Corticosterone potentiates ochratoxin A-induced microglial activation

Anchana Chansawhang; Sataporn Phochantachinda; Piya Temviriyanukul; Boonrat Chantong

doi:10.1515/bmc-2022-0017

Article Open Access

Corticosterone potentiates ochratoxin A-induced microglial activation

Anchana Chansawhang , Sataporn Phochantachinda , Piya Temviriyanukul and Boonrat Chantong

Published/Copyright: April 19, 2022

Published by

Become an author with De Gruyter Brill

Submit Manuscript Author Information Explore this Subject

From the journal Biomolecular Concepts Volume 13 Issue 1

Abstract

Microglial activation in the central nervous system (CNS) has been associated with brain damage and neurodegenerative disorders. Ochratoxin A (OTA) is a mycotoxin that occurs naturally in food and feed and has been associated with neurotoxicity, while corticosteroids are CNS’ physiological function modulators. This study examined how OTA affected microglia activation and how corticosteroids influenced microglial neuroinflammation. Murine microglial cells (BV-2) were stimulated by OTA, and the potentiation effects on OTA-induced inflammation were determined by corticosterone pre-treatment. Expressions of pro-inflammatory mediators including tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6), and inducible nitric oxide synthase (iNOS) were determined. Phosphorylation of mitogen-activated protein kinases (MAPKs) was analyzed by western blotting. OTA significantly increased the mRNA expression of IL-6, TNF-α, IL-1β, and iNOS and also elevated IL-6 and NO levels. Corticosterone pre-treatment enhanced the neuroinflammatory response to OTA in a mineralocorticoid receptor (MR)-dependent mechanism, which is associated with increases in extracellular signal-regulated kinase (ERK) and p38 MAPK activation. In response to OTA, microglial cells produced pro-inflammatory cytokines and NO, while corticosterone increased OTA-induced ERK and p38 MAPK phosphorylation via MR. Findings indicated the direct role of OTA in microglia activation and neuroinflammatory response and suggested that low corticosterone concentrations in the brain exacerbated neurodegeneration.

Keywords: corticosterone; mitogen-activated protein kinases; microglia; neuroinflammation; ochratoxin A

Abbreviations

BSA: bovine serum albumin
COX-2: cyclooxygenase-2
DMSO: dimethyl sulfoxide
DMEM: Dulbecco’s modified eagle medium
ERK: extracellular signal-regulated kinase
GAPDH: glyceraldehyde-3-phosphate dehydrogenase
GR: glucocorticoid receptor
IL-1β: interleukin-1β
IL-6: interleukin-6
iNOS: inducible nitric oxide synthase
JNK: c-Jun N-terminal kinase
LPS: lipopolysaccharide
MAPKs: mitogen-activated protein kinases
MR: mineralocorticoid receptors
NF-κB: nuclear factor-κB
NO: nitric oxide
PBS: phosphate-buffered saline
PCR: polymerase chain reaction
PMS: N-methyl dibenzopyrazine methyl sulfate
PVDF: polyvinylidene fluoride
ROS: reactive oxygen species
SD: standard deviation
TBST: tris-buffered saline tween-20
TMB: tetramethylbenzidine
TNF-α: tumor necrosis factor-α
OTA: ochratoxin A

Introduction

Microglial cells are brain-resident macrophage-like cells that are involved in the neuroinflammatory response. Neurodegenerative diseases such as multiple sclerosis, Parkinson’s disease (PD), and Alzheimer’s disease (AD) are caused by overactive microglial cells which produce pro-inflammatory cytokines, mediators, and reactive oxygen species (ROS), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6), and nitric oxide (NO) [1,2,3]. Mycotoxins have been shown to be toxic to humans and animals. Mycotoxins contaminate nearly 25% of worldwide cereal yield, according to the United Nations Food and Agriculture Organization [4]. Ochratoxin A (OTA) is a frequent food and feedstock contaminant produced by Aspergillus and Penicillium. The International Agency for Research on Cancer (IARC) classified OTA as a human carcinogen of class 2B (possibly carcinogenic to humans) [5]. OTA is concentrated in the cerebellum, pons, and cerebral cortex, resulting in neurotoxicity and neuroinflammation [6,7]. Numerous research groups have recognized the neurotoxic potential of OTA in the development of neurodegenerative disorders [7,8,9,10,11,12,13,14]. It has been hypothesized that OTA-mediated neurotoxicity occurs as a result of mitogen-activated protein kinase (MAPK) activation [15,16]. MAPK signaling has been shown to play a critical role in microglial cell activation by regulating the production of pro-inflammatory mediators [17,18]. However, it remains unclear whether microglia respond to OTA and induce neuroinflammatory cascades.

The hypothalamic–pituitary–adrenal (HPA) axis is a neurohumoral signaling system associated with stress response that releases glucocorticoid stress hormones, primarily cortisol in humans and corticosterone in rodents [19]. Chronic stress causes a significant increase in systemic baseline glucocorticoid release, which might exacerbate neurodegenerative disorders [20,21,22]. Glucocorticoids enter the brain and activate the glucocorticoid and mineralocorticoid receptors (GR and MR), which are critical for controlling the brain s response to stress [23]. Both GR and MR are expressed differently in neurons, microglia, astrocytes, and oligodendrocytes, and have opposing affinity and sensitivity to corticosteroid concentrations [24,25]. In various studies, glucocorticoids have been shown to promote neuroinflammation and enhance neurotoxicity. For instance, pre-exposure to corticosterone enhanced the neuroinflammatory response and neurotoxicity to methamphetamine [26], organophosphates [27,28], alcohol [29], and lipopolysaccharides (LPS) [30,31,32,33]. Chronic stress and glucocorticoids have been demonstrated to sensitize microglia, causing them to respond exaggeratedly to a second stimulus, such as LPS [22,30,34]. Thus, the present study wondered whether persistent stress may make microglia more vulnerable to OTA-induced neuroinflammation by promoting microglia activation.

As mentioned above, corticosterone may modulate microglial cell vulnerability to OTA-induced neuroinflammation. Here the expression of different pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6) and the release of IL-6 and NO in murine microglia in response to OTA exposure were measured to investigate the influence of corticosterone pre-treatment on microglial cell activation by OTA and the underlying key signaling molecules. Findings showed that corticosterone exacerbated OTA-induced pro-inflammatory cytokine production in microglia through MR modulation of the extracellular signal-regulated kinase (ERK) and p38 MAPK signaling pathways.

Materials and methods

Reagents and antibodies

Cell culture medium and supplements such as RPMI-1640, fetal bovine serum (FBS), l-glutamine, penicillin, streptomycin, fungizone, and trypsin were acquired from GIBCO (Waltham, MA, USA). Lipopolysaccharide (LPS) from Escherichia coli O111: B4, ochratoxin A (from Aspergillus ochraceus), sodium 3′-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis (4-methoxy6-nitro) benzene sulfonic acid hydrate (XTT), N-methyl dibenzopyrazine methyl sulfate (PMS), PD98059 (ERK inhibitor), SP600125 (JNK inhibitor), and SB203580 (p38 inhibitor) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Antibodies against actin (cat no. 4970), both phosphorylated and unphosphorylated ERK (cat no. 4376 and 4695), p38 MAPK (cat no. 9215 and 9212), and c-Jun N-terminal kinase (JNK) (cat no. 4671 and 9252) were obtained from Cell Signaling Technology (Danvers, MA, USA). The Bradford solution, non-fat dry milk, and polyvinylidene fluoride (PVDF) membrane were purchased from Bio-Rad (Benicia, CA, USA). The 2x qPCRBIO SyGreen 1-step Lo-ROX was obtained from PCR Biosystems (Wayne, PA, USA). Tri-RNA Reagent was purchased from Favorgen (Kaohsiung, Taiwan). IL-6 quantitative sandwich ELISA kit and radioimmunoprecipitation assay (RIPA) buffer were obtained from Abcam (Cambridge, MA, USA). The Griess reagent and CellTiter-Glo^® Luminescence assay kits were purchased from Promega (Madison, WI, USA). Protease inhibitor cocktail was purchased from Roche (Shanghai, China). Immobilon Forte Western HRP substrate was obtained from Merck Millipore (Burlington, MA, USA). Unless otherwise noted, all additional reagents were from Sigma-Aldrich. OTA was dissolved in DMSO and serially diluted in a cell culture medium. In the cultured cells experiments, the final concentration of DMSO was 0.5% (v/v) for the highest mycotoxin concentrations.

Cell culture and treatment

BV-2 cell culture

Immortalized mouse microglial cells (BV-2) were obtained from the Interlab Cell Line Collection (Genoa, Italy), and cultured as previously described [30] in 75 cm² flasks with RPMI-1640 medium supplemented with 10% FBS, penicillin (100 U/mL), streptomycin (100 µg/mL), fungizone (2.5 µg/mL), non-essential amino acids (0.1 mM), and HEPES (10 mM), at pH of 7.4 and at 37°C in a humidified incubator containing 5% CO₂. Cells were trypsinized after they reached approximately 80% confluence.

Treatment

Before each experiment, cells were seeded into 96-well plates (1 × 10³ cells/well for the XTT reduction assay and adenosine triphosphate (ATP) determination), 24-well plates (2 × 10⁴ cells/well for ELISA and NO measurement), 12-well plates (5 × 10⁵ cells/well for qPCR), and 6-well plates (1 × 10⁶ cells for western blotting), and incubated for 12 h at 37°C in FBS-free DMEM.

To determine the cytotoxicity and inflammatory activity of OTA on microglia, BV-2 cells were treated with various concentrations of OTA (32.25–2,000 nM) for 24 h before analysis.

To investigate the role of MAPKs on the inflammatory effects of OTA, BV-2 cells were pre-incubated for 1 h with PD98059 (ERK inhibitor; 20 µM), SP600125 (p38 MAPK inhibitor; 20 µM), and SB203580 (JNK inhibitor; 10 µM) before treatment for another 24 h with OTA (50, 250, and 500 nM).

To assess the effects of corticosterone and the receptors involved in OTA-induced microglia activation, cells were treated for 12 h with corticosterone (25 nM) in the absence or presence of spironolactone (1 µM) or mifepristone (1 µM), specific receptor antagonists of MR and GR, respectively, followed by treatment with OTA (250 nM).

Quantitative real-time polymerase chain reaction (qRT-PCR)

Following treatment, total RNA was extracted from cells using Tri-RNA Reagent, following the manufacturer’s instructions. Nanodrop ND-1000 spectrophotometry was used to analyze the RNA quality and concentration (NanoDrop Technologies, Wilmington, DE, USA). The qRT-PCR reaction mixture, qPCRBIO SyGreen 1-step Lo-ROX, was prepared according to the manufacturer’s recommendations (PCR Biosystems, Wayne, PA, USA). The qTOWER3 Real-Time PCR Systems (Analytik Jena, Langewiesen, Germany) were used to conduct qRT-PCR, and the mRNA expression levels were normalized to GAPDH. Each experiment was replicated at least three times, and the primer sequences are detailed in Table 1.

Table 1

Primers used for qRT-PCR

Genes	Primers	Sequences
GAPDH (mouse)	Forward	CTCGTGGAGTCTACTGGTGT
GAPDH (mouse)	Reverse	GTCATCATACTTGGCAGGTT
iNOS (mouse)	Forward	ATGAGGTACTCAGCGTGCTCCAC
iNOS (mouse)	Reverse	CCACAATAGTACAATACTACTTGG
IL-1β (mouse)	Forward	CGACAAAATACCTGTGGCCT
IL-1β (mouse)	Reverse	TTCTTTGGGTATTGCTTGGG
IL-6 (mouse)	Forward	GGAGGCTTAATTACACATGTT
IL-6 (mouse)	Reverse	TGATTTCAAGATGAATTGGAT
TNF-α (mouse)	Forward	TTCTGTCTACTGAACTTCGG
TNF-α (mouse)	Reverse	GTATGAGATAGCAAATCGGC

XTT reduction assay

The XTT reduction test was employed to assess cell viability. After treatment, the medium was withdrawn and solution containing XTT at 0.3 mg/mL and PMS at 125 mM was added in each well. Cells were incubated for 4 h at 37°C. The absorbance at 450 nm was measured by a microplate reader (BioTek, Winooski, VT, USA), while cell viability was quantified as a percentage of the control.

ATP level determination

Total ATP content was evaluated using the manufacturer’s suggested CellTiter-Glo^® Luminescence test kit. The assay buffer and substrate were pre-warmed. The buffer was then mixed gently with the substrate. Following cell treatment, 100 µL of the assay reagent was added to each well and stirred for 30 min under light protection. Luminescence was measured by a microplate reader (BioTek, Winooski, VT, USA). The luminescence signal was quantified as a percentage of the control.

Determination of NO production

The amount of nitrite released in the supernatant was determined using Griess reagent. Briefly, supernatant was mixed with reagent A (1% w/v sulfanilamide in 5% phosphoric acid) for 10 min then followed by incubation with reagent B (0.1% w/v N-1-napthylethylenediamine dihydrochloride) for 10 min. The absorbance at 540 nm was determined by a microplate reader (BioTek, Winooski, VT, USA).

IL-6 level measurement by ELISA

The levels of IL-6 were determined using a sandwich ELISA kit from Abcam (Cambridge, MA, USA). Briefly, 96-well ELISA plates (NUNC, Roskilde, Denmark) were pre-coated with murine monoclonal anti-mouse IL-6 antibody. Following addition of the supernatants, incubation, and washing, the biotinylated murine anti-IL-6 antibody was added. After incubation, HRP-streptavidin enzyme was added, followed by a substrate solution (TMB). Sulfuric acid (1 M) was added to stop the reaction. The absorbance was measured at 450 nm using a microplate reader (BioTek, Winooski, VT, USA).

Western blotting

Whole-cell lysates were prepared using RIPA buffer with protease inhibitors. Protein concentration was quantified by the Bradford assay. Equal amounts of protein (30 μg) were separated on a 10% SDS-polyacrylamide gel and then electro-blotted onto 0.2 μm PVDF membranes. Blots were blocked in 5% non-fat milk in TBST (10 mM Tris (pH 8.0) and 150 mM NaCl solution containing 0.05% Tween-20) for 1 h. After washing, the membrane was incubated overnight at 4°C with the following primary antibodies: anti-actin (1:5,000), anti-p-p38 (1:1,000), anti-p38 (1:1,000), anti-p-JNK (1:1,000), anti-JNK (1:1,000), anti-p-ERK (1:1,000), and anti-ERK (1:1,000). The membranes were washed with TBST and further incubated with anti-rabbit IgG-horseradish peroxidase (1:5,000) for 1 h. Immunolabeling was detected using the Immobilon Forte Western HRP substrate and visualized by Gel doc (Bio-Rad, Benicia, CA, USA). The density of the immunoreactive bands was quantitated using ImageJ software and normalized using actin as a loading control.

Statistical analysis

Data are expressed as mean value ± SD of the indicated number of independent experiments. All experiments were carried out in at least three replicates. Results were analyzed by one-way ANOVA followed by Tukey’s multiple comparison tests using GraphPad Prism (GraphPad Prism Software Inc., San Diego, CA, USA). Differences were considered statistically significant at p < 0.05.

Results

Cytotoxicity of ochratoxin A on microglial BV-2 cells

To determine the OTA cytotoxicity in BV-2 microglia, the XTT reduction assay and ATP levels were employed. The maximal OTA concentration in the present study was tenfold higher than those found in plasma [35]. The results revealed that 24 h treatments with OTA concentrations ranging from 15 to 2,000 nM did not decrease the viability of the microglial BV-2 cells, as determined by XTT reduction (Figure 1a) as well as ATP levels (Figure 1b).

Figure 1

Cytotoxicity of ochratoxin A on microglial BV-2 cells. BV-2 cells were incubated with different concentrations of OTA (31.25, 62.5, 125, 250, 500, 1,000, and 2,000 nM) for 24 h. (a) Cell viability examined by XTT reduction assay. (b) ATP levels measured by CellTiter-Glo^® luminescence assay kit. Results are expressed as a percentage of the control (100%). Values are mean values ± SD of at least three independent experiments.

Ochratoxin A-induced microglial activation

Neuronal injury is a significant element that contributes to microglial activation, which results in an inflammatory response by releasing numerous inflammatory markers [2]. As a result, we investigated the effects of OTA on microglial activation through the production of inflammatory markers, including IL-6, TNF-α, IL-1β, iNOS, and NO. After exposure to OTA, the responses of these inflammatory markers were determined. Exposure of BV-2 cells with OTA (50–2,000 nM) for 24 h significantly upregulated the expression of IL-6, TNF-α, IL-1β, and iNOS at mRNA levels (Figure 2a) in a dose-dependent fashion, albeit with different levels of expression. iNOS mRNA expression was the highest compared to the other genes. The concentrations of IL-6 and NO released into the culture media were determined using ELISA and Griess reagent, respectively. The results showed that OTA-treated BV-2 significantly increased IL-6 and NO production in a concentration-dependent manner when compared to controls. Consistent with the results in Figure 2a, increased IL-6 and NO were observed when OTA at 500 nm was applied. The morphology of the control BV-2 cells was mostly spherical with small dark nuclei. Cells treated with OTA and LPS became elongated with short thick processes (Figure 2d), confirming BV-2 activation by OTA. Overall, the data indicate that the non-toxic doses of OTA triggered microglial activation within 24 h of treatment in a dose-dependent fashion.

Figure 2

Effects of ochratoxin A on microglial inflammatory responses. BV-2 cells were incubated with different concentrations of OTA (50, 100, 250, 500, 1,000, and 2,000 nM) for 24 h. (a) mRNA levels of IL-6, TNF-α, IL-1β, and iNOS examined by qRT-PCR. (b) The IL-6 levels measured by ELISA. (c) NO levels measured by Griess reagent. (d) Cell morphology at 24 h obtained by taking phase-contrast pictures with an inverted Nikon microscope (10×). Data were expressed as mean value ± SD from at least three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.005, and ****p < 0.0001 compared to the control medium.

ERK and p38 MAPK are essential for induction of microglial activation by ochratoxin A

MAPK signaling activity has been involved in the production of pro-inflammatory mediators during microglial activation [36]. Thus, we conjectured that OTA may activate MAPKs, particularly the ERK, JNK, and p38 pathways, during microglial activation. To study the involvement of MAPKs in microglia activation triggered by OTA, three specific inhibitors as PD98059 (ERK inhibitor; 20 µM), SB202190 (p38 MAPK inhibitor; 10 µM), and SP600125 (JNK inhibitor; 20 µM) were co-treated with BV-2 and OTA. The BV-2 cells were pre-incubated with each specific inhibitor for 1 h before exposure with OTA (50, 250, and 500 nM) for 24 h (Figure 2). The cytokine mRNA expression, IL-6 levels, and NO levels were examined, as shown in Figure 2. Compared to cells treated only with OTA, cells pre-incubated with PD98059 (ERK inhibitor) and SB202190 (p38 MAPK inhibitor) significantly decreased the mRNA expression of IL-6, TNF-α, IL-1β, and iNOS induced by OTA (Figure 3a–d). Consistent with the mRNA data, PD98059 and SB202190 significantly reduced IL-6 protein and NO levels in OTA-treated BV-2 cells (Figure 3e and f). Nevertheless, pre-treatment with a JNK inhibitor did not affect microglial activation induced by OTA. Western blot analysis was used to confirm whether OTA has a concentration-dependent effect on MAPK phosphorylation. As illustrated in Figure 3d, OTA treatment significantly increased ERK and p38 MAPK phosphorylation levels compared to the control group. Cotreatment with MAPK inhibitors decreased OTA-mediated ERK and p38 MAPK activation, while OTA was unable to stimulate JNK phosphorylation (data not shown). In conclusion, OTA activated microglia through activating ERK and p38 MAPK but not JNK.

Figure 3

Involvement of MAP kinases in OTA-induced pro-inflammatory cytokine and iNOS expression in glial cells. BV-2 cells were pre-treated with or without PD98059 (20 μM), SP600125 (20 μM), or SB203580 (10 μM) for 1 h, and then treated with OTA (500 nM) for 24 h. (a–d) mRNA levels of IL-6, TNF-α, IL-1β, and iNOS examined by real-time PCR. (e) IL-6 levels detected by ELISA. (f) NO levels measured by Griess assay. (g) Phosphorylation levels of ERK and p38 MAPK determined by western blot analysis. Data were expressed as mean value ± SD of at least three independent experiments. *p < 0.05, **p < 0.01, and ****p < 0.0001 compared to medium control and ^# p < 0.05 compared with OTA.

Corticosterone exacerbates ochratoxin A-induced activation of microglial cells through the MR

Increased glucocorticoid stress hormones (cortisol in humans and corticosterone in rodents) produced by the HPA axis are an important component of organismal stress responses (Scheuer, 2010). Furthermore, glucocorticoids have been reported to enhance neuroinflammation-mediated neurotoxicity [37]. Hence, it is probable that glucocorticoids enhance neuronal susceptibility to OTA via microglial activation. To clear this point, BV-2 cells were treated with or without corticosterone (25 nM) for 12 h and then exposed to OTA (250 nM) for an additional 24 h. Cell viability was not significantly altered by corticosterone at the concentrations used (data not shown). As illustrated in Figure 4a–d, pre-exposure to corticosterone significantly increased OTA-induced mRNA expression of IL-6, TNF-α, IL-1β, and iNOS (p < 0.01). These findings were confirmed by investigating the IL-6 and NO protein levels. Corticosterone significantly increased OTA-induced IL-6 and NO generation, consistent with the mRNA data (Figure 4e and f). To establish the role of GR and MR in corticosterone’s impact on OTA-treated microglia cells, mifepristone (GR antagonist) and spironolactone (MR antagonist) were employed. Following corticosterone pre-exposure in the presence or absence of spironolactone (1 µM) or mifepristone (1 µM), cells were incubated with OTA for 24 h. Spironolactone, but not mifepristone, reduced the mRNA expression of cytokines by OTA (Figure 5a–d). Similarly, spironolactone substantially decreased the generation of IL-6 and NO (Figure 5e and f). The involvement of ERK and p38 MAPK was studied in corticosterone-mediated microglia activation induced by OTA. Corticosterone significantly increased OTA-induced ERK and p38 MAPK phosphorylation, whereas spironolactone significantly attenuated this effect (Figure 4g). Taken together, the results indicated that corticosterone promoted OTA-induced microglia activation via MR regulation of ERK and p38 MAPK signaling.

Figure 4

Potentiation effects on OTA-induced cytokine mRNA expression and IL-6 and NO production in BV-2 cells. BV-2 cells were pre-treated with corticosterone (25 nM) in the absence or presence of spironolactone (1 μM) or mifepristone (1 μM) for 12 h and then exposed to OTA (250 nM) for 24 h. (a–d) mRNA levels of IL-6, TNF-β, IL-1β, and iNOS examined by real-time PCR. (e) IL-6 levels detected by ELISA. (f) NO levels measured by Griess reagent. (g) Phosphorylation levels of ERK and p38 MAPK determined by western blot analysis. Data were expressed as mean value ± SD of at least three independent experiments. *p < 0.05 and ****p < 0.0001 compared with OTA; ^# p < 0.05 and ^#### p < 0.0001 compared with OTA and corticosterone.

Figure 5

A proposed mechanism of how stress hormones (glucocorticoids) promote OTA-mediated microglia activation, which might lead to neurodegeneration.

Discussion

OTA triggered the neurotoxicity and the development of various neurodegenerative disorders including AD, PD, and neuropsychiatric disorders [11,12,13]. Stress hormones have been demonstrated to boost neuroinflammation and activate microglia [20,21,22]. Hence, it is probable that glucocorticoids enhance neuronal susceptibility to OTA via microglial activation. The purpose of this research was to determine the impact of corticosterone pre-treatment on microglial cell activation by OTA and the underlying key signaling molecules. We found that OTA activated microglia and enhanced the expression of pro-inflammatory mediators. We also showed that corticosterone amplified microglial activation produced by OTA.

Microglial activation serves essential functions in the brain, while the imbalance between the M1 (activated) and M2 (inactivated) phenotypes of microglial contributes to brain damage and pathologies such as ischemia, AD, PD, and multiple sclerosis [1,2,3,38]. Microglia undergo morphological changes during the M1 stage through the secretion of pro-inflammatory cytokines such as TNF-α, IL-6, IL-1β, and other inflammatory mediators, including NO and ROS [3,38,39,40]. Therefore, the mRNA expression of IL-6, TNF-β, IL-1β, and iNOS and the release of IL-6 and NO were employed as bio-indicators of activated microglia. This study provided evidence that OTA promoted inflammation-mediated microglia activation by increasing pro-inflammatory cytokine mRNA expression and elevating IL-6 and NO levels in a concentration-dependent manner. This finding was consistent with previous studies exhibiting pro-inflammatory mediator induction of OTA in various cell types including microglia, macrophages, and Kupffer cells [14,41,42]. OTA has previously been demonstrated to have pro-inflammatory activities in a variety of acute and chronic inflammatory conditions of the liver, kidney, and gastrointestinal system [43,44,45]. However, the ability of OTA to produce neuroinflammation remains unclear although several studies have established neurotoxicity [46].

While various signaling molecules are involved in the activation of microglia, MAPKs have been demonstrated to be crucial in the activation of microglia, leading to the etiology of neurodegenerative illnesses [17,18,36]. As a result, we investigated the involvement of MAPKs in OTA-induced microglia activation. Pre-treatment with an ERK inhibitor (PD98059) and p38 MAPK inhibitor (SB202190) but not with a JNK inhibitor (SP600125) dramatically reduced the elevation and production of inflammatory molecules produced by OTA. Moreover, suppressing ERK and p38 MAPK with PD98059 and SB202190 abolished IL-6 and NO generation. Western blot results demonstrated that OTA treatment of BV-2 microglia increased ERK and p38 MAPK phosphorylation but not JNK phosphorylation. This finding concurred with previous studies in epithelial cells, chicken heterophils, and porcine alveolar macrophages that OTA activated ERK and/or p38 MAPK [47,48,49,50]. However, in this study, OTA failed to induce JNK phosphorylation in BV-2 cells. OTA activated JNK, stimulated JNK phosphorylation, and potentiated the effect of TNF-α on JNK activation in renal epithelial kidney cells [51].

It has been demonstrated that dysregulation of the HPA axis, as well as elevated cortisol and corticosterone levels, are associated with microglia activities, which contribute to the development of neuroinflammatory processes [20,21,22]. Animal studies have shown that corticosterone activates microglia [26,52,53,54,55]. Consequently, the function of corticosterone on OTA-induced inflammation in microglia was studied. The current study found that pre-treatment with corticosterone (25 nM) enhanced OTA-induced inflammation in BV-2 microglial cells. Consistent with the western blot result, corticosterone with OTA caused higher phosphorylation of ERK and p38 MAPK than OTA alone. Consistent with our study, corticosterone enhanced microglia activity and sensitivity to LPS in the hippocampus of rodents [31,34,52]. Chronic exogenous corticosterone amplified methamphetamine/diisopropyl fluorophosphate-induced activation of microglia in the striatum, resulting in increased production of pro-inflammatory cytokines/chemokines [26,53].

In microglia cells, corticosterone has been demonstrated to activate both MR and GR [25,56,57,58]. Therefore, the receptor dependence of corticosterone-potentiated microglia activation by OTA was examined using mifepristone and spironolactone as GR and MR antagonists, respectively. Subsequent studies showed that spironolactone diminished the action of corticosterone on the potentiation effect of OTA on microglia activation and inhibited corticosterone-induced activation of ERK and p38 MAPK. Consistently, aldosterone, an MR agonist, increased cytokine expression and activation of the ERK and p38 MAPKs and was then abolished by spironolactone. This finding is consistent with the binding affinity of the corticosterone receptors, since MR is a high-affinity receptor for corticosterone and GR is a low-affinity receptor for corticosterone. Corticosterone reduced LPS-induced inflammatory production through a GR-dependent mechanism at high physiological concentrations. On the other hand, low corticosterone concentrations increased cytokine expression in an MR-dependent manner [24,25,30,59,60]. MRs are highly expressed in immune cells, particularly microglia, and their involvement in neuroinflammation is well established [38]. For instance, aldosterone induced an inflammatory response by MR activation, characterized by microglial activation [30]. Increased MR expression in the hippocampus of spontaneously hypertensive rats was related to increased ramified glial cells [61]. Aldosterone raised the number of microglia in the retina and promoted the generation of ROS and pro-inflammatory mediators [62].

Our findings have significant implication for the role of stress hormone released by the HPA axis in promoting neuroinflammation caused by OTA through microglia activation. Chronic stress primes microglia, resulting in an increased pro-inflammatory response through MR-mediated ERK and p38 MAPK pathways. Furthermore, mediators produced during microglial activation might activate the HPA axis, causing glucocorticoid production. [63]. Consequently, glucocorticoid persistence can activate microglia, resulting in a vicious cycle (Figure 5).

Conclusion

The molecular mechanism(s) through which OTA activates microglial cells via the ERK and p38 MAPK pathways were defined. Corticosterone enhanced OTA by activating the MAPK signaling pathway through MR. Results suggested that stress hormones contributed to OTA-induced neurodegeneration via microglia activation.

Funding information: This work was supported by The Thailand Research Fund and Mahidol University [TRG5780153].
Author contributions: conceptualization: B.C.; data curation: A.C. and S.P.; formal analysis: A.C., S.P., and P.T.; funding acquisition: B.C.; investigation: A.C. and S.P.; methodology: A.C. and B.C.; project administration: B.C.; resources: P.T. and B.C.; validation: A.C. and S.P.; visualization: A.C.; writing – original draft preparation: A.C. and B.C.; writing – review and editing: A.C., S.P., P.T., and B.C. All authors have read and agreed to the published version of the manuscript.
Conflict of interest: The authors declare that there are no conflicts of interest regarding the publication of this article.
Data availability statement: All data generated or analyzed during this study are included in this published article [and its supplementary information files].

References

[1] Xu L, He D, Bai Y. Microglia-mediated inflammation and neurodegenerative disease. Mol Neurobiol. 2016;53(10):6709–15.10.1007/s12035-015-9593-4Search in Google Scholar PubMed

[2] Subhramanyam CS, Wang C, Hu Q, Dheen ST. Microglia-mediated neuroinflammation in neurodegenerative diseases. Semin Cell Dev Biol. 2019;94:112–2010.1016/j.semcdb.2019.05.004Search in Google Scholar PubMed

[3] Tang Y, Le W. Differential roles of M1 and M2 microglia in neurodegenerative diseases. Mol Neurobiol. 2016;53(2):1181–94.10.1007/s12035-014-9070-5Search in Google Scholar PubMed

[4] Marin S, Ramos AJ, Cano-Sancho G, Sanchis V. Mycotoxins: occurrence, toxicology, and exposure assessment. Food Chem Toxicol. 2013;60:218–37.10.1016/j.fct.2013.07.047Search in Google Scholar PubMed

[5] Ostry V, Malir F, Toman J, Grosse Y. Mycotoxins as human carcinogens-the IARC Monographs classification. Mycotoxin Res. 2017;33(1):65–73.10.1007/s12550-016-0265-7Search in Google Scholar PubMed

[6] Belmadani A, Tramu G, Betbeder AM, Steyn PS, Creppy EE. Regional selectivity to ochratoxin A, distribution and cytotoxicity in rat brain. Arch Toxicol. 1998;72(10):656–62.10.1007/s002040050557Search in Google Scholar PubMed

[7] Sava V, Reunova O, Velasquez A, Harbison R, Sánchez-Ramos J. Acute neurotoxic effects of the fungal metabolite ochratoxin-A. NeuroToxicology. 2006;27(1):82–92.10.1016/j.neuro.2005.07.004Search in Google Scholar PubMed

[8] Zhang X, Boesch-Saadatmandi C, Lou Y, Wolffram S, Huebbe P, Rimbach G. Ochratoxin A induces apoptosis in neuronal cells. Genes Nutr. 2009;4(1):41–8.10.1007/s12263-008-0109-ySearch in Google Scholar PubMed PubMed Central

[9] Zurich M-G, Lengacher S, Braissant O, Monnet-Tschudi F, Pellerin L, Honegger P. Unusual astrocyte reactivity caused by the food mycotoxin ochratoxin A in aggregating rat brain cell cultures. Neuroscience. 2005;134(3):771–82.10.1016/j.neuroscience.2005.04.030Search in Google Scholar PubMed

[10] Wilk–Zasadna I, Minta M. Developmental toxicity of ochratoxin A in rat embryo midbrain micromass cultures. Int J Mol Sci. 2009;10(1):37–49.10.3390/ijms10010037Search in Google Scholar PubMed PubMed Central

[11] Niaz K, Shah SZA, Khan F, Bule M. Ochratoxin A–induced genotoxic and epigenetic mechanisms lead to Alzheimer disease: its modulation with strategies. Environ Sci Pollut Res. 2020;27(36):44673–700.10.1007/s11356-020-08991-ySearch in Google Scholar PubMed

[12] Ratnaseelan AM, Tsilioni I, Theoharides TC. Effects of mycotoxins on neuropsychiatric symptoms and immune processes. Clin Ther. 2018;40(6):903–17.10.1016/j.clinthera.2018.05.004Search in Google Scholar PubMed

[13] Bhat PV, Anand T, Manu TM, Khanum F. Restorative effect of l-dopa treatment against ochratoxin A induced neurotoxicity. Neurochem Int. 2018;118:252–63.10.1016/j.neuint.2018.04.003Search in Google Scholar PubMed

[14] von Tobel JS, Antinori P, Zurich MG, Rosset R, Aschner M, Glück F, et al. Repeated exposure to ochratoxin A generates a neuroinflammatory response, characterized by neurodegenerative M1 microglial phenotype. Neurotoxicology. 2014;44:61–70.10.1016/j.neuro.2014.04.005Search in Google Scholar PubMed

[15] Rumora L, Grubisić TZ. A journey through mitogen-activated protein kinase and ochratoxin A interactions. Arh Hig Rada Toksikol. 2009;60(4):449–56.10.2478/10004-1254-60-2009-1969Search in Google Scholar PubMed

[16] Rumora L, Domijan AM, Zanić Grubišić T, Segvić, Klarić M. Differential activation of MAPKs by individual and combined ochratoxin A and citrinin treatments in porcine kidney PK15 cells. Toxicon. 2014;90:174–83.10.1016/j.toxicon.2014.08.006Search in Google Scholar PubMed

[17] Koistinaho M, Koistinaho J. Role of p38 and p44/42 mitogen-activated protein kinases in microglia. Glia. 2002;40(2):175–83.10.1002/glia.10151Search in Google Scholar PubMed

[18] Kim EK, Choi EJ. Compromised MAPK signaling in human diseases: an update. Arch Toxicol. 2015;89(6):867–82.10.1007/s00204-015-1472-2Search in Google Scholar PubMed

[19] Smith SM, Vale WW. The role of the hypothalamic-pituitary-adrenal axis in neuroendocrine responses to stress. Dialogues Clin Neurosci. 2006;8(4):383.10.31887/DCNS.2006.8.4/ssmithSearch in Google Scholar

[20] Swaab DF, Bao A-M, Lucassen PJ. The stress system in the human brain in depression and neurodegeneration. Age Res Rev. 2005;4(2):141–94.10.1016/j.arr.2005.03.003Search in Google Scholar PubMed

[21] Sheng JA, Bales NJ, Myers SA, Bautista AI, Roueinfar M, Hale TM, et al. The Hypothalamic-pituitary-adrenal axis: development, programming actions of hormones, and maternal-fetal interactions. Front Behav Neurosci. 2021;14:256.10.3389/fnbeh.2020.601939Search in Google Scholar PubMed PubMed Central

[22] Milligan Armstrong A, Porter T, Quek H, White A, Haynes J, Jackaman C, et al. Chronic stress and Alzheimer’s disease: the interplay between the hypothalamic–pituitary–adrenal axis, genetics and microglia. Biol Rev. 2021;96(5):2209–28.10.1111/brv.12750Search in Google Scholar PubMed

[23] Scheuer DA. Regulation of the stress response in rats by central actions of glucocorticoids. Exp Physiol. 2010;95(1):26–31.10.1113/expphysiol.2008.045971Search in Google Scholar PubMed PubMed Central

[24] Madalena KM, Lerch JK. The effect of glucocorticoid and glucocorticoid receptor interactions on brain, spinal cord, and glial cell plasticity. Neural Plast. 2017;2017:1–8.10.1155/2017/8640970Search in Google Scholar PubMed PubMed Central

[25] De Kloet ER, Van Acker SA, Sibug RM, Oitzl MS, Meijer OC, Rahmouni K, et al. Brain mineralocorticoid receptors and centrally regulated functions. Kidney Int. 2000;57(4):1329–36.10.1046/j.1523-1755.2000.00971.xSearch in Google Scholar PubMed

[26] Kelly KA, Miller DB, Bowyer JF, O’Callaghan JP. Chronic exposure to corticosterone enhances the neuroinflammatory and neurotoxic responses to methamphetamine. J Neurochem. 2012;122(5):995–1009.10.1111/j.1471-4159.2012.07864.xSearch in Google Scholar PubMed PubMed Central

[27] Locker AR, Michalovicz LT, Kelly KA, Miller JV, Miller DB, O’Callaghan JP. Corticosterone primes the neuroinflammatory response to Gulf War Illness‐relevant organophosphates independently of acetylcholinesterase inhibition. J Neurochem. 2017;142(3):444–55.10.1111/jnc.14071Search in Google Scholar PubMed PubMed Central

[28] O’Callaghan JP, Kelly KA, Locker AR, Miller DB, Lasley SM. Corticosterone primes the neuroinflammatory response to DFP in mice: potential animal model of Gulf War Illness. J Neurochem. 2015;133(5):708–21.10.1111/jnc.13088Search in Google Scholar PubMed PubMed Central

[29] Shukla PK, Meena AS, Dalal K, Canelas C, Samak G, Pierre JF, et al. Chronic stress and corticosterone exacerbate alcohol-induced tissue injury in the gut-liver-brain axis. Sci Rep. 2021;11(1):1–18.10.1038/s41598-020-80637-ySearch in Google Scholar PubMed PubMed Central

[30] Chantong B, Kratschmar DV, Nashev LG, Balazs Z, Odermatt A. Mineralocorticoid and glucocorticoid receptors differentially regulate NF-kappaB activity and pro-inflammatory cytokine production in murine BV-2 microglial cells. J Neuroinflamm. 2012;9(1):260.10.1186/1742-2094-9-260Search in Google Scholar PubMed PubMed Central

[31] Frank MG, Hershman SA, Weber MD, Watkins LR, Maier SF. Chronic exposure to exogenous glucocorticoids primes microglia to pro-inflammatory stimuli and induces NLRP3 mRNA in the hippocampus. Psychoneuroendocrinology. 2014;40:191–200.10.1016/j.psyneuen.2013.11.006Search in Google Scholar PubMed PubMed Central

[32] Kelly KA, Michalovicz LT, Miller JV, Castranova V, Miller DB, O’Callaghan JP. Prior exposure to corticosterone markedly enhances and prolongs the neuroinflammatory response to systemic challenge with LPS. PLoS one. 2018;13(1):e0190546.10.1371/journal.pone.0190546Search in Google Scholar PubMed PubMed Central

[33] Wijenayake S, Rahman MF, Lum CM, De Vega WC, Sasaki A, McGowan PO. Maternal high-fat diet induces sex-specific changes to glucocorticoid and inflammatory signaling in response to corticosterone and lipopolysaccharide challenge in adult rat offspring. J Neuroinflamm. 2020;17(1):1–16.10.1186/s12974-020-01798-1Search in Google Scholar PubMed PubMed Central

[34] Frank MG, Thompson BM, Watkins LR, Maier SF. Glucocorticoids mediate stress-induced priming of microglial pro-inflammatory responses. Brain Behav Immun. 2012;26(2):337–45.10.1016/j.bbi.2011.10.005Search in Google Scholar PubMed PubMed Central

[35] Coronel MB, Sanchis V, Ramos AJ, Marin S. Review. Ochratoxin A: presence in human plasma and intake estimation. Food Sci Technol Int. 2010;16(1):5–18.10.1177/1082013209353359Search in Google Scholar PubMed

[36] Park J, Min J-S, Kim B, Chae U-B, Yun JW, Choi M-S, et al. Mitochondrial ROS govern the LPS-induced pro-inflammatory response in microglia cells by regulating MAPK and NF-κB pathways. Neurosci Lett. 2015;584:191–6.10.1016/j.neulet.2014.10.016Search in Google Scholar PubMed

[37] Duque EdA, Munhoz CD. The pro-inflammatory effects of glucocorticoids in the brain. Front Endocrinol. 2016;7:78.10.3389/fendo.2016.00078Search in Google Scholar PubMed PubMed Central

[38] Bisht K, Sharma K, Tremblay M-È. Chronic stress as a risk factor for Alzheimer’s disease: roles of microglia-mediated synaptic remodeling, inflammation, and oxidative stress. Neurobiol Stress. 2018;9:9–21.10.1016/j.ynstr.2018.05.003Search in Google Scholar PubMed PubMed Central

[39] Streit WJ, Mrak RE, Griffin WST. Microglia and neuroinflammation: a pathological perspective. J Neuroinflammation. 2004;1(1):1–4.10.1186/1742-2094-1-14Search in Google Scholar PubMed PubMed Central

[40] Tse JK. Gut microbiota, nitric oxide, and microglia as prerequisites for neurodegenerative disorders. ACS Chem Neurosci. 2017;8(7):1438–47.10.1021/acschemneuro.7b00176Search in Google Scholar PubMed

[41] Monnet-Tschudi F, Zurich MG, Honegger P. Neurotoxicant-induced inflammatory response in three-dimensional brain cell cultures. Hum Exp Toxicol. 2007;26(4):339–46.10.1177/0960327107074589Search in Google Scholar PubMed

[42] Al-Anati L, Essid E, Stenius U, Beuerlein K, Schuh K, Petzinger E. Differential cell sensitivity between OTA and LPS upon releasing TNF-α. Toxins (Basel). 2010;2(6):1279–99.10.3390/toxins2061279Search in Google Scholar PubMed PubMed Central

[43] Wang W, Zhai S, Xia Y, Wang H, Ruan D, Zhou T, et al. Ochratoxin A induces liver inflammation: involvement of intestinal microbiota. Microbiome. 2019;7(1):151.10.1186/s40168-019-0761-zSearch in Google Scholar PubMed PubMed Central

[44] Marin DE, Pistol GC, Gras M, Palade M, Taranu I. A comparison between the effects of ochratoxin A and aristolochic acid on the inflammation and oxidative stress in the liver and kidney of weanling piglets. Naunyn Schmiedebergs Arch Pharmacol. 2018;391(10):1147–56.10.1007/s00210-018-1538-9Search in Google Scholar PubMed

[45] Longobardi C, Damiano S, Andretta E, Prisco F, Russo V, Pagnini F, et al. Curcumin modulates nitrosative stress, inflammation, and DNA damage and protects against ochratoxin A-induced hepatotoxicity and nephrotoxicity in rats. Antioxid (Basel). 2021;10:8.10.3390/antiox10081239Search in Google Scholar PubMed PubMed Central

[46] Paradells S, Rocamonde B, Llinares C, Herranz-Pérez V, Jimenez M, Garcia-Verdugo JM, et al. Neurotoxic effects of ochratoxin A on the subventricular zone of adult mouse brain. J Appl Toxicol. 2015;35(7):737–51.10.1002/jat.3061Search in Google Scholar PubMed

[47] Wang Y, Liu J, Cui J, Xing L, Wang J, Yan X, et al. ERK and p38 MAPK signaling pathways are involved in ochratoxin A-induced G2 phase arrest in human gastric epithelium cells. Toxicol Lett. 2012;209(2):186–92.10.1016/j.toxlet.2011.12.011Search in Google Scholar PubMed

[48] Han Z, Zhang Y, Wang C, Liu X, Jiang A, Liu Z, et al. Ochratoxin A-triggered chicken heterophil extracellular traps release through reactive oxygen species production dependent on activation of NADPH oxidase, ERK, and p38 MAPK signaling pathways. J Agric Food Chem. 2019;67(40):11230–5.10.1021/acs.jafc.9b03155Search in Google Scholar PubMed

[49] Hou L, Zhou X, Gan F, Liu Z, Zhou Y, Qian G, et al. Combination of selenomethionine and N-acetylcysteine alleviates the joint toxicities of aflatoxin B1 and ochratoxin A by ERK MAPK signal pathway in porcine alveolar macrophages. J Agric Food Chem. 2018;66(23):5913–23.10.1021/acs.jafc.8b01858Search in Google Scholar PubMed

[50] Lee J-Y, Lim W, Ryu S, Kim J, Song G. Ochratoxin A mediates cytotoxicity through the MAPK signaling pathway and alters intracellular homeostasis in bovine mammary epithelial cells. Environ Pollut. 2019;246:366–73.10.1016/j.envpol.2018.12.032Search in Google Scholar PubMed

[51] Gekle M, Schwerdt G, Freudinger R, Mildenberger S, Wilflingseder D, Pollack V, et al. Ochratoxin A induces JNK activation and apoptosis in MDCK-C7 cells at nanomolar concentrations. J Pharmacol Exp Ther. 2000;293(3):837–44.Search in Google Scholar

[52] Dey A, Hao S, Erion JR, Wosiski-Kuhn M, Stranahan AM. Glucocorticoid sensitization of microglia in a genetic mouse model of obesity and diabetes. J Neuroimmunol. 2014;269(1–2):20–7.10.1016/j.jneuroim.2014.01.013Search in Google Scholar

[53] Koo B-B, Michalovicz LT, Calderazzo S, Kelly KA, Sullivan K, Killiany RJ, et al. Corticosterone potentiates DFP-induced neuroinflammation and affects high-order diffusion imaging in a rat model of Gulf War Illness. Brain Behav Immun. 2018;67:42–6.10.1016/j.bbi.2017.08.003Search in Google Scholar

[54] Sun X, Han R, Cheng T, Zheng Y, Xiao J, So K-F, et al. Corticosterone-mediated microglia activation affects dendritic spine plasticity and motor learning functions in minimal hepatic encephalopathy. Brain Behav Immun. 2019;82:178–87.10.1016/j.bbi.2019.08.184Search in Google Scholar

[55] Komoltsev IG, Frankevich SO, Shirobokova NI, Volkova AA, Onufriev MV, Moiseeva JV, et al. Neuroinflammation and neuronal loss in the hippocampus are associated with immediate posttraumatic seizures and corticosterone elevation in rats. Int J Mol Sci. 2021;22(11):5883.10.3390/ijms22115883Search in Google Scholar

[56] Sierra A, Gottfried-Blackmore A, Milner TA, McEwen BS, Bulloch K. Steroid hormone receptor expression and function in microglia. Glia. 2008;56(6):659–74.10.1002/glia.20644Search in Google Scholar

[57] Hwang IK, Yoo KY, Nam YS, Choi JH, Lee IS, Kwon YG, et al. Mineralocorticoid and glucocorticoid receptor expressions in astrocytes and microglia in the gerbil hippocampal CA1 region after ischemic insult. Neurosci Res. 2006;54(4):319–27.10.1016/j.neures.2005.12.012Search in Google Scholar

[58] Tanaka J, Fujita H, Matsuda S, Toku K, Sakanaka M, Maeda N. Glucocorticoid- and mineralocorticoid receptors in microglial cells: the two receptors mediate differential effects of corticosteroids. Glia. 1997;20(1):23–37.10.1002/(SICI)1098-1136(199705)20:1<23::AID-GLIA3>3.0.CO;2-6Search in Google Scholar

[59] Reul JM, de Kloet ER, van Sluijs FJ, Rijnberk A, Rothuizen J. Binding characteristics of mineralocorticoid and glucocorticoid receptors in dog brain and pituitary. Endocrinology. 1990;127(2):907–15.10.1210/endo-127-2-907Search in Google Scholar

[60] Liu J, Mustafa S, Barratt DT, Hutchinson MR. Corticosterone preexposure increases NF-κB translocation and sensitizes IL-1β responses in BV2 microglia-like cells. Front Immunol. 2018;9:1–12.10.3389/fimmu.2018.00003Search in Google Scholar

[61] Brocca ME, Pietranera L, Meyer M, Lima A, Roig P, De Kloet ER, et al. Mineralocorticoid receptor associates with pro‐inflammatory bias in the hippocampus of spontaneously hypertensive rats. J Neuroendocrinol. 2017;29:7.10.1111/jne.12489Search in Google Scholar

[62] Rana I, Suphapimol V, Jerome JR, Talia DM, Deliyanti D, Wilkinson-Berka JL. Angiotensin II and aldosterone activate retinal microglia. Exp Eye Res. 2020;191:107902.10.1016/j.exer.2019.107902Search in Google Scholar PubMed

[63] Cheiran Pereira G, Piton E, Moreira dos Santos B, Ramanzini LG, Muniz Camargo LF, Menezes, da Silva R, et al. Microglia and HPA axis in depression: an overview of participation and relationship. World J Biol Psychiatry. 2021;6:1–18.10.1080/15622975.2021.1939154Search in Google Scholar PubMed

Received: 2022-01-27

Revised: 2022-02-26

Accepted: 2022-03-10

Published Online: 2022-04-19

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

https://doi.org/10.1515/bmc-2022-0017

Keywords for this article

corticosterone; mitogen-activated protein kinases; microglia; neuroinflammation; ochratoxin A

Creative Commons

BY 4.0