Home Thyroid hormone T3 induces Fyn modification and modulates palmitoyltransferase gene expression through αvβ3 integrin receptor in PC12 cells during hypoxia
Article Open Access

Thyroid hormone T3 induces Fyn modification and modulates palmitoyltransferase gene expression through αvβ3 integrin receptor in PC12 cells during hypoxia

  • Elisabed Kvergelidze , Tamar Barbakadze , Judit Bátor , Irine Kalandadze and David Mikeladze EMAIL logo
Published/Copyright: August 7, 2024
Download Article (PDF)
Become an author with De Gruyter Brill
Submit Manuscript Author Information
Translational Neuroscience
From the journal Translational Neuroscience Volume 15 Issue 1

Abstract

Thyroid hormones (THs) are essential in neuronal and glial cell development and differentiation, synaptogenesis, and myelin sheath formation. In addition to nuclear receptors, TH acts through αvβ3-integrin on the plasma membrane, influencing transcriptional regulation of signaling proteins that, in turn, affect adhesion and survival of nerve cells in various neurologic disorders. TH exhibits protective properties during brain hypoxia; however, precise intracellular mechanisms responsible for the preventive effects of TH remain unclear. In this study, we investigated the impact of TH on integrin αvβ3-dependent downstream systems in normoxic and hypoxic conditions of pheochromocytoma PC12 cells. Our findings reveal that triiodothyronine (T3), acting through αvβ3-integrin, induces activation of the JAK2/STAT5 pathway and suppression of the SHP2 in hypoxic PC12 cells. This activation correlates with the downregulation of the expression palmitoyltransferase-ZDHHC2 and ZDHHC9 genes, leading to a subsequent decrease in palmitoylation and phosphorylation of Fyn tyrosine kinase. We propose that these changes may occur due to STAT5-dependent epigenetic silencing of the palmitoyltransferase gene, which in turn reduces palmitoylation/phosphorylation of Fyn with a subsequent increase in the survival of cells. In summary, our study provides the first evidence demonstrating the involvement of integrin-dependent JAK/STAT pathway, SHP2 suppression, and altered post-translational modification of Fyn in protective effects of T3 during hypoxia.

Keywords: T3; hypoxia; Fyn; palmitoyltransferase; palmitoylation; JAK/STAT; SHP2; PC-12

1 Introduction

Thyroid hormones (THs), specifically thyroxine (T4) and triiodothyronine (T3) are vital for maintaining the body’s homeostasis and functioning. They play essential roles in neuronal and glial cell development and differentiation, synaptogenesis, and myelin sheath formation [1]. Through genomic and non-genomic mechanisms, THs affect organs, including the brain. Genomic action involves binding to nuclear receptors, directly regulating gene expression [2]. The non-genomic action of TH is a rapid process involving the interaction of THs with various cellular components, including the cytoskeleton and mitochondria [3]. Besides these actions, TH binds to plasma membrane integrin αvβ3, changing the transcriptional regulation of signaling proteins in downstream pathways [4,5]. These interactions lead to alterations in adhesion, growth, and proliferation.

Twenty-four distinct integrin heterodimers are expressed in mammals due to the combinatorial association of 18α and 8β subunits. Extracellular matrix ligands bind to the α subunit and activate intracellular signaling events via the β subunit to integrate extracellular and intracellular events necessary for cell motility, migration, and invasion [6]. The intracellular structures formed by integrins and cytoskeletal proteins are “focal complexes.” The first steps of integrin signaling involve interactions with tyrosine kinases such as focal adhesion kinase (Fak), Src kinase, integrin-linked kinase, cytoskeletal proteins such as talin and kindlin, and scaffold molecules such as P130CRK-associated substrate (P130Cas) [7]. Besides, integrins regulate the dynamics of the neuronal actin cytoskeleton, ultimately enhancing neuronal cell viability through the Rac1/NADPH oxidase/cofilin-1 pathway [8].

Increasing evidence from clinical and preclinical studies reveals the critical roles of the non-receptor tyrosine kinase (nRTK) superfamily in the pathophysiology and therapy of cognitive disorders [9]. To date, several nRTK members from three nRTK subfamilies, i.e., the Src family kinase (SFK), the Janus tyrosine kinase (Jak), and the focal adhesion kinase (Fak) subfamilies, may connect to the intracellular, intranuclear, and synaptic signaling network linking chronic stress to depression- and anxiety-like behavior [10]. Emerging evidence shows that nRTK members from these three families are sensitive to stress [11]. Recent investigations have suggested that T3 decreases integrin αvβ3-dependent Fyn-kinase phosphorylation [8]. Fyn is a non-receptor tyrosine kinase of the Src family, abundant in the central nervous system. Fyn deficiency in mice leads to impaired hippocampal long-term potentiation, spatial learning deficits, and increased fear and audiogenic convulsion sensitivity in new generations [12]. Fyn activation can render neurons more susceptible to synaptotoxicity, while reduced activation has neuroprotective effects. However, excessive inhibition may impair cognitive function in humans. Thus, maintaining a delicate balance between Fyn activation and inhibition is crucial [13]. Overactivation of Fyn has been linked to brain pathogenesis induced by ischemia, potentially initiating apoptosis [14]. Besides Fyn, Jak tyrosine kinase plays a significant role in regulating the brain’s cognitive functions. Several studies show that JAK2/STAT5 signaling cascade is critical for neuropsychiatric disorders [15].

The activation of downstream signaling pathways within the cell is intricately regulated by post-translational modifications of upstream signaling proteins, including palmitoylation. Palmitoylation is a lipid modification of proteins involving the addition of palmitate residues to cysteine residues. This modification anchors proteins to subcellular membranes like the plasma membrane, allowing control over their membrane localization and cellular responses [16,17]. Palmitoylation is mediated by the protein palmitoyltransferase belonging to the DHHC (Asp-His-His-Cys motif) family, which transfers palmitoyl moiety to the palmitoylated protein [18,19]. Therefore, differential ZDHHC gene expression may influence protein translocations and play a significant role in the synaptic and metabolic activities of the brain. There are 23 distinct palmitoyltransferases identified in mammals, mainly located in the membrane of organelles, such as the endoplasmic reticulum, Golgi apparatus, and cell membrane [20]. In neurons, palmitoylation dynamically regulates the trafficking of proteins between the plasma membrane and subcellular structures like the Golgi apparatus, endoplasmic reticulum, and endosomes [21]. Palmitoylation plays a pivotal role in neural physiology, like neuroplasticity, and errors in palmitoylation/depalmitoylation can lead to brain pathology [22].

Hypoxia, a condition characterized by insufficient tissue-level oxygen, can result from reduced blood supply or decreased blood oxygen levels. It can manifest acutely or chronically, with varying tissue responses. Some tissues are highly resistant to hypoxia, while others are more vulnerable to brief exposures [23]. The impact of hypoxia on the brain depends on its type, duration, severity, and frequency. Hypoxia can trigger the release of inflammatory mediators like TNFα and IL1β, leading to local inflammation. It can also result in depolarization changes, oxidative stress, apoptosis, and neurodegeneration [24,25]. In several cell types, hypoxia selectively enhances integrin receptor expression [26]. In the brain, integrin activity changes during inflammation, hypoxia, and stress [27]. TH signaling has been implicated in hypoxic tissue remodeling after infarction, and T3 prevents remodeling of the postinfarcted tissue, decreasing secondary organ failure [28]. However, the precise intracellular mechanisms responsible for the protective effects of THs and the regulatory systems implicated in these processes remain unclear. Our hypothesis posits that non-receptor tyrosine kinases, associated with integrin activity and palmitoyltransferase gene activity in the cells, mediate the TH-dependent protective responses. In this study, we observed that T3, through integrin-αvβ3, triggers the JAK2/STAT5 pathway activation in PC12 cells. This activation is associated with integrin-dependent downregulation of the palmitoyltransferase-ZDHHC2 and ZDHHC9 gene expression and possibly the consequent reduction of palmitoylation of the tyrosine kinase Fyn. We propose that these changes may occur due to the STAT5-dependent epigenetic silencing of the palmitoyltransferase gene, which in turn reduces palmitoylation/phosphorylation of Fyn with a subsequent increase in the survival of cells [8]. In our interpretation, these molecular changes culminate in a reconfiguration of the actin cytoskeleton, ultimately enhancing neuronal cell viability [8].

2 Materials and methods

2.1 Cell line

Pheochromocytoma cells (PC-12, ATCC® CRL-1721™) were cultured in a humidified atmosphere containing 5% CO2 at 37°C in a high-glucose Dulbecco’s modified Eagle’s medium supplemented with 10% heat-inactivated horse serum (HS), 5% fetal bovine serum (FBS), and 100 unit/mL penicillin as well as 50 µg/mL gentamicin sulfate. To induce differentiation, PC-12 cells (5 × 106 cells per sample) were incubated in low serum-containing DMEM (1% HS and 1% FBS) supplemented with 100 ng/mL nerve growth factor (NGF) for 5 days. The cells were scored as differentiated if one or more neurites were longer than the cell body diameter. Cell viability and number were determined with trypan blue dye (Bio‐Rad, cat no. 145‐0013) using a cell counter (TC 20TM; Bio‐Rad, USA). Differentiated cells were incubated with 10 nM T3 and αvβ3 blocking antibody (αvβ3-Ab, 1 µg/ml; sc-7312, Santa Cruz Biotechnology). The experiments were performed under hypoxic conditions for 1 h. Hypoxic conditions (0–1% oxygen) were maintained using nitrogen gas in a BioSpherix C-Chamber placed in a CO2 incubator and controlled by a ProOx Model P110 controller (BioSpherix, USA).

2.2 Cell fractionation for electrophoresis and western blotting

After 1 h exposure to hypoxia, PC-12 cells were detached from the cell culture flasks using 0.025% trypsin/EDTA containing phosphate-buffered saline (PBS) [8]. Briefly, trypsin inactivation of detached cells was performed using aprotinin-containing PBS (1 µg/mL). Cells were washed twice with PBS and pelleted by centrifugation at 300 × g. Incubated PC-12 cells were lysed using a lysis buffer. For the palmitoylation detection, 1% IGEPAL CA‐630, 50 mM Tris‐HCl, 150 mM NaCl, 10% glycerol, 50 mM N-ethylmaleimide, PMSF, and PI Cocktail III; pH 7.5 containing lysis buffer (LB) were used and passed through a 25Ga needle 10 times using a 1 mL syringe. For the JAK/STAT pathway protein analysis, cells were lysed with lysis buffer provided by RayBiothec. After cell lysis, the nuclei and intact cells were sedimented at 720 × g for 5 min, and the supernatant was subjected to the next steps.

2.3 Palmitoylated Fyn and p-Fyn detection

For specific detection of palmitoylated Fyn and palmitoylated p-Fyn, samples (0.3 mg) were immunoprecipitated with anti-Fyn (sc-434; Santa Cruz Biotechnology, USA) or anti-p-Fyn (sc-377555; Santa Cruz Biotechnology, USA) primary antibody and incubated overnight at 4°C with gentle shaking. The next day, A/G agarose was added to each sample (sc-2001; Santa Cruz Biotechnology, USA) and incubated for 4 h at 4°C with gentle shaking. After incubation, samples were washed with PBS buffer three times by centrifugation at 300 × g for 2 min; the protein/primary antibody/A/G-agarose precipitate was subsequently used to determine the palmitoylation level of target proteins.

Palmitoylated Fyn (palm-Fyn) and palmitoylated and phosphorylated Fyn (palm-p-Fyn) kinases were detected in the Fyn-anti-Fyn/A-G-agarose and p-Fyn/anti-p-Fyn/A-G-agarose immunoprecipitate according to Brigidi and Bamji [29] and Goloshvili et al. [17]. Briefly, A/G-agarose bound samples were incubated with 10 mM N-ethylmaleimide (NEM) containing lysis buffer (LB + NEM buffer) and incubated for 10 min on ice. Then, the suspension was centrifuged at 500 × g at 4°C, and a Stringent Buffer was added to the samples, centrifuged very quickly, and the supernatant was removed. The residue was washed three times with LB pH 7.2 (LB7.2) buffer (washing includes 1-min centrifugation at 500 × g at 4°C). Then, newly prepared hydroxylamine (1 M HAM) containing LB7.2 + 10 mM NEM was added to the residue as a potent reducing agent for removing palmitate groups from cysteine residues in Fyn and p-Fyn kinase molecules. Samples were incubated for 1 h at room temperature with slow shaking. After incubation, the supernatant was removed, and each sample was washed once on ice with lysis buffer (LB, pH 6.2 PMSF/PI (LB6.2). For further biotinylation, thiol groups on free cysteine residues, Biotin-BMCC buffer (Sigma Aldrich, cat no. B9181) (working concentration: 0.5–5 µM) were added to the A/G-agarose complex of Fyn and p-Fyn of each sample and incubated for 1 h at 4°C with gentle shaking. After incubation, each sample was washed once on ice with LB6.2 PMSF/PI. Subsequently, samples were washed three times with LB7.2 + PMSF/PI. All samples were placed on ice during the above washing process. Next, 2× sodium dodecyl sulfate (SDS) assay buffer without mercaptoethanol (5% SDS, 5% glycerol, 125 mM Tris‐HCl, pH 6.8, and 0.01% bromophenol blue) was added to the samples with freshly prepared dithiothreitol. The content of biotin-BMCC bound to palm-Fyn and palm-p-Fyn was determined by electrophoresis and western blotting methods using immunolabeled streptavidin-HPR and visualized with an enhanced chemiluminescence kit (cat no. sc2048, ECL, Santa Cruz Biotechnology) and was analyzed using the Image J (1.53 k, National Institute of Health, USA).

2.4 Detection of the relative levels of phosphorylation of JAK/STAT pathway proteins

The relative levels of JAK/STAT pathway protein phosphorylation were detected using the RayBio® JAK/STAT Pathway Phosphorylation Array Kit (Cat# AAH-JAKSTAT-1-8; RayBiotech) according to the manufacturer’s manual. After quantification using the BCA kit, 100 μg of protein was loaded onto a RayBio Human Signaling Pathway Antibody Array membrane, and the steps mentioned in the manual were followed. In the end, immunolabeled bands on the membrane were visualized using enhanced chemiluminescence (sc-2048; Santa Cruz Biotechnology, USA) and analyzed by Image J (1.53 k, National Institute of Health, USA). The internal control signals of each protein array chip were used for standardization. A t-test was used for the difference analysis, and fold changes ≥1.5 times were considered significant.

2.5 RNA extraction with Trizol reagent

Trizol reagent is used to isolate RNA. About 1 ml Trizol was added to each sample and incubated for 5 min. Later, 200 µl/l chloroform was added, incubated for 15 min on ice, and centrifuged at 12,000 × g for 15 min at 4°C. RNA is precipitated from the aqueous layer with isopropanol and isolated according to Invitrogen’s user guide (TRIzol Reagent User Guide (Pub.No. MAN0001271 C.0). The amount and purity of the obtained RNA was determined spectrophotometrically using nanodrop (DeNovix DS-11 Spectrophotometer, DeNovix Inc., USA). The ratio A 260/A 280 should be >1.8. The RNA residue was dissolved in DEPC water and stored at −70°C.

2.6 cDNA synthesis using the RevertAid RT Kit

According to the protocol, the RevertAid RT Kit was used for the cDNA synthesis (cat no. K1691, Thermo Scientific) specified by the manufacturer. One microliter of Random hexamer primer was added to 2 μg RNA-containing samples and filled until 12 μL with nuclease-free water. This step was followed by the addition of 4 μL of 5× Reaction buffer, 1 μL RiboLock, 2 μL 10 mM DNTP, and 2 μL RevertAid. Finally, 20 μL of the mixture was incubated for 5 min at 25°C and 60 min at 42°C. The reaction was terminated by heating at 70°C for 5 min. The reverse transcription reaction product was stored at −70°C for real-time PCR experiments.

2.7 PCR amplification of first strand cDNA

The relative level of palmitoyl transferase genes 2, 3, 8, 9, and 16 (genes: Zdhh2, Zdhh3, Zdhh8, Zdhh9, Zdhh16, and housekeeping gene: Hprt1 – hypoxanthine phosporibosyl transferase) expression was analyzed using RT-RCR. Appropriate primers were selected for PCR by Integrate DNA Technology (https://eu.idtdna.com/scitools/Applications/RealTimePCR/Default.aspx) and using Primer-BLAST (Table 1) (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi) and were ordered to Eurofins Genomics, Ebersberg, Germany (Table 1).

Table 1

Primers for real-time PCR analyzing the genes: Zdhh2, Zdhh3, Zdhh8, Zdhh9, Zdhh16, and housekeeping gene Hprt1

Ref seq gene Accession number Forward primer (5′–3′) Reverse primer (5′–3′) Ampl. size
Hprt1 NM_012583.2 GTTCTGTCATGTCGACCCTC AACACCTTTTCCAAATCTTCAGC 115
Zdhhc2 NM_145096 TGTATGCGGCTGGAAGATG AGCTGATGAACACCACAGG 95
Zdhhc3 NM_001039014 ATGCCAGTATGGACAGAATAGC GGCTGGAGGTATTCTGGTTTC 86
Zdhhc8 NM_001039021 TCAAACCCGCCAAGTACATC ACAGCTCTTGTCAACCACG 103
Zdhhc9 NM_001039016 GATTTTCAAGCTCAGCCTCTG TTTCTCCCACTTCCTTGTCAC 120
Zdhhc16 NM_001039346 TGAAACTTCTATGCGCCAGG GAGCAGAGGTGGGCATC 120

Structured using Integrate DNA Technology (https://eu.idtdna.com/scitools/Applications/RealTimePCR/Default.aspx) and using Primer-BLAST. Hprt1: hypoxanthine phosphoribosyl transferase.

Table 2

RT-qPCR analysis of genes ZDHHC2, ZDHHC3, ZDHHC8, ZDHHC9, and ZDHHC16 showing the effect of 10 nM T3 and αvβ3-Ab integrin (µg/ml) in differentiated PC-12 cells exposed to 1 h hypoxia

ZDHHC2 (2^−(∆∆Ct)) ZDHHC3 (2^−(∆∆Ct)) ZDHHC8 (2^−(∆∆Ct)) ZDHHC9 (2^−(∆∆Ct)) ZDHHC16 (2^−(∆∆Ct))
Control 3.73 4.90 1.00 11.06 3.55
αvβ3-Ab 4.13 7.26 5.01 13.04 1.10
T3 1.92 5.02 0.75 6.97 4.82
T3+αvβ3-Ab 2.91 4.63 1.32 11.51 6.39

The results are expressed as 2^−(∆∆Ct) after normalization on Hprt1 (hypoxanthine phosphoribosyl transferase) housekeeping gene. Results represent the mean ± SEM of duplicate samples from three independent experiments.

Sybr Green PCR master mix (cat no. 4309155; Applied Biosystems) was used in RT-PCR experiments. The primers were diluted according to the manufacture protocol to a final concentration of 10 pmol/l. About 2 μL of the first strand cDNA synthesis reaction product of each sample was used as a template, followed by the addition of the 1 μL of forward primer (5′–3′), 1 μL of reverse primer (5′-3′), 21 μL of DNase- and RNase-free water, and 25 DNase- and RNase-free water 2X SYBR green Master Mix for subsequent PCR in 50 μL of total volume. The final mixture of all samples was subjected to PCR using the recommended thermal cycling conditions outlined as follows:

Step Temperature (°C) Time Number of cycles
Initial denaturation 95 1–3 min 1
Denaturation 95 30 s
Annealing Tm-5 30 s 40
Extension 72 1 min/kb
Final extension 72 5–15 min 1

2.8 Statistical analysis

Statistical analysis was performed using one-way ANOVA with post-hoc Tukey to compare multiple treatments. A value of p < 0.05 was considered as statistically significant.

3 Results

To elucidate the downstream regulatory systems involved in the effects of T3-dependent integrin activation during 1-h hypoxia, we analyzed the qualitative protein phosphorylation profile of the JAK/STAT pathway. Of the 12 phosphorylated proteins, the most significant changes were observed: JAK1 and JAK2, SHP1 and SHP2, STAT1, STAT3 and STAT5, and non-receptor tyrosine kinase – TYK2. Our results have shown that the phosphorylation of JAK1, SHP1, SHP2, and STAT1 decreased. In contrast, the phosphorylation of JAK2, STAT3, and STAT5 increased, and only the change in JAK2, STAT5, and SHP2 phosphorylation returned to control levels in the presence of an anti-integrin antibody (Figure 1). Phosphorylation of other proteins was not reversed in the presence of anti-integrin antibodies, indicating that, in these cases, the change in phosphorylation occurs independently of integrin. Therefore, only the integrin-dependent JAK2/STAT5 pathway is activated during hypoxia under the influence of T3.

Figure 1 JAK/STAT pathway’s protein phosphorylation in differentiated PC-12 cells in hypoxia. Densitometric analysis (arbitrary units of spot signal densities normalized to the positive control signals) showing the effect of 10 nM T3 and αvβ3-Ab integrin (µg/ml). Results represent the mean ± SEM of duplicate samples from two independent experiments. A significant level is defined as *p < 0.05 vs control and #p < 0.05 to T3.
Figure 1

JAK/STAT pathway’s protein phosphorylation in differentiated PC-12 cells in hypoxia. Densitometric analysis (arbitrary units of spot signal densities normalized to the positive control signals) showing the effect of 10 nM T3 and αvβ3-Ab integrin (µg/ml). Results represent the mean ± SEM of duplicate samples from two independent experiments. A significant level is defined as *p < 0.05 vs control and #p < 0.05 to T3.

Tyrosine kinase Fyn is involved in the phosphorylation and assembly/remodeling of the postsynaptic complexes in response to hypoxia/ischemia in the brain and Fyn coordinates with other non-receptor tyrosine kinases [30]. Fyn enhances Jak2-mediated phosphorylation [31], and both Fyn and Jak2 are required for ROS-dependent activation of redox-sensitive downstream systems [32]. Thus, the activity of Fyn kinase is closely related to the Jak2 pathway, in which post-translational modification could play a significant role. Our recent studies indicate that T3 reduces the p-Fyn/Fyn ratio, regulating actin cytoskeleton dynamics through αvβ3-integrin-mediated Fyn dephosphorylation [8] and by switching on anti-apoptotic pathways [33]. Considering that besides phosphorylation, the activity and localization of Fyn are regulated by palmitoylation [34], next, we investigated the αvβ3 integrin-mediated effects of T3 on Fyn palmitoylation and the phosphorylation of palmitoylated Fyn (at Thr12) during 1-h hypoxia. Our experiments revealed that T3 reduces Fyn palmitoylation, and this effect is reversed by αvβ3 integrin antibody (Figure 2). Additionally, T3 decreases the phosphorylation of palmitoylated Fyn, and inhibition of αvβ3-integrin by antibody significantly increases palmitoylated Fyn phosphorylation. Notably, inhibiting αvβ3 integrin without T3 reduces the phosphorylation of palmitoylated Fyn. These findings indicate that T3 activates Fyn phosphorylation, depending on protein palmitoylation.

Figure 2 The action of T3 on the phosphorylation and palmitoylation of Fyn A. The ratio of palmitoylated and non-palmitoylated Fyn and p-Fyn forms. The palm-Fyn/Fyn ratio in differentiated PC-12 cells exposed to 10 nM T3 and µg/ml αvβ3-Ab integrin during 1 h of hypoxia. (a) Immunoblotting image of palm-Fyn and total Fyn; the palm-p-Fyn/p-Fyn ratio in differentiated PC-12 cells exposed to 10 nM T3 and αvβ3-Ab integrin (µg/ml) during 1 h of hypoxia. (b) Immunoblotting image of palm-p-Fyn and total p-Fyn; plot of the ratio of palm-p-Fyn to total p-Fyn. Plot of the ratio of palm-Fyn to total Fyn. Results represent the mean ± SEM of duplicate samples from two independent experiments. A significant level was defined as *p < 0.05 vs control and #p < 0.05 to T3.
Figure 2

The action of T3 on the phosphorylation and palmitoylation of Fyn A. The ratio of palmitoylated and non-palmitoylated Fyn and p-Fyn forms. The palm-Fyn/Fyn ratio in differentiated PC-12 cells exposed to 10 nM T3 and µg/ml αvβ3-Ab integrin during 1 h of hypoxia. (a) Immunoblotting image of palm-Fyn and total Fyn; the palm-p-Fyn/p-Fyn ratio in differentiated PC-12 cells exposed to 10 nM T3 and αvβ3-Ab integrin (µg/ml) during 1 h of hypoxia. (b) Immunoblotting image of palm-p-Fyn and total p-Fyn; plot of the ratio of palm-p-Fyn to total p-Fyn. Plot of the ratio of palm-Fyn to total Fyn. Results represent the mean ± SEM of duplicate samples from two independent experiments. A significant level was defined as *p < 0.05 vs control and #p < 0.05 to T3.

Analyzing the ratio of phosphorylated to non-phosphorylated forms of palmitoylated Fyn in PC-12 cells revealed a significant effect of T3 and αvβ3 integrin. TH supplementation of hypoxic cells increases the proportion of phosphorylated to non-phosphorylated forms of palmitoylated Fyn kinase compared to controls, and αvβ3 integrin inhibition further enhances this ratio. However, declining the activity of αvβ3 integrin without T3 did not alter this ratio compared to control cells (Figure 3).

Figure 3 TH supplementation of hypoxic cells increases the proportion of phosphorylated to non-phosphorylated forms of palmitoylated Fyn kinase in differentiated PC-12 cells exposed to 10 nM T3 and αvβ3-Ab (µg/ml) integrin during 1 h hypoxia. Results represent the mean ± SEM of duplicate samples from two independent experiments. A significant level was defined as *p < 0.05. vs control and #p < 0.05. to T3.
Figure 3

TH supplementation of hypoxic cells increases the proportion of phosphorylated to non-phosphorylated forms of palmitoylated Fyn kinase in differentiated PC-12 cells exposed to 10 nM T3 and αvβ3-Ab (µg/ml) integrin during 1 h hypoxia. Results represent the mean ± SEM of duplicate samples from two independent experiments. A significant level was defined as *p < 0.05. vs control and #p < 0.05. to T3.

Based on these results, it can be inferred that in hypoxic PC-12 cells, crosstalk exists between the T3-mediated αvβ3 integrin-dependent Fak/STAT3 pathway and other nRTK-dependent pathways. This interplay contributes to complex cellular processes that mutually modulate each other [35].

Palmitoyltransferases are typically located within intracellular structures. The levels of these enzymes in the cells depend on the activity of the genes encoding these enzymes [36]. Thus, next, we determine the expression of genes involved in palmitoylation through quantitative analysis of mRNA. Specifically, we analyzed the expression of palmitoyltransferase genes 2, 3, 8, 9, and 16 owing to their critical roles in the nervous system [21,22]. The expression levels of ZDHHC2, 3, 8, 9, and 16 genes during 1-h hypoxia are shown in Table 2.

We found that T3 does not alter the expression of ZDHHC3 and ZDHHC8 in hypoxia. However, when αvβ3 integrin was blocked, a significant increase in the expression of these genes was observed. Subsequently, we examined the expression of ZDHHC2 because there is some evidence that the activity of ZDHHC2 is associated with the palmitoylation of cytoskeleton-associated protein-4 (CKAP4), thereby suppressing cell proliferative activity in tumorigenesis [37]. T3 significantly reduces the expression of ZDHHC2, which is explicitly mediated by αvβ3 integrins (Figure 4a). Based on our results, we can assume that T3 does not affect the expression of ZDHHC3 and ZDHHC8 under hypoxic conditions. Still, it significantly reduces the expression of the ZDHHC2 gene, and this effect is partially resolved by blocking αvβ3 integrin. These data suggest that T3, in hypoxia, does not affect the expression of ZDHHC3 and ZDHHC8; however, it significantly reduces the expression of the ZDHHC2 gene.

Figure 4 The palmitoyltransferase gene expression levels of (a) ZDHHC2 and (b) ZDHHC9It were determined using the RT-PCR method in differentiated PC-12 cells exposed to 10 nM T3 and αvβ3-Ab integrin (µg/ml) during 1 h hypoxia. Results represent the mean ± SEM of duplicate samples from three independent experiments. A significant level was defined as *p < 0.05 vs control and #p < 0.05 to T3.
Figure 4

The palmitoyltransferase gene expression levels of (a) ZDHHC2 and (b) ZDHHC9It were determined using the RT-PCR method in differentiated PC-12 cells exposed to 10 nM T3 and αvβ3-Ab integrin (µg/ml) during 1 h hypoxia. Results represent the mean ± SEM of duplicate samples from three independent experiments. A significant level was defined as *p < 0.05 vs control and #p < 0.05 to T3.

Because mutation of ZDHHC9 palmitoyltransferase leads to the impairment of various cognitive functions and the development of epilepsy [38], and ZDHHC16 palmitoyltransferase plays an essential role in activating the early response to DNA damage [39], next, we analyzed the expression of these two genes. We found that T3 significantly reduces ZDHHC9 expression in hypoxic cells, and this effect was reversed in the presence of αvβ3 integrin-blocking antibody (Figure 4b).

Next, the expression of ZDHHC16 was determined. There is some evidence that this isozyme plays a significant role in the embryogenesis of the nervous system [40]. Besides, the importance of ZDHHC16 in early response to DNA damage has been suggested [39]. We found that T3 non-specifically increases the expression of ZDHHC16, but this effect is enhanced in combination with αvβ3 integrin blocking antibody. Based on the obtained data, it can be suggested that in contrast to the ZDHHC16 gene, T3 regulates the expression of ZDHHC9 through αvβ3 integrin activation. ZDHHC16 gene expression is also altered, although, unlike ZDHHC9, its expression is not αvβ3 integrin-specific and other T3-dependent mechanisms are involved in the expression of this gene.

4 Discussion

Accumulating evidence suggests that TH plays a critical role in the response of various tissues to ischemic/hypoxic insults. TH signaling has been implicated in ROS-dependent damage after infarction in hypoxic tissue, preventing post-infarcted remodeling [28,41]. These effects of THs may be due to genomic and non-genomic actions. The classical genomic action of T3 is mediated by high-affinity nuclear receptors that directly regulate gene expression. In contrast, the non-genomic effects of THs occur rapidly and are unaffected by transcription and protein synthesis inhibitors [3]. The non-nuclear actions of THs involve multiple physiological processes in many different cell types and are thought to be mediated by various intracellular regulatory systems. Sites of non-genomic action are localized to the plasma membrane, cytoplasm, cytoskeleton, and sub-cellular organelles. Recent advances have identified the plasma membrane integrin αvβ3 as a high-affinity receptor for T3 [42]. This research adds a new direction to THs’ actions because they promote the discovery of new mechanisms in cell growth and proliferation.

Integrin αvβ3 is a heterodimer found on the surfaces of cells that has an essential role in maintaining cell structure and signal transduction. Several small molecules, like resveratrol, non-peptide hormones like steroid hormones [43], and THs [44] have specific binding sites on integrin αvβ3 [35]. These ligands induce signal transduction and sequentially stimulate the biological activities of cells [42,44]. Focal adhesion kinase (Fak), a non-receptor tyrosine kinase, controls the activity of integrin αvβ3 and promotes cell migration and invasion [45].

Activation of proliferative genes via the integrin αvβ3/Fak pathway is one of the signaling actions of THs [46]. Several studies suggested that various non-receptor tyrosine kinases, including the Fak, can induce JAK/STAT cascade activation; however, the precise mechanisms involved in the phosphorylation and activation of JAK are unknown [47,48]. Our analysis of different non-receptor tyrosine kinases has shown T3-dependent phosphorylation of the JAK2/STAT5, suggesting an activation of this cascade system. Proper functioning of the JAK2/STAT5 signaling pathway relies on crosstalk with other signaling pathways, which leads to normal biological performance [49]. Considering that hypoxia itself may compensatory activate this signaling cascade [50,51], it may be concluded that the additional action of T3 can significantly increase the oxidative stress-induced responses. Simultaneously, T3 decreases SHP-2 protein phosphorylation during hypoxia, which affects the Fak kinase activation [52]. T3-induced effect is abolished under the action of integrin αvβ3 inhibitory antibody. Recent studies indicate that SHP2 has a crucial role in neurodegenerative brain diseases, and its suppression may be neuroprotective [53].

The JAK2-STAT5 pathway is essential for cellular development and survival [54]. Increased JAK2 activity increases BDNF expression and inhibits the apoptosis of neurons in chronic mild stress [55,56]. Moreover, hypoxia-induced JAK2/STAT5 activation could prevent neuronal apoptosis after ischemic injury [57]. Numerous studies have shown that STAT5 can also function as a transcriptional repressor by recruiting demethylating or deacetylating epigenetic modifiers in specific gene loci [58,59]. Lysine-specific histone demethylase 1A (LSD1) and HDAC3 also exert transcriptional regulation of STAT5 targets and facilitate specific gene repression by either deacetylation or histone demethylation [60]. These findings indicate that STAT5 may be involved in the epigenetic regulation of gene expression in physiological and pathological brain processes [61].

We found that Fyn kinase, a Src family member of tyrosine kinase, can also participate in the T3-dependent action in hypoxic cells. Fyn palmitoylation is essential for its localization to the membrane, and aberrant modification of this enzyme contributes to the pathophysiology of neurodegenerative diseases [62]. Our experiments have shown that T3 reduces Fyn palmitoylation and decreases its subsequent protein phosphorylation (at Thr12). Our recent studies indicate that a decline in the p-Fyn/Fyn ratio regulates actin cytoskeleton dynamics through αvβ3-integrin-mediated Fyn dephosphorylation [8]. These findings align with the observations that phosphorylation at the 12th threonine residue modulates Fyn kinase activity [63,64], and by reducing Fyn kinase, phosphorylation switches on anti-apoptotic machinery in neurons [33].

Elevated expression of palmitoylating enzymes [65] and integrins [66] was found in neurons. In this light, we analyzed the expression of five genes, which are highly distributed in nervous tissue. Our results show that T3 downregulates ZDHHC2 and ZDHHC9 gene expression in an integrin-specific manner. In contrast, the expression of other palmitoyltransferase genes, such as ZDHHC3, ZDHHC8, and ZDHHC16, changes slightly, or their differences are not integrin-specific. Thus, we can conclude that the TH T3, through the integrin αvβ3/JAK2/STAT5 pathway, suppresses the expression of the palmitoyltransferase genes ZDHHC2 and ZDHHC9, which is likely due to the inclusion of epigenetic silencing [64]. Notably, the DHHC family of protein palmitoyltransferases is epigenetically regulated through DNA methylation [67], which can be modulated by STAT5. It seems that these changes are a preventive effect protecting the brain from high-frequency stimulation and fear reactions [51].

In conclusion, our observations are the first to demonstrate the involvement of the integrin-dependent JAK2/STAT5 cascade and possible modulation of Fyn palmitoylation in the T3-mediated effects during 1-h hypoxia. This pathway and nRTKs are activated through integrin-αvβ3 and likely compensate for ROS-induced damage. In this case, a decrease in the expression of the ZDHHC2 and ZDHHC9 genes is observed, associated with changes in palmitoylation and redistribution of several proteins, including the protein kinase Fyn, that are beneficial for maintaining cell viability during hypoxia. These changes may occur due to the STAT5-dependent possible induction epigenetic silencing of the palmitoyltransferase gene, which in turn reduces palmitoylation/phosphorylation of Fyn with a subsequent increase in the survival of neurons [8] (Figure 5). These findings highlight the importance of further research using different research models to explore potential therapeutic interventions and their consequences.

Figure 5 Hypothetical scheme of the beneficial effect of T3 on differentiated PC-12 cells during hypoxia.
Figure 5

Hypothetical scheme of the beneficial effect of T3 on differentiated PC-12 cells during hypoxia.

Acknowledgements

The authors appreciate all the participants who supported this study.

  1. Funding information: This research was supported by the Shota Rustaveli National Science Foundation of Georgia (SRNSF), Tbilisi, Georgia (Grant No. PHDF-19-751).

  2. Author contributions: E.K., J.B., and T.B. contributed to all experimental work and reviewed the literature for the manuscript. I.K. contributed to cell cultivation and sample preparation. T.B. and D.M. participated in study design, data collection and evaluation, drafting, and statistical analysis. D.M. performed editing and approved the final version of this manuscript for submission. All authors approved the manuscript for submission.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Uchida K, Suzuki M. Congenital hypothyroidism and brain development: Association with other psychiatric disorders. Front Neurosci. 2021;15:772382. 10.3389/fnins.2021.772382.Search in Google Scholar PubMed PubMed Central

[2] Das B, Matsuda H, Fujimoto K, Sun G, Matsuura K, Shi YB. Molecular and genetic studies suggest that thyroid hormone receptor is both necessary and sufficient to mediate the developmental effects of thyroid hormone. Gen Comp Endocrinol. 2010 Sep;168(2):174–80. 10.1016/j.ygcen.2010.01.019.Search in Google Scholar PubMed PubMed Central

[3] Giammanco M, Di Liegro CM, Schiera G, Di Liegro I. Genomic and non-genomic mechanisms of action of thyroid hormones and their catabolite 3,5-diiodo-L-thyronine in mammals. Int J Mol Sci. 2020 Jun;21(11):4140. 10.3390/ijms21114140. PMID: 32532017; PMCID: PMC7312989.Search in Google Scholar PubMed PubMed Central

[4] Bergh JJ, Lin HY, Lansing L, Mohamed SN, Davis FB, Mousa S, et al. Integrin alphaVbeta3 contains a cell surface receptor site for thyroid hormone that is linked to activation of mitogen-activated protein kinase and induction of angiogenesis. Endocrinology. 2005 Jul;146(7):2864–71. 10.1210/en.2005-0102.Search in Google Scholar PubMed

[5] Barbakadze T, Natsvlishvili N, Mikeladze D. Thyroid hormones differentially regulate phosphorylation of ERK and Akt via integrin αvβ3 receptor in undifferentiated and differentiated PC‐12 cells. Cell Biochem Funct. 2014 Apr;32(3):282–6.10.1002/cbf.3013Search in Google Scholar PubMed

[6] Hynes RO. Integrins: bidirectional, allosteric signaling machines. Cell. 2002;110(6):673–87.10.1016/S0092-8674(02)00971-6Search in Google Scholar

[7] Yan L, Cui Z. Integrin β1 and the repair after nervous system injury. Eur Neurol. 2023;86(1):2–12.10.1159/000526690Search in Google Scholar PubMed

[8] Barbakadze T, Kvergelidze E, Bátor J, Szeberényi J, Mikeladze D. 3,5,3’-Triiodo-L-thyronine regulates actin cytoskeleton dynamic in the differentiated PC-12 cells during hypoxia through An αvβ3 Integrin. Cell J. 2023;25(4):247–54. 10.22074/cellj.2022.557501.1059.Search in Google Scholar PubMed PubMed Central

[9] Mao L, Wang JQ. Tyrosine phosphorylation of glutamate receptors by non-receptor tyrosine kinases: roles in depression-like behavior. Neurotransmitter. 2016;3:e1118.Search in Google Scholar

[10] Kalia LV, Gingrich JR, Salter MW. Src in synaptic transmission and plasticity. Oncogene. 2004;23(48):8007–16.10.1038/sj.onc.1208158Search in Google Scholar PubMed

[11] Wang JQ, Derges JD, Bodepudi A, Pokala N, Mao LM. Roles of non-receptor tyrosine kinases in pathogenesis and treatment of depression. J Integr Neurosci. 2022;21(1):25. 10.31083/j.jin2101025.Search in Google Scholar PubMed PubMed Central

[12] Grant SG, O’Dell TJ, Karl KA, Stein PL, Soriano P, Kandel ER. Impaired long-term potentiation, spatial learning, and hippocampal development in fyn mutant mice. Science. 1992;258(5090):1903–10. 10.1126/science.1361685.Search in Google Scholar PubMed

[13] Matrone C, Petrillo F, Nasso R, Ferretti G. Fyn tyrosine kinase as harmonizing factor in neuronal functions and dysfunctions. Int J Mol Sci. 2020;21(12):4444.10.3390/ijms21124444Search in Google Scholar PubMed PubMed Central

[14] Du F, Tang T, Li Q, Liu J. Fyn signaling in ischemia-reperfusion injury: Potential and therapeutic implications. Mediators Inflamm. 2022 Sep;2022:9112127. 10.1155/2022/9112127.Search in Google Scholar PubMed PubMed Central

[15] Jain M, Singh MK, Shyam H, Mishra A, Kumar S, Kumar A, et al. Role of JAK/STAT in the neuroinflammation and its association with neurological disorders. Ann Neurosci. 2021;28(3-4):191–200. 10.1177/09727531211070532.Search in Google Scholar PubMed PubMed Central

[16] Guan X, Fierke CA. Understanding protein palmitoylation: Biological significance and enzymology. Sci China Chem. 2011;54(12):1888–97. 10.1007/s11426-011-4428-2.Search in Google Scholar PubMed PubMed Central

[17] Goloshvili G, Barbakadze T, Mikeladze D. Sodium nitroprusside induces H-Ras depalmitoylation and alters the cellular response to hypoxia in differentiated and undifferentiated PC12 cells. Cell Biochem Funct. 2019;37:545–52. 10.1002/cbf.3431.Search in Google Scholar PubMed

[18] Tabaczar S, Czogalla A, Podkalicka J, Biernatowska A, Sikorski AF. Protein palmitoylation: Palmitoyltransferases and their specificity. Exp Biol Med. 2017;242:1150–7.10.1177/1535370217707732Search in Google Scholar PubMed PubMed Central

[19] Zingler P, Sarchen V, Glatter T, Caning L, Saggau C, Kathayat RS, et al. Palmitoylation is required for TNF-R1 signaling. Cell Commun Signal. 2019;17:90.10.1186/s12964-019-0405-8Search in Google Scholar PubMed PubMed Central

[20] Linder ME, Deschenes RJ. Palmitoylation: Policing protein stability and traffic. Nat Rev Mol Cell Biol. 2007;8:74–84.10.1038/nrm2084Search in Google Scholar PubMed

[21] Fukata M, Fukata Y, Adesnik H, Nicoll RA, Bredt DS. Identification of PSD-95 palmitoylating enzymes. Neuron. 2004;44:987–96.10.1016/j.neuron.2004.12.005Search in Google Scholar PubMed

[22] Cho E, Park M. Palmitoylation in Alzheimer’s disease and other neurodegenerative diseases. Pharmacol Res. 2016;111:133–51. 10.1016/j.phrs.2016.06.008.Search in Google Scholar PubMed

[23] Dzhalilova D, Makarova O. Differences in tolerance to hypoxia: Physiological, biochemical, and molecular-biological characteristics. Biomedicines. 2020;8(10):428. 10.3390/biomedicines8100428.Search in Google Scholar PubMed PubMed Central

[24] Hou Y, Dan X, Babbar M, Wei Y, Hasselbalch SG, Croteau DL, et al. Ageing as a risk factor for neurodegenerative disease. Nat Rev Neurol. 2019 Oct;15(10):565–81. 10.1038/s41582-019-0244-7.Search in Google Scholar PubMed

[25] Burtscher J, Mallet RT, Burtscher M, Millet GP. Hypoxia and brain aging: neurodegeneration or neuroprotection? Ageing Res Rev. 2021;68:101343.10.1016/j.arr.2021.101343Search in Google Scholar PubMed

[26] Ju JA, Godet I, Ye IC, Byun J, Jayatilaka H, Lee SJ, et al. Hypoxia selectively enhances integrin α5β1 receptor expression in breast cancer to promote metastasis. Mol Cancer Res. 2017;15(6):723–34.10.1158/1541-7786.MCR-16-0338Search in Google Scholar PubMed PubMed Central

[27] Ikeshima-Kataoka H, Sugimoto C, Tsubokawa T. Integrin signaling in the central nervous system in animals and human brain diseases. Int J Mol Sci. 2022;23(3):1435.10.3390/ijms23031435Search in Google Scholar PubMed PubMed Central

[28] Lourbopoulos AI, Mourouzis IS, Trikas AG, Tseti IK, Pantos CI. Effects of thyroid hormone on tissue hypoxia: Relevance to sepsis therapy. J Clin Med. 2021;10(24):5855. 10.3390/jcm10245855. PMID: 34945151; PMCID: PMC8703810.Search in Google Scholar PubMed PubMed Central

[29] Brigidi GS, Bamji SX. Detection of protein palmitoylation in cultured hippocampal neurons by immunoprecipitation and acyl-biotin exchange (ABE). J Vis Exp. 2013;72:50031. 10.3791/50031.Search in Google Scholar PubMed PubMed Central

[30] Knox R, Jiang X. Fyn in neurodevelopment and ischemic brain injury. Dev Neurosci. 2015;37(4–5):311–20. 10.1159/000369995.Search in Google Scholar PubMed PubMed Central

[31] Tse MC, Liu X, Yang S, Ye K, Chan CB. Fyn regulates adipogenesis by promoting PIKE-A/STAT5a interaction. Mol Cell Biol. 2013;33(9):1797–808.10.1128/MCB.01410-12Search in Google Scholar PubMed PubMed Central

[32] Abe J, Berk BC. Fyn and JAK2 mediate Ras activation by reactive oxygen species. J Biol Chem. 1999;274(30):21003–10. 10.1074/jbc.274.30.21003. PMID: 10409649.Search in Google Scholar PubMed

[33] Saminathan H, Ghosh A, Zhang D, Song C, Jin H, Anantharam V, et al. Fyn kinase-mediated PKCδ Y311 phosphorylation induces dopaminergic degeneration in cell culture and animal models: implications for the identification of a new pharmacological target for Parkinson’s disease. Front Pharmacol. 2021;12:631375.10.3389/fphar.2021.631375Search in Google Scholar PubMed PubMed Central

[34] Resh MD. Fyn, a Src family tyrosine kinase. Int J Biochem Cell Biol. 1998;30(11):1159–62.10.1016/S1357-2725(98)00089-2Search in Google Scholar

[35] Yang YSH, Ko PJ, Pan YS, Lin HY, Whang-Peng J, Davis PJ, et al. Role of thyroid hormone-integrin αvβ3-signal and therapeutic strategies in colorectal cancers. J Biomed Sci. 2021;28(1):24. 10.1186/s12929-021-00719-5.Search in Google Scholar PubMed PubMed Central

[36] Wirth A, Labus J, Galil DA, Schill Y, Schmidt S, Bunke T, et al. Palmitoylation of the small GTPase Cdc42 by DHHC5 modulates spine formation and gene transcription. J Biol Chem. 2022;298(6):102048. 10.1016/j.jbc.2022.102048.Search in Google Scholar PubMed PubMed Central

[37] Planey SL, Keay SK, Zhang CO, Zacharias DA. Palmitoylation of cytoskeleton associated protein 4 by DHHC2 regulates antiproliferative factor-mediated signaling. Mol Biol Cell. 2009;20(5):1454–63. 10.1091/mbc.e08-08-0849.Search in Google Scholar PubMed PubMed Central

[38] Baker K, Astle DE, Scerif G, Barnes J, Smith J, Moffat G, et al. Epilepsy, cognitive deficits and neuroanatomy in males with ZDHHC9 mutations. Ann Clin Transl Neurol. 2015;2(5):559–69. 10.1002/acn3.196.Search in Google Scholar PubMed PubMed Central

[39] Cao N, Li JK, Rao YQ, Liu H, Wu J, Li B, et al. A potential role for protein palmitoylation and zDHHC16 in DNA damage response. BMC Mol Biol. 2016;17(1):12. 10.1186/s12867-016-0065-9.Search in Google Scholar PubMed PubMed Central

[40] Shi W, Chen X, Wang F, Gao M, Yang Y, Du Z, et al. ZDHHC16 modulates FGF/ERK dependent proliferation of neural stem/progenitor cells in the zebrafish telencephalon. Dev Neurobiol. 2016 Sep;76(9):1014–28. 10.1002/dneu.22372.Search in Google Scholar PubMed

[41] Forini F, Kusmic C, Nicolini G, Mariani L, Zucchi R, Matteucci M, et al. Triiodothyronine prevents cardiac ischemia/reperfusion mitochondrial impairment and cell loss by regulating miR30a/p53 axis. Endocrinology. 2014;155:4581–90. 10.1210/en.2014-1106.Search in Google Scholar PubMed

[42] Davis PJ, Mousa SA, Lin HY. Nongenomic actions of thyroid hormone: The integrin component. Physiol Rev. 2021;101(1):319–52.10.1152/physrev.00038.2019Search in Google Scholar PubMed

[43] Chin YT, Wei PL, Ho Y, Nana AW, Changou CA, Chen YR, et al. Thyroxine inhibits resveratrol-caused apoptosis by PD-L1 in ovarian cancer cells. Endocrine-Related Cancer. 2018;25(5):533–45.10.1530/ERC-17-0376Search in Google Scholar PubMed

[44] Lin HY, Cody V, Davis FB, Hercbergs AA, Luidens MK, Mousa SA, et al. Identification and functions of the plasma membrane receptor for thyroid hormone analogues. Discovery Med. 2011;11(59):337–47.Search in Google Scholar

[45] Sulzmaier FJ, Jean C, Schlaepfer DD. FAK in cancer: Mechanistic findings and clinical applications. Nat Rev Cancer 14(9):598–610.10.1038/nrc3792Search in Google Scholar PubMed PubMed Central

[46] Cheng TM, Chang WJ, Chu HY, De Luca R, Pedersen JZ, Incerpi S, et al. Nano-strategies targeting the integrin αvβ3 network for cancer therapy. Cells. 2021;10(7):1684.10.3390/cells10071684Search in Google Scholar PubMed PubMed Central

[47] Behera R, Kumar V, Lohite K, Karnik S, Kundu GC. Activation of JAK2/STAT3 signaling by osteopontin promotes tumor growth in human breast cancer cells. Carcinogenesis. 2010;31(2):192–200. 10.1093/carcin/bgp289.Search in Google Scholar PubMed

[48] Gao J, Zhao BR, Zhang H, You YL, Li F, Wang XW. Interferon functional analog activates antiviral Jak/Stat signaling through integrin in an arthropod. Cell Rep. 2021;36(13):109761. 10.1016/j.celrep.2021.109761.Search in Google Scholar PubMed

[49] Tian M, Qi Y, Zhang X, Wu Z, Chen J, Chen F, et al. Regulation of the JAK2-STAT5 pathway by signaling molecules in the mammary gland. Front Cell Dev Biol. 2020;8:604896.10.3389/fcell.2020.604896Search in Google Scholar PubMed PubMed Central

[50] Joung YH, Lim EJ, Lee MY, Park JH, Ye SK, Park EU, et al. Hypoxia activates the cyclin D1 promoter via the Jak2/STAT5b pathway in breast cancer cells. Exp & Mol Med. 2005;37(4):353–64.10.1038/emm.2005.45Search in Google Scholar PubMed

[51] Wang Y, Wang D, Zhang L, Ye F, Li M, Wen K. Role of JAK-STAT pathway in reducing cardiomyocytes hypoxia/reoxygenation injury induced by S1P postconditioning. Eur J Pharmacol. 2016;784:129–36.10.1016/j.ejphar.2016.05.024Search in Google Scholar PubMed

[52] Choi I, Byun J, Park SM, Jou I, Joe E. LRRK2 inhibits FAK activity by promoting FERM-mediated Autoinhibition of FAK and recruiting the tyrosine phosphatase, SHP-2. Exp Neurobiol. 2016;25:269–76. 10.5607/en.2016.25.5.269.Search in Google Scholar PubMed PubMed Central

[53] Pan J, Zhou L, Zhang C, Xu Q, Sun Y. Targeting protein phosphatases for the treatment of inflammation-related diseases: From signaling to therapy. Sig Transduct Target Ther. 2022;7:177. 10.1038/s41392-022-01038-3.Search in Google Scholar PubMed PubMed Central

[54] O’Shea JJ, Gadina M, Schreiber RD. Cytokine signaling in 2002: New surprises in the Jak/Stat pathway. Cell. 2002;109(Suppl):S121–31. 10.1016/s0092-8674(02)00701-8. PMID: 11983158.Search in Google Scholar PubMed

[55] Kvergelidze E, Barbakadze T, Mikeladze D. Thyroid hormone T3 regulates NOX2 activity and BDNF secretion in differentiated PC-12 cells during hypoxia via αvβ3 integrin. Bull Georgian Natl Acad Sci. 2022;16(2):115–21.Search in Google Scholar

[56] Tian RH, Bai Y, Li JY, Guo KM. Reducing PRLR expression and JAK2 activity results in an increase in BDNF expression and inhibits the apoptosis of CA3 hippocampal neurons in a chronic mild stress model of depression. Brain Res. 2019;1725:146472.10.1016/j.brainres.2019.146472Search in Google Scholar PubMed

[57] Liu F, Lu Z, Li Z, Wang S, Zhuang L, Hong M, et al. Electroacupuncture improves cerebral ischemic injury by enhancing the EPO-JAK2-STAT5 pathway in rats. Neuropsychiatr Dis Treat. 2021;17:2489–98. 10.2147/NDT.S316136.Search in Google Scholar PubMed PubMed Central

[58] Yang XP, Ghoreschi K, Steward-Tharp SM, Rodriguez-Canales J, Zhu J, Grainger JR, et al. Opposing regulation of the locus encoding IL-17 through direct, reciprocal actions of STAT3 and STAT5. Nat immunology. 2011;12(3):247–54.10.1038/ni.1995Search in Google Scholar PubMed PubMed Central

[59] Mandal M, Powers SE, Maienschein-Cline M, Bartom ET, Hamel KM, Kee BL, et al. Epigenetic repression of the Igk locus by STAT5-mediated recruitment of the histone methyltransferase Ezh2. Nat Immunol. 2011;12(12):1212–20.10.1038/ni.2136Search in Google Scholar PubMed PubMed Central

[60] Wingelhofer B, Neubauer HA, Valent P, Han X, Constantinescu SN, Gunning PT, et al. Implications of STAT3 and STAT5 signaling on gene regulation and chromatin remodeling in hematopoietic cancer. Leukemia. 2018;32(8):1713–26.10.1038/s41375-018-0117-xSearch in Google Scholar PubMed PubMed Central

[61] Kagohara LT, Stein-O’Brien GL, Kelley D, Flam E, Wick HC, Danilova LV, et al. Epigenetic regulation of gene expression in cancer: techniques, resources and analysis. Brief Funct Genomics. 2018;17(1):49–63.10.1093/bfgp/elx018Search in Google Scholar PubMed PubMed Central

[62] Li W, Pang Y, Wang Y, Mei F, Guo M, Wei Y, et al. Aberrant palmitoylation caused by a ZDHHC21 mutation contributes to pathophysiology of Alzheimer’s disease. BMC Med. 2023 Jun;21(1):223. 10.1186/s12916-023-02930-7.Search in Google Scholar PubMed PubMed Central

[63] Anzovino A, Chiang S, Brown BE, Hawkins CL, Richardson DR, Huang MLH. Molecular alterations in a mouse cardiac model of Friedreich ataxia: An Impaired Nrf2 response mediated via upregulation of Keap1 and activation of the Gsk3β Axis. Am J Pathol. 2017;187:2858–75.10.1016/j.ajpath.2017.08.021Search in Google Scholar PubMed

[64] Tang X, Feng Y, Ye K. Src-family tyrosine kinase fyn phosphorylates phosphatidylinositol 3-kinase enhancer-activating Akt, preventing its apoptotic cleavage and promoting cell survival. Cell Death Differ. 2007;14:368–77. 10.1038/sj.cdd.4402011.Search in Google Scholar PubMed

[65] Wild AR, Hogg PW, Flibotte S, Nasseri GG, Hollman RB, Abazari D, et al. Exploring the expression patterns of palmitoylating and de-palmitoylating enzymes in the mouse brain using the curated RNA-seq database BrainPalmSeq. Elife. 2022;11:e75804.10.7554/eLife.75804Search in Google Scholar PubMed PubMed Central

[66] Izumi Y, Wakita S, Kanbara C, Nakai T, Akaike A, Kume T. Integrin α5β1 expression on dopaminergic neurons is involved in dopaminergic neurite outgrowth on striatal neurons. Sci Rep. 2017;7:42111. 10.1038/srep42111.Search in Google Scholar PubMed PubMed Central

[67] Sharma ND, Nickl CK, Kang H, Ornatowski W, Brown R, Ness SA, et al. Epigenetic silencing of SOCS5 potentiates JAK-STAT signaling and progression of T-cell acute lymphoblastic leukemia. Cancer Sci. 2019;110(6):1931–46. 10.1111/cas.14021.Search in Google Scholar PubMed PubMed Central

Received: 2024-03-08
Revised: 2024-06-23
Accepted: 2024-07-08
Published Online: 2024-08-07

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Brain expression profiles of two SCN1A antisense RNAs in children and adolescents with epilepsy
  3. Silibinin suppresses glioblastoma cell growth, invasion, stemness, and glutamine metabolism by YY1/SLC1A5 pathway
  4. Early exercise intervention promotes myelin repair in the brains of ischemic rats by inhibiting the MEK/ERK pathway
  5. Comparative analysis of CRASH and IMPACT in predicting the outcome of 340 patients with traumatic brain injury
  6. Association between FOXP3 polymorphisms and expression and neuromyelitis optica spectrum disorder risk in the Northern Chinese Han population
  7. Trehalose improves the movement ability of Aβarc Drosophila by restoring the damaged mitochondria
  8. The ACE2/Ang-(1-7)/MasR axis alleviates brain injury after cardiopulmonary resuscitation in rabbits by activating PI3K/Akt signaling
  9. Single cocaine exposure attenuates the intrinsic excitability of CRH neurons in the ventral BNST via Sigma-1 receptors
  10. Effect of dopamine on limbic network connectivity at rest in Parkinson’s disease patients with freezing of gait
  11. FT4-to-FT3 ratio is a novel prognostic marker in subacute combined spinal cord degeneration patients
  12. Suanzaoren decoction exerts its antidepressant effect via the CaMK signaling pathway
  13. Acute ischemic STROKE – from laboratory to the Patient’s BED (STROKELABED): A translational approach to reperfusion injury. Study Protocol
  14. Thyroid hormone T3 induces Fyn modification and modulates palmitoyltransferase gene expression through αvβ3 integrin receptor in PC12 cells during hypoxia
  15. Activating α7nAChR suppresses systemic inflammation by mitigating neuroinflammation of the medullary visceral zone in sepsis in a rat model
  16. Amelioration of behavioral and histological impairments in somatosensory cortex injury rats by limbal mesenchymal stem cell transplantation
  17. TTBK2 T3290C mutation in spinocerebellar ataxia 11 interferes with ciliogenesis
  18. In a rodent model of autism, probiotics decrease gut leakiness in relation to gene expression of GABA receptors: Emphasize how crucial the gut–brain axis
  19. A data science approach to optimize ADHD assessment with the BRIEF-2 questionnaire
  20. Cystatin C alleviates unconjugated bilirubin-induced neurotoxicity by promoting bilirubin clearance from neurocytes via exosomes, dependent on hepatocyte UGT1A1 activity
  21. Macrophage accumulation in dorsal root ganglion is associated with neuropathic pain in experimental autoimmune neuritis
  22. Identifying key biomarkers and therapeutic candidates for post-COVID-19 depression through integrated omics and bioinformatics approaches
  23. The hidden link: Investigating functional connectivity of rarely explored sub-regions of thalamus and superior temporal gyrus in Schizophrenia
  24. A pilot evaluation of the diagnostic accuracy of ChatGPT-3.5 for multiple sclerosis from case reports
  25. Review Articles
  26. Adaptation of the layer V supraspinal motor corticofugal projections from the primary (M1) and premotor (PM) cortices after CNS motor disorders in non-human primates: A survey
  27. Comorbidity in spinal cord injury in Iran: A narrative review
  28. Lipid-based nanoparticles for drug delivery in Parkinson’s disease
  29. Disgust sensitivity and psychopathic behavior: A narrative review
  30. Rapid Communications
  31. Long COVID elevated MMP-9 and release from microglia by SARS-CoV-2 Spike protein
  32. Internal consistency of the Mental Health Professional Culture Inventory: A pilot study in Romanian population
  33. Retraction
  34. Retraction of “Effect of C-phycocyanin on HDAC3 and miRNA-335 in Alzheimer’s disease”
  35. Corrigendum
  36. Corrigendum to “The ACE2/Ang-(1-7)/MasR axis alleviates brain injury after cardiopulmonary resuscitation in rabbits by activating PI3K/Akt signaling”
  37. Corrigendum to “Tongxinluo promotes axonal plasticity and functional recovery after stroke”
https://doi.org/10.1515/tnsci-2022-0347
Keywords for this article
T3; hypoxia; Fyn; palmitoyltransferase; palmitoylation; JAK/STAT; SHP2; PC-12
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Brain expression profiles of two SCN1A antisense RNAs in children and adolescents with epilepsy
  3. Silibinin suppresses glioblastoma cell growth, invasion, stemness, and glutamine metabolism by YY1/SLC1A5 pathway
  4. Early exercise intervention promotes myelin repair in the brains of ischemic rats by inhibiting the MEK/ERK pathway
  5. Comparative analysis of CRASH and IMPACT in predicting the outcome of 340 patients with traumatic brain injury
  6. Association between FOXP3 polymorphisms and expression and neuromyelitis optica spectrum disorder risk in the Northern Chinese Han population
  7. Trehalose improves the movement ability of Aβarc Drosophila by restoring the damaged mitochondria
  8. The ACE2/Ang-(1-7)/MasR axis alleviates brain injury after cardiopulmonary resuscitation in rabbits by activating PI3K/Akt signaling
  9. Single cocaine exposure attenuates the intrinsic excitability of CRH neurons in the ventral BNST via Sigma-1 receptors
  10. Effect of dopamine on limbic network connectivity at rest in Parkinson’s disease patients with freezing of gait
  11. FT4-to-FT3 ratio is a novel prognostic marker in subacute combined spinal cord degeneration patients
  12. Suanzaoren decoction exerts its antidepressant effect via the CaMK signaling pathway
  13. Acute ischemic STROKE – from laboratory to the Patient’s BED (STROKELABED): A translational approach to reperfusion injury. Study Protocol
  14. Thyroid hormone T3 induces Fyn modification and modulates palmitoyltransferase gene expression through αvβ3 integrin receptor in PC12 cells during hypoxia
  15. Activating α7nAChR suppresses systemic inflammation by mitigating neuroinflammation of the medullary visceral zone in sepsis in a rat model
  16. Amelioration of behavioral and histological impairments in somatosensory cortex injury rats by limbal mesenchymal stem cell transplantation
  17. TTBK2 T3290C mutation in spinocerebellar ataxia 11 interferes with ciliogenesis
  18. In a rodent model of autism, probiotics decrease gut leakiness in relation to gene expression of GABA receptors: Emphasize how crucial the gut–brain axis
  19. A data science approach to optimize ADHD assessment with the BRIEF-2 questionnaire
  20. Cystatin C alleviates unconjugated bilirubin-induced neurotoxicity by promoting bilirubin clearance from neurocytes via exosomes, dependent on hepatocyte UGT1A1 activity
  21. Macrophage accumulation in dorsal root ganglion is associated with neuropathic pain in experimental autoimmune neuritis
  22. Identifying key biomarkers and therapeutic candidates for post-COVID-19 depression through integrated omics and bioinformatics approaches
  23. The hidden link: Investigating functional connectivity of rarely explored sub-regions of thalamus and superior temporal gyrus in Schizophrenia
  24. A pilot evaluation of the diagnostic accuracy of ChatGPT-3.5 for multiple sclerosis from case reports
  25. Review Articles
  26. Adaptation of the layer V supraspinal motor corticofugal projections from the primary (M1) and premotor (PM) cortices after CNS motor disorders in non-human primates: A survey
  27. Comorbidity in spinal cord injury in Iran: A narrative review
  28. Lipid-based nanoparticles for drug delivery in Parkinson’s disease
  29. Disgust sensitivity and psychopathic behavior: A narrative review
  30. Rapid Communications
  31. Long COVID elevated MMP-9 and release from microglia by SARS-CoV-2 Spike protein
  32. Internal consistency of the Mental Health Professional Culture Inventory: A pilot study in Romanian population
  33. Retraction
  34. Retraction of “Effect of C-phycocyanin on HDAC3 and miRNA-335 in Alzheimer’s disease”
  35. Corrigendum
  36. Corrigendum to “The ACE2/Ang-(1-7)/MasR axis alleviates brain injury after cardiopulmonary resuscitation in rabbits by activating PI3K/Akt signaling”
  37. Corrigendum to “Tongxinluo promotes axonal plasticity and functional recovery after stroke”
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 10.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/tnsci-2022-0347/html
Scroll to top button