TTBK2 ^T3290C mutation in spinocerebellar ataxia 11 interferes with ciliogenesis

2.1 Sample collection

All subjects originated from the same Chinese family afflicted with SCA11, as depicted in Figure S1. The family spanned three generations and comprised a total of 26 individuals, 10 of whom had manifested the disease across these generations. Clinical data were obtained from the 10 affected family members (I2, II2, II3, II5, II7, III3, III6, III8, III9, and III15). Following the acquisition of informed consent, 4 ml of venous blood was collected from the proband (III3) as well as from other affected family members (III6, III8, III9, and III15, carrying the pathogenic variant) and unaffected individuals (III4, III5, III7, III10, III12, and III16, wild type). The blood specimens were placed in ethylenediamine tetraacetic acid-containing anticoagulant tubes for lymphocyte isolation and subsequent lymphocyte separation for further analysis.

2.2 Reverse transcription-polymerase chain reaction (RT-PCR) analysis

Total RNA was extracted from isolated lymphocytes or transfected HEK-293/mouse embryonic fibroblast (MEF) cells using TRIzol reagent. Subsequently, cDNA synthesis was performed using the 5× Prime Script RT Master Mix, followed by real-time quantitative polymerase chain reaction with the SYBR Premix Ex Taq State II kit. The primer sequence is as follows: TTBK2(F): 5′CTCCTCACAATCCAAAAACACC3′, TTBK2(R): 5′CTAGATGGTGAGGAACTAGACG3′, GAPDH(F): 5′GAAGGTGAAGGTCGGAGTC3′, and GAPDH(R): 5′GAAGATGGTGATGGGATTTC3′.

2.3 Western blotting and immunoprecipitation

The cellular protein was extracted and resolved using sodium dodecyl sulfate polyacrylamide gel electrophoresis. Subsequently, the proteins were transferred onto a polyvinylidene fluoride membrane, blocked with milk, and incubated overnight at 4°C with either anti-TTBK2 or anti-Moesin. The protein bands were visualized using an enhanced chemiluminescence reagent, and band intensities were quantified using Image Pro Plus software.

For co-immunoprecipitation (Co-IP) experiments, transfected cells were lysed, and protein concentrations were determined. Immunoprecipitation was then carried out using anti-IgG and anti-Myc antibodies. Subsequently, western blotting analysis was performed using anti-Myc or anti-Flag antibodies.

2.4 Cell transfection

The full-length complementary (c) DNA of human TTBK2 was synthesized and cloned into the expression vector pEGFP-N1 (Beijing Olinger Biotechnology Co., Ltd). The TTBK2 ^T3290C mutant plasmid was obtained from the same company. Transfection of full-length cDNA or mutant TTBK2 plasmids into cells was performed using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA).

2.5 Isolation of MEF cells and induction of cilia formation

The MEFs were isolated from embryos of E10.5 or E12.5 and maintained them as previously described [16]. Subsequently, the isolated MEFs were transfected with wild-type and mutant (T3290C) TTBK2 plasmids using Lipofectamine 2000. Cilia formation was induced by shifting cells from 10 to 0.5% fetal bovine serum (FBS) and maintaining them under low serum conditions for 48 h.

2.6 TTBK2 enzyme activity

TTBK2 enzyme activity was assessed utilizing the Universal Kinase Assay Kit (Abcam, ab138879). Samples were prepared and processed following the manufacturer’s instructions. The procedure for conducting the ADP Assay is as follows: prepare a 50× ADP Sensor I stock solution by combining 50 µL of DMSO with the vial of ADP Sensor I. Subsequently, generate the ADP Sensor by mixing 50 µL of the 50× ADP Sensor I stock solution with the vial of ADP Sensor II. Then, add 20 µL of ADP Sensor Buffer and 10 µL of ADP Sensor to each well containing 20 µL of kinase reaction solution, resulting in a total ADP assay volume of 50 µL/well. Incubate the reaction mixture at room temperature for 30 min, and measure the fluorescence intensity using a fluorescence plate reader set at E _x/E _m = 540/590 nm (cutoff 570 nm).

2.7 Immunofluorescence

The transfected cells were cultured in a 24-well plate with low serum (0.5% FBS) for 48 h, followed by fixation in 4% paraformaldehyde for 30 min. Subsequently, the cells were permeabilized with 0.1% Triton X-100 for 15 min after washing with phosphate-buffered saline. After washing again, the cell was blocked by 5% bovine serum albumin for 2 h at 37°C. Next, the cells were then incubated overnight at 4°C with primary antibodies, ARL13b (66739-1-Ig; Proteintech, 1:200) and γ-tubulin (ab179503; Abcam, 1:500), followed by 1-h incubation at room temperature with secondary antibodies (CY3 R 1:50, FITC M 1:50). Finally, the cells were stained with DAPI in phosphate-buffered solution (PBS) for 10 min, washed with PBS, and fixed on a glass slide.

2.8 Statistical analysis

Data were analyzed using GraphPad Prism 7 software and presented as means ± standard deviation. Two groups of data were analyzed by Student’s t-test. For multiple comparisons, we used one-way analysis of variance and the Tukey honestly significant difference test. P  <  0.05 was considered significant.

1. Ethical approval: The research related to human use has been complied with all the relevant national regulations and institutional policies and in accordance with the tenets of the Helsinki Declaration and has been approved by the authors’ institutional review board or equivalent committee. This study was approved by the Second Affiliated Hospital of Nanchang University.

2. Informed consent: Informed consent has been obtained from all individuals included in this study.

3.1 TTBK2^T3290C MUT in SCA11 does not affect its mRNA and protein expression

To compare the expression levels of TTBK2 in individuals with pathogenic variants (mutant type, n = 5) and healthy controls (wild type, n = 6) within the SCA11 family, peripheral blood samples were collected for lymphocyte extraction. The mRNA and protein expression of TTBK2 were subsequently analyzed using RT-PCR and Western blot techniques. Statistical evaluation revealed no significant difference in TTBK2 mRNA expression between the patient group and healthy controls (Figure 1a, p = 0.8536). Similarly, protein expression analysis showed no significant difference between the two groups (Figure 1b, p = 0.8636). These findings suggested that the TTBK2 ^T3290C MUT in SCA11 does not impact its gene or protein expression.

Figure 1

TTBK2 expression in SCA11 patients. Peripheral blood and lymphocytes were extracted from patients (pathogenic variant individuals, mutant types) and healthy individuals (healthy individuals, wild-type) in the SCA11 family. (a) The TTBK2 mRNA level was detected by RT-PCR. (b) The TTBK2 protein level was detected by western blotting (membrane tissue extension spike protein, Moesin as the control). Results are pooled from three independent experiments. Statistical comparison was performed by Student’s t-test. ns indicates no significance.

3.2 The SCA11-associated TTBK2^T3290C MUT does not affect its protein expression and enzyme activity

To elucidate the impact of the SCA11-associated TTBK2 ^T3290C MUT on its expression and enzymatic function, we engineered wild-type and mutant (T3290C) TTBK2 plasmids and transfected them into HEK-293 cells. Non-transfected cells served as controls, while cells transfected with empty plasmids were treated as negative controls (NC). Subsequently, TTBK2 protein levels and kinase activity were assessed. Western blot analysis revealed that the SCA11-associated TTBK2 ^T3290C MUT did not alter its protein expression (Figure 2a, p = 0.6544). Data from the Universal Kinase Assay Kit indicated that the TTBK2 ^T3290C MUT did not influence TTBK2’s enzymatic activity (Figure 2b, p = 0.9194). These findings suggested that the SCA11-associated TTBK2 ^T3290C MUT does not affect its protein expression or functional activity.

Figure 2

TTBK2 ^T3290C mutation does not affect protein expression and enzyme activity. The empty, wild-type, and mutant (T3290C) TTBK2 plasmids were transfected into HEK-293 cells, and the untransfected cell as the control group. (a) The TTBK2 protein level was detected by western blotting. (b) The TTBK2 enzyme activity was measured by Universal Kinase Assay Kit. Results are pooled from three independent experiments. Statistical comparison was performed by Student’s t-test. ns indicates no significance.

3.3 TTBK2^T3290C MUT reduces cilia formation in embryonic cells

Next, to investigate the effect of SCA11-associated TTBK2 ^T3290C MUT on MEF cell cilia formation, we isolated mouse embryonic MEF cells and transfected them with empty (NC), wild-type, and mutant TTBK2 plasmids. Immunofluorescence staining for the primary cilia marker ARL13B was utilized to assess cilia formation, with γ-Tubulin serving as a centrosomal marker (Figure 3a and b). Our findings demonstrated that MEF cells transfected with the wild-type TTBK2 plasmid exhibited a significantly greater ciliary length compared to those transfected with the NC empty plasmid (p = 0.0104). Conversely, MEF cells transfected with the TTBK2 ^T3290C mutant plasmid displayed shorter cilia than those transfected with the wild-type TTBK2 plasmid (p = 0.0108) (Figure 3c). These results indicated that the TTBK2 ^T3290C MUT impairs cilia formation in MEF cells.

Figure 3

SCA11-associated TTBK2 ^T3290C mutation affects cilia formation in MEF cells. Mouse embryonic MEF cells were isolated and divided into three groups, transfected with empty (NC), wild-type, and mutant (T3290C) TTBK2 plasmid, respectively. Then, the cells were maintained under low serum conditions for 48 h to induce cilia formation. (a) and (b) Cilia were immunostained for ARL13b (green) to label cilia and γ-Tubulin (red) to label centrosomes, scar bar = 20 and 1 µm. (c) Quantification of the cilia length from MEFs. Results are pooled from three independent experiments. Statistical comparison was performed by Student’s t-test. *p < 0.05.

3.4 TTBK2^T3290C MUT reduces its binding to Cep164 protein

The aforementioned study demonstrated that the SCA11-associated TTBK2 ^T3290C MUT does not impact TTBK2 protein expression or enzymatic activity, but it significantly impedes ciliogenesis. To elucidate the mechanism by which the SCA11-associated TTBK2 ^T3290C MUT influences ciliogenesis, we assessed the impact of the TTBK2 ^T3290C MUT on its interaction with the Cep164 protein using Co-IP assays. HEK-293 cells were transfected with MYC-Cep164 plasmids alongside either wild-type (Flag-TTBK2) or mutant (Flag-TTBK2 ^T3290C) plasmids. The findings revealed that the TTBK2 ^T3290C MUT diminished its binding affinity to the Cep164 protein (Figure 4).

Figure 4

TTBK2 ^T3290C mutation reduces its binding to Cep164 protein. HEK-293 cells were transfected with MYC-Cep164 plasmids and wild-type (Flag-TTBK2)/mutant (Flag-TTBK2 ^T3290C) plasmid. Pull-down assessment for interaction between TTBK2 and Cep164 in vitro.