Correlative study of peripheral ATP1A1 gene expression level to anxiety severity score on major depressive disorder patients

Subject selection

All participants were from the Chinese Han ethnic group. A total of 40 drug-free MDD patients (25 females, 15 males, age 29–60 years) were included in the experimental group, while an additional 40 healthy subjects (25 females, 15 males, age 30–60 years) participated as the normal control. All subjects were recruited from the clinic of Beijing Friendship Hospital, Capital Medical University (Beijing, China) and were clinically screened to eliminate possible diseases of other systems. The MDD patients were diagnosed and enrolled into study group according to the criteria of Diagnostic and Statistical Manual of Mental Disorders – 4th edition (DSM-IV) (American Psychiatric Association) through “The Mini International Neuropsychiatric Interview” (MINI) structured clinical interview [22]. All research procedures were reviewed and approved by the Institutional Research Ethics Committee of Capital Medical University and a written informed consent statement was obtained from each participant.

The inclusion criteria for MDD patients were: (1) diagnosed by two well-trained senior psychiatrists in accordance with the DSM-IV criteria; (2) absence of evidence and history of any other systemic diseases; (3) medication-free for at least 2 weeks; (4) HAM-D 24 and/or HAM-A 17 scores (HAM-D≥20 and/or HAM-A≥14). For normal control subjects, the scores of HAM-D 24 and HAM-A 17 were <8 and 7, respectively.

Peripheral venous blood collection and total RNA extraction

Following 12 h fasting, 5 mL of peripheral venous blood was collected from both MDD patients and normal controls. The collected blood was stored in EDTA and was processed for total RNA extraction within 2 h of collection. Whole blood total RNAs were isolated by using PureLink^® RNA Mini Kit (Life Technologies, Carlsbad, CA, USA) according to manufacturer’s instructions. The isolated total RNAs were subjected to the BioSpec-nano Spectrophotometer (Shimadzu, Kyoto, Japan) for quantization of optical density (OD) at OD₂₆₀ and quality assessment at OD₂₆₀/OD₂₈₀ and OD₂₆₀/OD₂₃₀, respectively. In addition, 1% agarose gel electrophoresis was also used for total RNA quality control.

Reverse transcription and real-time PCR

Total RNAs were reverse transcribed into cDNAs by using PrimerScript™ RT Reagent Kit (Takara Bio Inc., Shiga, Japan) according to the manufacturer’s instructions. Briefly, the 10 μL reaction system was composed of 500 ng total RNA, 25 pmol Oligo dT primer, 50 pmol Random 6 mers, 2 μL of 5× PrimerSript buffer, 0.5 μL PrimerScript™ RT Enzyme Mix, and RNase free dH₂O. The reaction was performed on S1000™ Thermal Cycler (BIO-RAD, Hercules, CA, USA) by the program of 37 °C for 15 min and 85 °C for 5 s.

Beacon Designer™ software (PREMIER Biosoft, Palo Alto, CA, USA) was applied to design the polymerase chain reaction (PCR) primers for ATP1A1 (target) and β-actin (control) genes according to GenBank nucleotide sequence records. The forward and reverse primers for ATP1A1 gene (Accession number: NM_000701) were GGTCCCAACGCCCTCACTC and ACCACACCCAGGTACAGATTATCG, respectively. The forward and reverse primers for β-actin gene (Accession number: NM_001101) were GGCGGCACCACCATGTACCCT and AGGGGCCGGACTCGTCATACT, respectively. The primer sequences of ATP1A1 gene were subjected to nucleotide BLAST investigation against GenBank “Human genomic” and “transcript” databases to ensure the specificity (i.e. no sequence overlapping with other Na⁺/K⁺ ATPase α subunit isoforms). The real-time PCR was performed by using Applied Biosystems 7500 Fast Real-Time PCR System (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instruction. Briefly, the 25 μL reaction system was composed of 2 μL of diluted cDNA template, 12.5 μL SYBR^® Green Real-Time PCR Master Mix (Life Technologies, Carlsbad, CA, USA), and 0.2 mmol/L of each primer. The reaction conditions were 95 °C for 20 s, followed by 40 cycles of 95 °C for 3 s, 60 °C for 30 s, and then 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s, and 60 °C for 15 s. The amplified fragments were checked by running 1% agarose gel electrophoresis of the PCR products. A 10-fold dilution series of cDNA (10⁻³–10⁻¹⁰ times) for each target gene was applied as a standard to construct a relative standard curve and to determine the PCR efficiency that would be used in converting quantification cycle into relative quantity.

Data analysis

The real-time PCR data was processed and analyzed by using 7500 Fast Real-Time PCR System Sequence Detection Software (version 1.4) (Life Technologies, Carlsbad, CA, USA). The standard curve of each target gene and their amplification (Rn vs. Cycle) and dissociation curves were derived. The equations of each target gene amplification were then calculated for optimal experimental condition evaluation. The final absolute copy number of each target gene was calculated by using the formulation of target gene absolute copy numbers=sample concentration/sample molecular weight×6×10¹⁴ and then was converted to target gene relative copy numbers by using the formulation of target gene relative copy numbers=target gene absolute copy numbers/reference control gene absolute copy numbers. The data of both control and MDD groups were statistically assessed by using Microsoft Excel T-test program (Microsoft, Seattle, WA, USA). The comparative studies of ATP1A1 gene expression levels to MDD patients’ HAM-A and HAM-D scores were performed, respectively. Further, the correlative statistical analysis between ATP1A1 expression level and HAM-A score in all 40 patients’ samples was also performed by using Microsoft Excel CORREL program (Microsoft, Seattle, WA, USA).

Demographics

The general information about MDD and normal control groups is listed in Table 1. There were no significant differences between the control and each patient groups regarding age (p>0.05). However, there were significant differences in both HAM-A and HAM-D scores between the normal control and the MDD patients (p<0.01) (Table 2). According to the clinical survey scores of HAM-A and HAM-D, the MDD patients were reorganized into HAM-A1 (HAM-A score≥15) and HAM-A2 (HAM-A score≤14) groups, and HAM-D1 (HAM-D score≥24) and HAM-D2 (HAM-D score≤23) groups in further (Table 2). Additional analysis of MDD group regarding HAM-A and HAM-D scores showed that there was a significant difference in HAM-A scores between HAM-A1 and HAM-A2 groups (p<0.01), but no significant difference in HAM-D scores between those two groups (p>0.05) was observed. The comparative of HAM-D1 and HAM-D2 groups showed a significant difference in HAM-D scores (p<0.01) and no significant difference in HAM-A scores (p>0.05) (Table 2).

Real-time PCR reactions of target and control genes

Both ATP1A1 and β-actin genes demonstrated satisfactory amplification and unique PCR product in each individual gradient reaction with a single sharp amplification peak and a smooth amplification curve. Both genes’ standard equations showed a linear relationship with R²-values larger than 0.99 and the slopes less than –3, which indicated the success of reactions for both genes’ amplifications.

Comparative study of ATP1A1 expression among control and MDD patient groups

The absolute and relative copy numbers of ATP1A1 and β-actin genes of each individual subject among the control and MDD groups were calculated. The distribution of ATP1A1 gene relative expression levels among control and MDD groups were shown in Figure 1. There was a significant difference on ATP1A1 expression level between control and whole MDD patient groups (p<0.01). Additional studies showed that the ATP1A1 gene expression levels of all MDD subgroups showed significant reduction compared to that of control group (p<0.01). Further, there was a significant difference in ATP1A1 gene expression level reduction between HAM-A1 and HAM-A2 groups (p<0.01). However, there was no significant difference in ATP1A1 gene expression level changes between HAM-D1 and HAM-D2 groups (p>0.05). In addition, the correlation statistical analysis between ATP1A1 and HAM-A scores of all 40 patients showed a weak negative correlation between two groups (–0.3234) (Figure 2A).

Figure 1:

The distribution of ATP1A1 gene relative expression level among control and MDD groups.

Figure 2:

The relations and trends (solid line) of ATP1A1 gene expression level changes among HAM-A (A) and HAM-D (B) groups.