPTG and was allowed the protein to express for 4 h at 37°C (Figure 3).

Figure 3:

Expression of OsWRKY71 in E. coli.

Lane M: marker, Lane 1: uninduced BL21, Lane 2: induced BL21.

Overexpression of OsWRKY71 confers abiotic stress tolerance in E. coli

In order to assess the function of expressed OsWRKY71 protein in salt stress condition, the effect of high NaCl concentration was examined. BL/pGEX4T-1, BL/OsWRKY71 containing cells have same growth pattern on standard LB plates. But when plates were supplemented with various concentrations of NaCl and mannitol, there were visible differences with reference to growth and natural assortment (Figure 4). Likewise, OsWRKY71-expressing bacteria were able to bear the high temperature stress in comparison with the control cells. Whereas, there was no clear differences in growth of control and recombinant bacteria in response to cold shock (Figure 5).

Figure 4:

Spot assay of BL/pGEX4T-1 and BL/OsWRKY71 recombinant cells.

Cultures were induced with 1 mM IPTG. OD was adjusted to OD₆₀₀=1. Then 10 μL of 50-, 100- and 200-fold diluted bacterial suspension was spotted on LB plates. (A) Spot assay of BL/OsWRKY71 and BL/pGEX4T-1 on the LB plates supplemented with various concentrations of NaCl containing 400, 500 and 600 mM NaCl for salt stress. (B) Spot assay of BL/OsWRKY71 and BL/pGEX4T-1 on the LB plates supplemented with various concentrations of mannitol containing 500, 800 mM and 1 M mannitol for desiccation.

Figure 5:

Spot assay of BL/pGEX4T-1 and BL/OsWRKY71 recombinant cells.

Cultures were induced with 1 mM IPTG. OD was adjusted to OD₆₀₀=1. Then 10 μL of 50-, 100- and 200-fold diluted bacterial suspension was spotted on LB plates. (A) Spot assay of BL/OsWRKY71 and BL/pGEX4T-1 on the LB plates. Samples were spotted after 2, 4, 6 and 8 h of cold stress. (B) Spot assay of BL/OsWRKY71 and BL/pGEX4T-1 on the LB plates. Samples were spotted after 1, 2 and 3 h of heat stress.

In high salt concentration, the survival of OsWRKY71 transformed bacterial cells was considerably superior with improved persistence in comparison to untransformed cells. Each plate supplemented with 400–600 mM NaCl exhibited different numbers of bacterial colonies, and survival of the recombinant cells was affectedly better than that of non-recombinant cells. OsWRKY71-expressing bacterial cultures diluted by 50- and 100-fold persisted the 600 mM NaCl concentration, while there was no growth when bacterial culture was diluted up to 200-fold (Figure 4A). The outcome proposed that the development of control cells was stopped in high salt stress whereas this stress was better tolerated by cells expressing OsWRKY71.

The response of OsWRKY71 protein in drought was examined by accompanying the growth media with different concentrations of mannitol to create water stress for OsWRKY71-transformed and untransformed E. coli. The growth of recombinant cells was remarkably better as compared to control cells in mannitol-induced dehydration (Figure 4B). This outcome suggested that the expression of the OsWRKY71 gene expression has provided tolerance to E. coli cells against drought stress.

With the aim of identifying the outcome of OsWRKY71 overexpression on the growth of E. coli cells against low and high-temperature, cultures induced with IPTG were moved to 4°C and 50°C respectively. After employing the temperature stresses for different time intervals, the number of cells were compared in diluted cultures. Number of control cells was less as compared to BL/OsWRKY71 but growth rate was stagnant for both control and BL/OsWRKY71 cells after 2, 4, 6 and 8 h of cold treatment (Figure 5A). Heat stress was used to evaluate the response of OsWRKY71. Untransformed cells showed minor growth after 1, 2 and 3 h of heat stress in 50- and 100-fold dilutions, but no sign of growth was observed in 200-fold diluted control bacterial cells. In comparison, OsWRKY71 transformed cells indicated better survival till 3 h successively followed by high-temperature shock (Figure 5B). These results suggested that the OsWRKY71 gene significantly increased the tolerance to high-temperature stresses.

Bacterial growth curves were plotted by observing the growth of bacterial cells in LB medium under salt, drought, cold and heat stresses (Figure 6). Under high salt stress, OsWRKY71 transformants had improved growth in comparison to control. In water stress with mannitol treatment, OsWRKY71-expressing cultures displayed better tolerance than control. In cold stress, recombinants and control cells continued to grow at the same rate whereas in heat shock, recombinants grew markedly till 12 h as compared to untransformed cells that shows growth till 4 h and recorded no additional development (Figure 6).

Figure 6:

The growth performance of BL/pGEX4T-OsWRKY71 and BL/pGEX4T-1 recombinants.

Transformed E. coli cells were subjected to different abiotic stresses. (A) LB medium, (B) 500 mM NaCl, (C) 800 mM mannitol, (D) cold treatment, (E) heat treatment. OD₆₀₀ was measured at a 2 h interval for 12 h and mean values are shown in graph. Error bars represents the standard error.

Bacteria harboring OsWRKY71 showed significant tolerance in salt, drought and heat shocks as indicated by ANOVA. The results of spot, survival rate and growth curve assay under various stresses prove that the heterologous expression of OsWRKY71 confers tolerance to E. coli. Thus, OsWRKY71 might play an important role in gene regulation accompanied by the exposure to stresses, enhancing the adaptation of plant cells to varying environment.

OsWRKY71 gene expression in response to abiotic stresses

OsWRKY71 expression was also examined in rice in response to cold, salt, drought, heat and wounding stresses by RT-qPCR (Figure 7). The Student’s t-test showed significant variation with respect to control in response to all the treatments for OsWRKY71 transcript expression. The expression level of OsWRKY71 gene was up-regulated by cold, salt, drought and wounding stresses. Expression was slightly induced (2-fold) by wounding and drought. Specifically, OsWRKY71 expression was greatly induced (8-fold) by salt stress (500 mM NaCl) while 5-fold increase was observed when cold stress was applied. These findings strongly proposed that OsWRKY71 gene plays important roles in providing tolerance to various abiotic stresses.

Figure 7:

Relative expression analysis of OsWRKY71 gene in abiotic stresses by RT-qPCR.

Bars represent standard errors of the mean based on three independent experiments. Different alphabets on graph bars represents the significance of result. Expression level of OsWRKY71 in all types of stresses differ significantly. However, there is non-significant difference in expression level in response of drought and wounding stress.