Home Medicine MAPK pathway involved in epidermal terminal differentiation of normal human epidermal keratinocytes
Article Open Access

MAPK pathway involved in epidermal terminal differentiation of normal human epidermal keratinocytes

  • Xianguang Meng , Liyun Qiu , Haiyan Song and Ningning Dang EMAIL logo
Published/Copyright: May 10, 2018
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 13 Issue 1

Abstract

Objective

To investigate the effect of mitogen-activated protein kinase (MAPK) signaling pathway in epidermal terminal differentiation.

Methods

The MAPK pathways (p38, ERK1/2, JNK) were inhibited by SB203580, PD98059, and SP600125 in normal human epidermal keratinocytes (NHEKs), respectively. Western blotting assays were performed to detect expression of filaggrin and differentiation-related proteins. The mRNA expressions of differentiation-related proteins were detected by real-time quantitative PCR (qRT-PCR).

Results

Inhibition of MAPK pathway by SB203580, PD98059, and SP600125 resulted in significant reduction of filaggrin expression in NHEKs. Inhibition of the p38 MAPK pathway decreased the expression of differentiation-related proteins (cytokeratin 5, cytokeratin 14, ST14, and SPRR3), Akt, and NF-κB. Inhibition of JNK also suppressed expression of cytokeratin 14, SPRR3, Akt, and NF-κB. However, inhibition of ERK1/2 merely decreased expression of SPRR3 and Akt.

Conclusion

MAPK pathways regulates epidermal terminal differentiation in NHEKs. The p38 signaling pathway plays an especially important role.

Keywords: Epidermal terminal differentiation; Keratinocyte differentiation; MAPK signaling pathway; Normal human epidermal keratinocytes (NHEKs); Differentiation-related proteins

1 Introduction

Skin is the first line of defense for the human body to resist environmental damage, water and nutrients loss, and prevent pathogens and allergens from entering. The stratum corneum (SC), the final product of terminal differentiation of keratinocytes in the epidermis, is the main element of epidermal skin barrier. A sophisticated signal transduction network controls keratinocyte physiology to ensure its normal function [1], and the mitogen-activated protein kinase (MAPK) signaling pathway occupies a central location [2]. The MAPK families have been proven to be essential for controlling diverse cellular behaviors, including cell proliferation, differentiation and apoptosis, for instance the p38 MAPK pathway, ERK1/2 MAPK pathway and JNK signaling pathway [3, 4]. Studies have shown that the MAPK signaling pathways integrate and mediate various signals and play a major role in regulating keratinocyte differentiation and the function of skin barrier [5,6,7]. The ERK1/2 signaling pathway has been shown to control keratinocyte differentiation; low ERK1/2 activity could induce keratinocyte differentiation and apoptosis [8]. The p38 and ERK pathways are activated and participate in keratinocyte differentiation among MAPK signaling pathways while the epidermal barrier is disrupted [8,9,10,11]. In addition, epidermal differentiation would be enhanced when JNK is inhibited by SP600125 [11].

This study aimed to investigate the role of MAPK signaling pathways in epidermal terminal differentiation based on the previous study.

2 Materials and methods

2.1 Cell culture

NHEKs cells were purchased from Invitrogen and cultured in EpiLife medium (Invitrogen, Carlsbad, CA, USA) which was supplemented with 10% fetal calf serum (FCS, Gibco, Carlsbad, CA, USA), 1.5 mM L-Glutamine, 100 IU/mL penicillin, and 100 g/mL streptomycin (Gibco, Carlsbad, CA, USA). They were then maintained at 37 °C in 5% CO2.

2.2 Inhibition of the MAPK pathways

Different concentrations of SB203580, PD98059, and SP600125 (Cell Signaling Technology, Beverly, MA, USA, dissolved in DMSO) were used to inhibit the p38 MAPK pathway, ERK1/2 pathway and JNK pathway according to the manufacturer’s instructions. Approximately 5×106 NHEKs were seeded in 6-cm diameter dishes with DMEM medium at 37°C with 5% CO2 for 24 h. Then cells were divided into 3 groups as follows: i) treated with p38 pathway specific inhibitor (SB203580 at 5 μM, 10 μM and 20 μM), ii) treated with ERK1/2 pathway specific inhibitor (PD98059 at 50μM, 100μM, 200 μM), iii) treated with JNK pathway specific inhibitor (SP600125 at 50 μM, 100 μM, 200 μM), then incubated for 24 h. The appropriate concentrations of these three inhibitors were selected to achieve maximum inhibition effect and used in further experiments. Moreover, DMSO was used as control reagent and cells treated with DMSO as the control group. The expression level of filaggrin, p38, p-JNK, p-ERK1/2 and differentiation-related proteins were detected by Western blotting. This experiment was carried out in duplicate and independently repeated at least two times.

2.3 Western blotting analysis

Western blotting assays were used to detect expression of filaggrin and differentiation-related proteins. After 72h, NHEKs cells treated with inhibitor were collected to extract proteins and quantify using Mammalian Protein Extraction Reagent (M-PER, Pierce, Rockford, IL, USA). Each protein (20μL) was separated with 10% SDS-PAGE and then transferred to a PVDF membrane (Millipore, Bedford, MA, USA). The membrane was incubated with primary antibodies overnight at 4°C after blocking the membrane with 5% skim milk. After rinsing with TBST, the membrane was incubated with secondary antibody (Rabbit IgG, 1:2000, Cell Signaling, Beverly, MA, USA) at RT for 1 h. Gel-Pro Analyzer (Media Cybernetics, Silver Spring, MD, USA) was used to detect labeled protein with incubation of SuperSignal West Pico Chemiluminent Substrates (Pierce, Appleton, WI, USA). Then the labeled protein was exposured to X-ray film. Image J software was used to quantify the relative expression level of proteins by determining a ratio between the amount of them and GADPH. The primary antibodies were as follows: Filaggrin (1:250, Covance, Berkeley, CA, USA); Phospho-p38 MAPK (1:250, Cell Signaling, Beverly, MA, USA); Phospho-ERK1/2 (1:250, Cell Signaling, Beverly, MA, USA); Phospho-JNK (1:200, Cell Signaling, Beverly, MA, USA); Phospho-NF-κB (1:200, Cell Signaling, Beverly, MA, USA); Phospho-Akt (1:200, Cell Signaling, Beverly, MA, USA); Cytokeratin 5 (1:500, GeneTex, Irvine, CA, USA); Cytokeratin 14 (1:1000, GeneTex, Irvine, CA, USA); Loricrin (1:500, GeneTex, Irvine, CA, USA); SPRR3 (1:500, GeneTex, Irvine, CA, USA); and GAPDH (1:2000, Cell Signaling, Beverly, MA, USA).

2.4 Real-time quantitative RT-PCR analysis

Real-time quantitative RT-PCR was used to quantitatively detect mRNA expression of differentiation-related proteins. Total RNA was isolated by TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reverse transcribed to cDNA by using the MMLV Reverse Transcriptase system (Promega, Madison, WI, USA). The Mx3000 Real-time PCR Instrument (Stratagen, La Jolla, CA, USA) was used for following real-time quantitative RT-PCR analysis with the program: 95°C for 3 min, 95°C for 30s, 62°C for 40 s, with a repetition of 40 cycles. Real-time RT-PCR data was analyzed by comparative CT(ΔΔCT) method. The expression level of mRNA was normalized to the endogenous control GAPDH. Primers sequences are shown in Table 1.

Table 1

Primer Sequences used in RT-PCR

GenePrimer Sequence
Cytokeratin 5[12]Upstream: 5′- ATCGCCACTTACCGCAAGCTGCTG-3′ Downstream: 5′- GAGGGAAACACTGCTTGTGACAACAGAG -3′
Cytokeratin 14 [13]Upstream: 5′- CCGACACCTTCTCTTCACTCA -3′ Downstream: 5′- AGGAGCCCTTCATGGAGCTG -3′
Loricrin [14]Upstream: 5′- ACGTCTCCTCGCAGCAGG -3′ Downstream: 5′- CTATTTGGACGGCCAGGT -3′
ST14Upstream: 5′- CACTGGTGGTTCTACTGAC -3′ Downstream: 5′- GTTTTCCAGGGTCCTCCGA -3′
SPRR3 [15]Upstream: 5′- CTTCTCTGCACAGCAGGRCC -3′ Downstream: 5′- AGCAATTTAATGAGGGAAGAGC -3′
filaggrinUpstream: 5′-CACAAGATTCTGCGTATCACTCAGG-3′ Downstream: 5′- GCCTTTCAGTGCCCTCAGATTG-3′
GAPDHUpstream: 5′- CATGAGAAGTATGA CAACAGCCT-3′ Downstream: 5′- AGTCCTTCCACGATA CCAAA GT-3′

2.5 Statistical analysis

Experimental data were analyzed using SPSS 11.0 (SPSS Inc., Chicago, IL, USA) software with one-way ANOVA and the Student’s t-test to analyze differences between groups. Quantitative data was presented as the mean ± standard deviation (n = 3). A value of P < 0.05 for the difference was considered statistically significant.

3 Results

3.1 Inhibition of MAPK decreased the expression of filaggrin in NHEKs

To examine whether MAPK pathways had an effect on filaggrin expression, we cultured NHEKs cells with a specific inhibitor (SB203580) of the p38 MAPK pathway, a specific inhibitor (PD98059) of ERK1/2 pathway, and a specific inhibitor (SP600125) of JNK pathway. The data showed that the p38 MAPK pathway, ERK1/2 pathway and JNK pathway were inhibited by SB203580, PD98059 and SP600125, respectively, and that the 20 μM, 100 μM and 50 μM concentrations inhibited to maximum effect, respectively. These concentrations were used in further experiments (Fig.1A-C). The expression of filaggrin protein was reduced when the MAPK pathway was inhibited (Fig.1A-C). Moreover, the expression of filaggrin mRNA was decreased by inhibiting the MAPK pathway (Fig.1 D). Thus, this finding suggested that it was the inhibition of the p38 MAPK pathway, ERK1/2 pathway and JNK pathway that down-regulated filaggrin in NHEKs.

Figure 1 Inhibition of the p38, ERK1/2 and JNK pathways decreased the expression of filaggrin. A. Western blotting results of filaggrin (38 k Da), and p38. NHEKs were treated with SB203580 (p38 inhibitor) at 5 μM, 10 μM and 20 μM for 24 h. DMSO treatment was used as control B. Western blotting results of filaggrin (38 k Da), and ERK1/2. NHEKs were treated with PD98059 (ERK1/2 inhibitor) at 50 μM, 100 μM and 200 μM for 24 h. DMSO treatment was used as control. C. Western blotting results of filaggrin (38 k Da), and ERK1/2. NHEKs were treated with SP600125 (JNK inhibitor) at 50 μM, 100 μM and 200 μM for 24 h. DMSO treatment was used as control. D. qRT-PCR results of expression of filaggrin mRNA in NHEKs cells treated with 20 μM SB203580, 100 μM PD98059 or 50 μM SP600125, respectively. n = 3, ∗P < 0.05, ΔP < 0.001.
Figure 1

Inhibition of the p38, ERK1/2 and JNK pathways decreased the expression of filaggrin. A. Western blotting results of filaggrin (38 k Da), and p38. NHEKs were treated with SB203580 (p38 inhibitor) at 5 μM, 10 μM and 20 μM for 24 h. DMSO treatment was used as control B. Western blotting results of filaggrin (38 k Da), and ERK1/2. NHEKs were treated with PD98059 (ERK1/2 inhibitor) at 50 μM, 100 μM and 200 μM for 24 h. DMSO treatment was used as control. C. Western blotting results of filaggrin (38 k Da), and ERK1/2. NHEKs were treated with SP600125 (JNK inhibitor) at 50 μM, 100 μM and 200 μM for 24 h. DMSO treatment was used as control. D. qRT-PCR results of expression of filaggrin mRNA in NHEKs cells treated with 20 μM SB203580, 100 μM PD98059 or 50 μM SP600125, respectively. n = 3, ∗P < 0.05, ΔP < 0.001.

3.2 Inhibition of MAPK signaling pathway affected expression of differentiation-related proteins in NHEKs

In order to further investigate whether the inhibition of MAPKs affected NHEKs differentiation, we measured the expression of differentiation-related proteins in NHEKs. The expressions of Cytokeratin 5, Cytokeratin 14 and ST14 were significantly decreased compared with the control group in NHEKs (P<0.05) after treatment with the p38 MAPK pathway specific inhibitor, and in particular, the expression of p-Akt, p-NF-κB and SPRR3 was remarkably reduced (P<0.01) (Fig. 2A, B). However, treatment with the ERK1/2 pathway specific inhibitor not only decreased the expressions of SPRR3 and p-Akt (P<0.05), but also enhanced the expression of Cytokeratin 14, locrin and ST14 (Fig. 2A, B). In addition, the specific inhibition of SP600125 on the JNK pathway only affected the expression of SPRR3, p-Akt, p-NF-κB and ST14, in that SPRR3, p-Akt, and p-NF-κB were inhibited (P<0.05), while ST14 expression was promoted (Fig. 2A, B). The qRT-PCR results showed similar results; inhibition of p38 MAPK significantly decreased mRNA expression of Cytokeratin 5, Cytokeratin 14 and SPRR3 (Fig. 3). These data revealed that the p38 MAPK pathway, ERK1/2 pathway and JNK pathway have diverse functions in NHEK epidermal differentiation.

Figure 2 Inhibition of the MAPK pathway affected expression of differentiation-related proteins. A. Western blotting results of differentiation-related proteins. NHEKs were treated with 20 μM SB203580, 100 μM PD98059 or 50 μM SP600125, respectively. B. Semi-quantitative analysis of differentiation-related proteins, compared with the control (DMSO), n = 3, ∗P < 0.05, ΔP < 0.001.
Figure 2

Inhibition of the MAPK pathway affected expression of differentiation-related proteins. A. Western blotting results of differentiation-related proteins. NHEKs were treated with 20 μM SB203580, 100 μM PD98059 or 50 μM SP600125, respectively. B. Semi-quantitative analysis of differentiation-related proteins, compared with the control (DMSO), n = 3, ∗P < 0.05, ΔP < 0.001.

Figure 3 Inhibition of the MAPK pathway affected mRNA expression of differentiation-related proteins. qRT-PCR results of mRNA expression of differentiation-related proteins. NHEKs were treated with 20 μM SB203580, 100 μM PD98059 or 50 μM SP600125, respectively. n = 3, ∗ P < 0.05, ΔP < 0.001.
Figure 3

Inhibition of the MAPK pathway affected mRNA expression of differentiation-related proteins. qRT-PCR results of mRNA expression of differentiation-related proteins. NHEKs were treated with 20 μM SB203580, 100 μM PD98059 or 50 μM SP600125, respectively. n = 3, ∗ P < 0.05, ΔP < 0.001.

4 Discussion

Filaggrin is a vital component of keratohyalin granules and the skin barrier [16], and is generally considered as one of the major markers of epidermal terminal differentiation and formation of the SC. Kezic et al found that epidermal filaggrin and its degradation product levels were reduced or completely lost when the FLG gene was mutated [17]. Loss of filaggrin can result in serious defects in the epithelial barrier, incomplete keratin accumulation, and loss of transepidermal water [18, 19]. In this report, it was revealed that inhibition of p38 MAPK, ERK1/2, and JNK pathways down-regulated expression of filaggrin in NHEKs, suggesting that the MAPK pathway may have effect on terminal differentiation of NHEKs.

The MAPK signaling pathway has been shown to play critical roles in epidermal differentiation and skin barrier function [20,21,22,23]. The MAPK signaling pathways can integrate and mediate various signals involved in keratinocyte differentiation, including epidermal growth factor receptor (EGFR), integrin and calcium signaling. Inhibition of the p38 MAPK pathway in keratinocytes could interfere with keratinocyte differentiation. Thus, we investigated the role of the MAPK signaling pathway in epidermal differentiation of NHEKs through detecting expression of differentiation-related proteins. Epidermal proliferation of normal skin is limited to the basal layer, and is related to specific keratin proteins, such as Cytokeratin 5 and Cytokeratin 14 [24]. Researchers have confirmed that Cytokeratin 5 and Cytokeratin 14, which are expressed in the basal layer, are related to cell differentiation, and contribute to maintain the cell proliferation potential [25, 26]. In addition, small proline-rich protein (SPRRs) and loricrin are also associated with increased epithelial proliferation. Loricrin is a major cornified cell envelope (CE) protein that forms the outermost layer of epidermis and plays an important role in maintaining the epidermal barrier. ST14 is generally known to be involved in cell growth and differentiation, and is suggested to be related to the regulation of differentiation in suprabasal keratinocytes [27]. In this study, we found that inhibition of JNK, ERK1/2, and p38 MAPK pathways resulted in significant reduction of SPRR3, but had different effects on expression of Cytokeratin 14, loricrin, and ST14 (Fig. 2). Thus, it suggested that MAPK pathways affected terminal differentiation of NHEKs via regulating differentiation-related proteins. In addition, inhibition of MAPK signaling pathway suppressed activation of Akt and NF-κB pathway (Fig. 2). NF-κB and Akt have also been revealed to play an important role in epidermal differentiation[28, 29]. These signaling pathways are interrelated with each other in cellular activities, and certain forms of cellular stress could enhance p38 phosphorylation, also leading to activation of the NF-κB pathway in human keratinocytes[30]. Furthermore, Oh et al found that activation of NF-κB induced by tumor necrosis factor α (TNF-α) impacts the activation of Akt in human pulmonary epithelial cells [31]. Hence, we inferred that the mechanisms of NF-κB and Akt action in epidermal differentiation might be closely associated with MAPK pathways.

In this study of the MAPK signaling pathway in epidermal differentiation, we found that JNK pathway, ERK1/2 pathway, and p38 MAPK pathway were associated with the regulation of differentiation-related proteins in NHEKs (Fig.2), which was consistent with previous studies [32]. However, the three pathways were different in regulating the differentiation-related proteins (Fig. 2). Inhibition of the p38 MAPK signaling pathway led to the significantly decreased expression of Cytokeratin 5, Cytokeratin 14 and ST14, and the expression of p-Akt, P-NF-κB, SPRR3 reduced remarkably. But only SPRR3 and p-Akt expressions were inhibited slightly in the case of ERK1/2 signaling pathway inhibition, while expression of Cytokeratin 14, locrin and ST14 increased remarkably, indicating there might be a feedback compensatory mechanism to connect pathways. However, the inhibition of JNK signaling pathway only affected the expression of SPRR3, p-Akt, p-NF-κB and ST14, in which SPRR3, p-Akt and p-NF-κB were inhibited, while ST14 expression was enhanced. These results demonstrated that the JNK pathway, ERK1/2 pathway and p38 MAPK pathway might have different mechanisms to regulate epidermal differentiation in NHEKs. ERK1/2 exerted opposite effects of p38 in epidermal keratinocytes, which was consistent with Gazel A’s study [33]. This experiment also suggested that expressions of p-Akt and p-NF-κB were less when p38 was inhibited than in the other cases when the JNK pathway or ERK1/2 pathway were inhibited, indicating that the MAPK p38 pathway may affect NHEKs differentiation through Akt and NF-κB. Furthermore, there was no significant change of NF-κB activation when ERK1/2 was inhibited. Previous studies have shown that there was no connection in induction of IL-6 between ERK1/2 and NF-κB in cardiac fibroblasts[34]. But Jiang B found that ERK1/2 has an effect on the regulation of NF-κB activation in vascular smooth muscle cells [35]. It might be different cell types and experimental models which cause these conflicting results. Therefore, further research is needed to explain and confirm the conflicting results.

5 Conclusion

Our previous study demonstrated that, in filaggrin-deficient NHEKs, the expression of p38, p44/42 MAPK and SAPK/JNK and caspase-14 were significantly decreased [36]. In conclusion, our data suggested that Filaggrin might regulate the expression of differentiation-related proteins via p38 MAPK pathway. Meanwhile, p38 MAPK pathway activation regulated the expression of filaggrin in NHEKs. The inhibition of the p38 MAPK pathway, which was regulated by knock-down filaggrin, affected downstream NF-κB and Akt pathways. In addition, the ERK pathway and JNK pathway also played a role in the keratinocyte differentiation process. Our study provided a potential mechanism for terminal differentiation deficiency in diseases related to filaggrin functional absence.

  1. Funding: This study was supported by China Postdoctoral Science Foundation (CPSF) (No.2014M550370, 2015T80740) and Shandong Provincial Natural Science Foundation, China (No. ZR2017MH074).

  2. Conflicts of interest: The authors have no conflicts of interest to declare.

References

[1] Cursons J, Angel CE, Hurley DG, Print CG, Dunbar PR, Jacobs MD, Crampin EJ. Spatially transformed fluorescence image data for ERK-MAPK and selected proteins within human epidermis Gigascience, 2015; 4: 6310.1186/s13742-015-0102-5Search in Google Scholar

[2] Isaeva AR, Mitev VI. CK2 is acting upstream of MEK3/6 as a part of the signal control of ERK1/2 and p38 MAPK during keratinocytes autocrine differentiation. Z Naturforsch C. 2011;66(1-2):83-8610.1515/znc-2011-1-211Search in Google Scholar

[3] Raman M, Chen W, Mh . Differential regulation and properties of MAPKs. Oncogene. 2007;26(22):3100-311210.1038/sj.onc.1210392Search in Google Scholar

[4] Robinson MJ, Cobb MH. Robinson MJ, Cobb MHMitogen-activated protein kinase pathways. Curr Opin Cell Biol. 1997; 9(2):180-18610.1016/S0955-0674(97)80061-0Search in Google Scholar

[5] Popp T, Egea V, Kehe K, Steinritz D, Schmidt A, Jochum M, Ries C. Sulfur mustard induces differentiation in human primary keratinocytes: opposite roles of p38 and ERK1/2 MAPK. Toxicology Letters. 2011; 204(1): 43-5110.1016/j.toxlet.2011.04.007Search in Google Scholar PubMed

[6] Hara T, Miyazaki M, Hakuno F, Takahashi S, Chida K. PKCη promotes a proliferation to differentiation switch in keratinocytes via upregulation of p27Kip1 mRNA through suppression of JNK/c-Jun signaling under stress conditions. Cell Death Dis. 2011;2: e15710.1038/cddis.2011.40Search in Google Scholar PubMed PubMed Central

[7] Wu N, Sulpice E, Obeid P, Benzina S, Kermarrec F, Combe S, Gidrol X. The miR-17 family links p63 protein to MAPK signaling to promote the onset of human keratinocyte differentiation. PloS One. 2012;7(9): e4576110.1371/journal.pone.0045761Search in Google Scholar PubMed PubMed Central

[8] Kobayashi H, Aiba S, Yoshino Y, Tagami H. Acute cutaneous barrier disruption activates epidermal p44/42 and p38 mitogen-activated protein kinases in human and hairless guinea pig skin. Exp Dermatol.2003; 12(6):734-74610.1111/j.0906-6705.2003.00045.xSearch in Google Scholar PubMed

[9] Hammers CM, Stanley JR. Desmoglein-1, differentiation, and disease. J Clin Invest. 2013;123(4): 1419-142210.1172/JCI69071Search in Google Scholar PubMed PubMed Central

[10] Rauhala L, Hämäläinen L, Salonen P, Bart G, Tammi M, Pasonenseppänen S, Tammi R. Low Dose Ultraviolet B Irradiation Increases Hyaluronan Synthesis in Epidermal Keratinocytes via Sequential Induction of Hyaluronan Synthases Has1–3 Mediated by p38 and Ca2+/Calmodulin-dependent Protein Kinase II (CaMKII) Signaling. J Biol Chem. 2013; 288(25): 17999-801210.1074/jbc.M113.472530Search in Google Scholar PubMed PubMed Central

[11] Gazel A, Banno T, Walsh R, Blumenberg M. Inhibition of JNK promotes differentiation of epidermal keratinocytes . J Biol Chem. 2006; 281(29): 20530-2054110.1074/jbc.M602712200Search in Google Scholar PubMed

[12] Potemski P, Pluciennik E, Bednarek AK, Kusinska R, Kubiak R, Kordek R. Evaluation of oestrogen receptor expression in breast cancer by quantification of mRNA. Histopathology. 2007; 51(6): 829-83610.1111/j.1365-2559.2007.02886.xSearch in Google Scholar PubMed

[13] Yoshida K, Sato K, Tonogi M, Tanaka Y, Yamane GY, Katakura A. Expression of Cytokeratin 14 and 19 in Process of Oral Carcinogenesis. Bull Tokyo Dent Coll. 2015;56(2):105-11110.2209/tdcpublication.56.105Search in Google Scholar PubMed

[14] Lehr E, Jarnik M, Brown DR. Human Papillomavirus Type 11 Alters the Transcription and Expression of Loricrin, the Major Cell Envelope Protein. Virology. 2002;298(2): 240-24710.1006/viro.2002.1445Search in Google Scholar PubMed

[15] Chen BS, Wang MR, Cai Y, Xu X, Xu ZX, Han YL, Wu M. Decreased expression of SPRR3 in Chinese human oesophageal cancer. Carcinogenesis. 2000;21(12): 2147-215010.1093/carcin/21.12.2147Search in Google Scholar PubMed

[16] Colombini ZM, Paula SL, Leão OR, Valéria A. Skin barrier in atopic dermatitis: beyond filaggrin. An Bras Dermatol. 2016; 91(4): 472-47810.1590/abd1806-4841.20164412Search in Google Scholar PubMed PubMed Central

[17] Kezic S, O’Regan GM, Yau N, Sandilands A, Chen H, Campbell LE, Kroboth K, Watson R, Rowland M, Irwin MWH. Levels of filaggrin degradation products are influenced by both filaggrin genotype and atopic dermatitis severity. Allergy. 2011; 66(7): 934-94010.1111/j.1398-9995.2010.02540.xSearch in Google Scholar PubMed PubMed Central

[18] De D, Handa S. Filaggrin mutations and the skin. Indian J Dermatol Venereol Leprol. 2012; 78(5): 545-55110.4103/0378-6323.100518Search in Google Scholar PubMed

[19] Eichenfield LF, Ellis CN, Mancini AJ, Paller AS, Simpson EL. Atopic Dermatitis: Epidemiology and Pathogenesis Update. Semin Cutan Med Surg. 2012; 31(3 Suppl):S3-510.1016/j.sder.2012.07.002Search in Google Scholar PubMed

[20] Jonak C, Kokesch C, Klosner G, Mildner M, Fodinger D, Trautinger F. The 27kD heat shock protein and MAPK signalling are required for epidermal differentiation. J Invest Dermatol. 2016;4(5):731-735Search in Google Scholar

[21] Eckert RL, Efimova T, Dashti SR, Balasubramanian S, Deucher A, Crish JF, Sturniolo M, Bone F. Keratinocyte survival, differentiation, and death: many roads lead to mitogen-activated protein kinase. J Investig Dermatol Symp Proc. 2002;7(1):36-4010.1046/j.1523-1747.2002.19634.xSearch in Google Scholar PubMed

[22] Cursons J, Gao J, Hurley DG, Print CG, Dunbar PR, Jacobs MD, Crampin EJ. Regulation of ERK-MAPK signaling in human epidermis. BMC Syst Biol. 2015;9:4110.1186/s12918-015-0187-6Search in Google Scholar PubMed PubMed Central

[23] Harmon RM. Intracellular Desmoglein-1 Domains Promote Epidermal Differentiation By Forming a MAPK Inhibitory Apparatus. Dissertations & Theses - Gradworks. 2014;8(3):41-44Search in Google Scholar

[24] Ivanova P, Atanasova G, Poumay Y, Mitev V. Knockdown of PKD1 in normal human epidermal keratinocytes increases mRNA expression of keratin 10 and involucrin: early markers of keratinocyte differentiation. Arch Dermatol Res. 2008; 300(3):139-14510.1007/s00403-008-0832-7Search in Google Scholar PubMed

[25] Alam H, Sehgal L, Kundu ST, Dalal SN, Vaidya MM. Novel function of keratins 5 and 14 in proliferation and differentiation of stratified epithelial cells. Mol Biol Cell. 2011; 22(21):4068-407810.1091/mbc.e10-08-0703Search in Google Scholar PubMed PubMed Central

[26] Coulombe PA, Kopan R, Fuchs E. Expression of Keratin K14 in the Epidermis and Hair Follicle: Insights into Complex Programs of Differentiation. J Cell Biol. 1989; 109(5):2295-231210.1083/jcb.109.5.2295Search in Google Scholar PubMed PubMed Central

[27] Chen YW, Wang JK, Chou FP, Wu BY, Hsiao HC, Han C, Xu Z, Baksh AN, Shi G, Kaul M. Matriptase regulates proliferation and early, but not terminal, differentiation of human keratinocytes J Invest Dermatol. 2014; 134(2):405-41410.1038/jid.2013.320Search in Google Scholar PubMed PubMed Central

[28] Calautti E, Li J, Saoncella S, Brissette JL, Goetinck PF. Phosphoinositide 3-kinase signaling to Akt promotes keratinocyte differentiation versus death. J Biol Chem. 2005;280(38):32856-3286510.1074/jbc.M506119200Search in Google Scholar PubMed

[29] Lopez-Pajares V, Yan K, Zarnegar BJ, Jameson KL, Khavari PA. Genetic pathways in disorders of epidermal differentiation. Trends Genet. 2013; 29(1):31-4010.1016/j.tig.2012.10.005Search in Google Scholar PubMed PubMed Central

[30] Connelly JT, Mishra A, Gautrot JE, Watt FM. Shape-Induced Terminal Differentiation of Human Epidermal Stem Cells Requires p38 and Is Regulated by Histone Acetylation. PloS One. 2011;6(11): e2725910.1371/journal.pone.0027259Search in Google Scholar PubMed PubMed Central

[31] Oh JH, Kwon TK. Withaferin A inhibits tumor necrosis factor-alpha-induced expression of cell adhesion molecules by inactivation of Akt and NF-kappaB in human pulmonary epithelial cells. Int Immunopharmacol. 2009;9(5):614-61910.1016/j.intimp.2009.02.002Search in Google Scholar PubMed

[32] Jonak C, Mildner M, Klosner G, Paulitschke V, Kunstfeld R, Pehamberger H, Tschachler E, Trautinger F. The hsp27kD heat shock protein and p38-MAPK signaling are required for regular epidermal differentiation. J Dermatol Sci. 2011; 61(1):32-3710.1016/j.jdermsci.2010.10.009Search in Google Scholar PubMed

[33] Gazel A, Nijhawan RI, Walsh R, Blumenberg M. Transcriptional profiling defines the roles of ERK and p38 kinases in epidermal keratinocytes. J Cell Physiol. 2008; 215(2):292-30810.1002/jcp.21394Search in Google Scholar PubMed

[34] Sano M, Fukuda K, Sato T, Kawaguchi H, Suematsu M, Matsuda S, Koyasu S, Matsui H, Yamauchi-Takihara K, Harada M. ERK and p38 MAPK, but not NF-kappaB, are critically involved in reactive oxygen species-mediated induction of IL-6 by angiotensin II in cardiac fibroblasts. Circ Res. 2001;89(8): 661-66910.1161/hh2001.098873Search in Google Scholar PubMed

[35] Jiang B, Xu S, Hou X, Pimentel DR, Brecher P, Cohen RA. Temporal Control of NF-κB Activation by ERK Differentially Regulates Interleukin-1β-induced Gene Expression. J Biol Chem. 2004;279(2): 1323-132910.1074/jbc.M307521200Search in Google Scholar PubMed

[36] Dang N, Pang S, Song H, An L, Ma X. Inactivation of mitogen-activated protein kinase signaling pathway reduces caspase-14 expression in impaired keratinocytes. Iran J Basic Med Sci. 2016;19(1): 28-33Search in Google Scholar

Received: 2017-10-10
Accepted: 2018-03-27
Published Online: 2018-05-10

© 2018 Xianguang Meng et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Articles in the same Issue

  1. Regular Articles
  2. Cleidocranial dysplasia-dental disorder treatment and audiology diagnosis
  3. A hybrid neural network – world cup optimization algorithm for melanoma detection
  4. Early administration of venovenous extracorporeal life support for status asthmaticus during anaesthetic induction: case report and literature review
  5. Assessment of maximal isometric hand grip strength in school-aged children
  6. Evaluation of a neurokinin-1 antagonist in preventing multiple-day cisplatin-induced nausea and vomiting
  7. Value of continuous video EEG and EEG responses to thermesthesia stimulation in prognosis evaluation of comatose patients after cardiopulmonary resuscitation
  8. Platelet-rich plasma protects HUVECs against oX-LDL-induced injury
  9. Pharmacoeconomics of three therapeutic schemes for anti-tuberculosis therapy induced liver injury in China
  10. Small-cell lung cancer presenting as fatal pulmonary hemorrhage
  11. Correlation of retinopathy of prematurity with bronchopulmonary dysplasia
  12. Prognosis of treatment outcomes by cognitive and physical scales
  13. The efficacy of radiofrequency hyperthermia combined with chemotherapy in the treatment of advanced ovarian cancer
  14. Arcuate Fasciculus in Autism Spectrum Disorder Toddlers with Language Regression
  15. Aesthetic dental procedures: legal and medico-legal implications
  16. Blood transfusion in children: the refusal of Jehovah’s Witness parents’
  17. Burnout among anesthetists and intensive care physicians
  18. Relationship of HS CRP and sacroiliac joint inflammation in undifferentiated spondyloarthritis
  19. Ethical and legal issues in gestational surrogacy
  20. Effects of arginine vasopressin on migration and respiratory burst activity in human leukocytes
  21. Associations of diabetic retinopathy with retinal neurodegeneration on the background of diabetes mellitus. Overview of recent medical studies with an assessment of the impact on healthcare systems
  22. Pituitary dysfunction from an unruptured ophthalmic internal carotid artery aneurysm with improved 2-year follow-up results: A case report
  23. Effectiveness of treatment with endostatin in combination with emcitabine, carboplatin, and gemcitabine in patients with advanced non-small cell lung cancer: a retrospective study
  24. Piercing and tattoos in adolescents: legal and medico-legal implications
  25. The central importance of information in cosmetic surgery and treatments
  26. Penile calciphylaxis in a patient with end-stage renal disease: a case report and review of the literature
  27. Serum CA72-4 as a biomarker in the diagnosis of colorectal cancer: A meta-analysis
  28. Association between uric acid and metabolic syndrome in elderly women
  29. Distinct expression and prognostic value of MS4A in gastric cancer
  30. MAPK pathway involved in epidermal terminal differentiation of normal human epidermal keratinocytes
  31. Association of central obesity with sex hormonebinding globulin: a cross-sectional study of 1166 Chinese men
  32. Successful endovascular therapy in an elderly patient with severe hemorrhage caused by traumatic injury
  33. Inflammatory biomarkers and risk of atherosclerotic cardiovascular disease
  34. Related factors of early mortality in young adults with cerebral hemorrhage
  35. Growth suppression of glioma cells using HDAC6 inhibitor, tubacin
  36. Post-stroke upper limb spasticity incidence for different cerebral infarction site
  37. The esophageal manometry with gas-perfused catheters
  38. MMP-2 and TIMP-2 in patients with heart failure and chronic kidney disease
  39. Genetic testing: ethical aspects
  40. Intervention for physician burnout: A systematic review
  41. The melanin-concentrating hormone system in human, rodent and avian brain
  42. Clinical effects of piribedil in adjuvant treatment of Parkinson’s Disease: A meta-analysis
  43. Identification of a novel BRAF Thr599dup mutation in lung adenocarcinoma
  44. Adrenal incidentaloma – diagnostic and treating problem – own experience
  45. Common illnesses in tropical Asia and significance of medical volunteering
  46. Genetic risk in insurance field
  47. Genetic testing and professional responsibility: the italian experience
  48. The mechanism of mitral regurgitant jets identified by 3-dimensional transesophageal echocardiography
  49. Control of blood pressure and cardiovascular outcomes in type 2 diabetes
  50. Pseudomesotheliomatous primary squamous cell lung carcinoma: The first case reported in Turkey and a review of the literature
  51. Diagnostic efficacy of serum 1,3-β-D-glucan for invasive fungal infection: An update meta-analysis based on 37 case or cohort studies
  52. GPER was associated with hypertension in post-menopausal women
  53. Metabolic activity of sulfate-reducing bacteria from rodents with colitis
  54. Association of miRNA122 & ADAM17 with lipids among hypertensives in Nigeria
  55. The efficacy and safety of enoxaparin: a meta-analysis
  56. Cuffed versus uncuffed endotracheal tubes in pediatrics: a meta-analysis
  57. Thresholding for medical image segmentation for cancer using fuzzy entropy with level set algorithm
  58. Sleep deprivation in Intensive Care Unit – systematic review
  59. Benefits of computed tomography in reducing mortality in emergency medicine
  60. Ipragliflozin ameliorates liver damage in non-alcoholic fatty liver disease
  61. Limits of professional competency in nurses working in Nicu
  62. MDA-19 suppresses progression of melanoma via inhibiting the PI3K/Akt pathway
  63. The effect of smoking on posttraumatic pseudoarthrosis healing after internal stabilization, treated with platelet rich plasma (PRP)
  64. Partial deletion of the long arm of chromosome 7: a case report
  65. Meta-analysis of PET/CT detect lymph nodes metastases of cervical cancer
  66. High Expression of NLRC5 is associated with prognosis of gastric cancer
  67. Is monitoring mean platelet volume necessary in breast cancer patients?
  68. Resectable single hepatic epithelioid hemangioendothelioma in the left lobe of the liver: a case report
  69. Epidemiological study of carbapenem-resistant Klebsiella pneumoniae
  70. The CCR5-Delta32 genetic polymorphism and HIV-1 infection susceptibility: a meta-analysis
  71. Phenotypic and molecular characterisation of Staphylococcus aureus with reduced vancomycin susceptibility derivated in vitro
  72. Preliminary results of Highly Injectable Bi-Phasic Bone Substitute (CERAMENT) in the treatment of benign bone tumors and tumor-like lesions
  73. Analysis of patient satisfaction with emergency medical services
  74. Guillain-Barré syndrome and Low back pain: two cases and literature review
  75. HELLP syndrome complicated by pulmonary edema: a case report
  76. Pharmacokinetics of vancomycin in patients with different renal function levels
  77. Recurrent chronic subdural hematoma: Report of 13 cases
  78. Is awareness enough to bring patients to colorectal screening?
  79. Serum tumor marker carbohydrate antigen 125 levels and carotid atherosclerosis in patients with coronary artery disease
  80. Plastic treatment for giant pseudocyst after incisional hernia mesh repair: a case report and comprehensive literature review
  81. High expression levels of fascin-1 protein in human gliomas and its clinical relevance
  82. Thromboembolic complications following tissue plasminogen activator therapy in patients of acute ischemic stroke - Case report and possibility for detection of cardiac thrombi
  83. The effects of gastrointestinal function on the incidence of ventilator-associated pneumonia in critically ill patients
  84. A report of chronic intestinal pseudo-obstruction related to systemic lupus erythematosus
  85. Risk model in women with ovarian cancer without mutations
  86. Direct oral anticoagulants and travel-related venous thromboembolism
  87. How bispectral index compares to spectral entropy of the EEG and A-line ARX index in the same patient
  88. Henoch-schonlein purpura nephritis with renal interstitial lesions
  89. Cardiovascular risk estimated by UKPDS risk engine algorithm in diabetes
  90. CD5 and CD43 expression are associate with poor prognosis in DLBCL patients
  91. Combination of novoseven and feiba in hemophiliac patients with inhibitors
https://doi.org/10.1515/med-2018-0029
Keywords for this article
Epidermal terminal differentiation; Keratinocyte differentiation; MAPK signaling pathway; Normal human epidermal keratinocytes (NHEKs); Differentiation-related proteins
Creative Commons
BY-NC-ND 4.0

Articles in the same Issue

  1. Regular Articles
  2. Cleidocranial dysplasia-dental disorder treatment and audiology diagnosis
  3. A hybrid neural network – world cup optimization algorithm for melanoma detection
  4. Early administration of venovenous extracorporeal life support for status asthmaticus during anaesthetic induction: case report and literature review
  5. Assessment of maximal isometric hand grip strength in school-aged children
  6. Evaluation of a neurokinin-1 antagonist in preventing multiple-day cisplatin-induced nausea and vomiting
  7. Value of continuous video EEG and EEG responses to thermesthesia stimulation in prognosis evaluation of comatose patients after cardiopulmonary resuscitation
  8. Platelet-rich plasma protects HUVECs against oX-LDL-induced injury
  9. Pharmacoeconomics of three therapeutic schemes for anti-tuberculosis therapy induced liver injury in China
  10. Small-cell lung cancer presenting as fatal pulmonary hemorrhage
  11. Correlation of retinopathy of prematurity with bronchopulmonary dysplasia
  12. Prognosis of treatment outcomes by cognitive and physical scales
  13. The efficacy of radiofrequency hyperthermia combined with chemotherapy in the treatment of advanced ovarian cancer
  14. Arcuate Fasciculus in Autism Spectrum Disorder Toddlers with Language Regression
  15. Aesthetic dental procedures: legal and medico-legal implications
  16. Blood transfusion in children: the refusal of Jehovah’s Witness parents’
  17. Burnout among anesthetists and intensive care physicians
  18. Relationship of HS CRP and sacroiliac joint inflammation in undifferentiated spondyloarthritis
  19. Ethical and legal issues in gestational surrogacy
  20. Effects of arginine vasopressin on migration and respiratory burst activity in human leukocytes
  21. Associations of diabetic retinopathy with retinal neurodegeneration on the background of diabetes mellitus. Overview of recent medical studies with an assessment of the impact on healthcare systems
  22. Pituitary dysfunction from an unruptured ophthalmic internal carotid artery aneurysm with improved 2-year follow-up results: A case report
  23. Effectiveness of treatment with endostatin in combination with emcitabine, carboplatin, and gemcitabine in patients with advanced non-small cell lung cancer: a retrospective study
  24. Piercing and tattoos in adolescents: legal and medico-legal implications
  25. The central importance of information in cosmetic surgery and treatments
  26. Penile calciphylaxis in a patient with end-stage renal disease: a case report and review of the literature
  27. Serum CA72-4 as a biomarker in the diagnosis of colorectal cancer: A meta-analysis
  28. Association between uric acid and metabolic syndrome in elderly women
  29. Distinct expression and prognostic value of MS4A in gastric cancer
  30. MAPK pathway involved in epidermal terminal differentiation of normal human epidermal keratinocytes
  31. Association of central obesity with sex hormonebinding globulin: a cross-sectional study of 1166 Chinese men
  32. Successful endovascular therapy in an elderly patient with severe hemorrhage caused by traumatic injury
  33. Inflammatory biomarkers and risk of atherosclerotic cardiovascular disease
  34. Related factors of early mortality in young adults with cerebral hemorrhage
  35. Growth suppression of glioma cells using HDAC6 inhibitor, tubacin
  36. Post-stroke upper limb spasticity incidence for different cerebral infarction site
  37. The esophageal manometry with gas-perfused catheters
  38. MMP-2 and TIMP-2 in patients with heart failure and chronic kidney disease
  39. Genetic testing: ethical aspects
  40. Intervention for physician burnout: A systematic review
  41. The melanin-concentrating hormone system in human, rodent and avian brain
  42. Clinical effects of piribedil in adjuvant treatment of Parkinson’s Disease: A meta-analysis
  43. Identification of a novel BRAF Thr599dup mutation in lung adenocarcinoma
  44. Adrenal incidentaloma – diagnostic and treating problem – own experience
  45. Common illnesses in tropical Asia and significance of medical volunteering
  46. Genetic risk in insurance field
  47. Genetic testing and professional responsibility: the italian experience
  48. The mechanism of mitral regurgitant jets identified by 3-dimensional transesophageal echocardiography
  49. Control of blood pressure and cardiovascular outcomes in type 2 diabetes
  50. Pseudomesotheliomatous primary squamous cell lung carcinoma: The first case reported in Turkey and a review of the literature
  51. Diagnostic efficacy of serum 1,3-β-D-glucan for invasive fungal infection: An update meta-analysis based on 37 case or cohort studies
  52. GPER was associated with hypertension in post-menopausal women
  53. Metabolic activity of sulfate-reducing bacteria from rodents with colitis
  54. Association of miRNA122 & ADAM17 with lipids among hypertensives in Nigeria
  55. The efficacy and safety of enoxaparin: a meta-analysis
  56. Cuffed versus uncuffed endotracheal tubes in pediatrics: a meta-analysis
  57. Thresholding for medical image segmentation for cancer using fuzzy entropy with level set algorithm
  58. Sleep deprivation in Intensive Care Unit – systematic review
  59. Benefits of computed tomography in reducing mortality in emergency medicine
  60. Ipragliflozin ameliorates liver damage in non-alcoholic fatty liver disease
  61. Limits of professional competency in nurses working in Nicu
  62. MDA-19 suppresses progression of melanoma via inhibiting the PI3K/Akt pathway
  63. The effect of smoking on posttraumatic pseudoarthrosis healing after internal stabilization, treated with platelet rich plasma (PRP)
  64. Partial deletion of the long arm of chromosome 7: a case report
  65. Meta-analysis of PET/CT detect lymph nodes metastases of cervical cancer
  66. High Expression of NLRC5 is associated with prognosis of gastric cancer
  67. Is monitoring mean platelet volume necessary in breast cancer patients?
  68. Resectable single hepatic epithelioid hemangioendothelioma in the left lobe of the liver: a case report
  69. Epidemiological study of carbapenem-resistant Klebsiella pneumoniae
  70. The CCR5-Delta32 genetic polymorphism and HIV-1 infection susceptibility: a meta-analysis
  71. Phenotypic and molecular characterisation of Staphylococcus aureus with reduced vancomycin susceptibility derivated in vitro
  72. Preliminary results of Highly Injectable Bi-Phasic Bone Substitute (CERAMENT) in the treatment of benign bone tumors and tumor-like lesions
  73. Analysis of patient satisfaction with emergency medical services
  74. Guillain-Barré syndrome and Low back pain: two cases and literature review
  75. HELLP syndrome complicated by pulmonary edema: a case report
  76. Pharmacokinetics of vancomycin in patients with different renal function levels
  77. Recurrent chronic subdural hematoma: Report of 13 cases
  78. Is awareness enough to bring patients to colorectal screening?
  79. Serum tumor marker carbohydrate antigen 125 levels and carotid atherosclerosis in patients with coronary artery disease
  80. Plastic treatment for giant pseudocyst after incisional hernia mesh repair: a case report and comprehensive literature review
  81. High expression levels of fascin-1 protein in human gliomas and its clinical relevance
  82. Thromboembolic complications following tissue plasminogen activator therapy in patients of acute ischemic stroke - Case report and possibility for detection of cardiac thrombi
  83. The effects of gastrointestinal function on the incidence of ventilator-associated pneumonia in critically ill patients
  84. A report of chronic intestinal pseudo-obstruction related to systemic lupus erythematosus
  85. Risk model in women with ovarian cancer without mutations
  86. Direct oral anticoagulants and travel-related venous thromboembolism
  87. How bispectral index compares to spectral entropy of the EEG and A-line ARX index in the same patient
  88. Henoch-schonlein purpura nephritis with renal interstitial lesions
  89. Cardiovascular risk estimated by UKPDS risk engine algorithm in diabetes
  90. CD5 and CD43 expression are associate with poor prognosis in DLBCL patients
  91. Combination of novoseven and feiba in hemophiliac patients with inhibitors
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Winner of the OpenAthens UX Award 2026
Winner of the OpenAthens UX Award 2026
Have an idea on how to improve our website?
Please write us.
© 2026 De Gruyter Brill
Downloaded on 10.3.2026 from https://www.degruyterbrill.com/document/doi/10.1515/med-2018-0029/html
Scroll to top button