Home BMPR1A promotes the proliferation of colorectal cancer cells through the activation of Smad1
Article Open Access

BMPR1A promotes the proliferation of colorectal cancer cells through the activation of Smad1

  • Pengjun Zhou EMAIL logo , Wanning Li , Meiyi Ye , Chunlan Chen and Yifei Wang EMAIL logo
Published/Copyright: March 4, 2025
Download Article (PDF)
Oncologie
From the journal Oncologie Volume 27 Issue 2

Abstract

Objectives

Colorectal cancer (CRC) is the second leading cause of cancer-related deaths globally. Although bone morphogenetic protein receptor type 1A (BMPR1A) is recognized for its important role in tumor development, the precise mechanism by which it acts in CRC necessitates additional research. Our study aimed to investigate the role and mechanism of BMPR1A in CRC.

Methods

Using the Gene Expression Profiling Interactive Analysis (GEPIA) database, we analyzed BMPR1A expression in CRC. We investigated the effects of BMPR1A on cell proliferation, migration, invasion, and cell cycle, and the regulation of Smad1. In addition, a mouse xenograft model was established.

Results

The GEPIA database revealed that elevated expression levels of BMPR1A correlate with higher mortality rates and shorter survival duration in patients with CRC. Following the knockdown of BMPR1A, SW620 and HCT116 cells exhibited a decrease in the rate of value addition, arrest of the cell cycle, and a heightened rate of apoptosis, alongside a reduction in migratory and invasive capabilities. Tumor growth was inhibited after the injection of cells with si-BMPR1A in CRC mouse models. Further investigation demonstrated that SMAD family member 1 (Smad1) is activated by BMPR1A. Inhibition of the BMPR1A/Smad1 pathway was found to block p38 pathway activation and mitigate CRC progression.

Conclusions

BMPR1A could have a crucial function in the development of CRC through the activation of Smad1, and governs related downstream processes. Targeting BMPR1A provides a foundation for novel therapeutic strategies in CRC.

Keywords: colorectal cancer; bone morphogenetic protein receptor type 1A (BMPR1A); SMAD family member 1 (Smad1); cell proliferation

Introduction

Colorectal cancer (CRC) is a commonly occurring cancer on a global scale, standing as the third most frequently diagnosed type of cancer in 2020, with reports indicating 2 million new instances. The International Agency for Research on Cancer estimates that this number may increase to 3.2 million new cases, leading to approximately 1.6 million fatalities by the year 2040 [1]. The median age of CRC onset is 67 years; however, approximately 10 % of patients are under 50 years old, and the incidence of CRC is increasing among younger individuals [2]. In China, statistics indicate that CRC has the fifth highest mortality rate among cancers, with rates of 14.63 % in men and 11.29 % in women [3]. This trend of rising incidence among those younger than 50 years is notable. Furthermore, CRC was the fifth leading cause of cancer-related deaths in China in 2020 [1]. Consequently, the treatment of CRC continues to face numerous challenges.

The type II BMP receptor is bound by bone morphogenetic protein (BMP), which is part of the transforming growth factor beta superfamily and functions as a signaling molecule. The receptor subsequently undergoes oligomerization and transphosphorylation of type I BMP receptors, specifically BMPR1A and BMPR1B. This process leads to the recruitment and phosphorylation of the receptor-regulated Mothers Against Decapentaplegic homolog (Smad) proteins, including Smad1 [4], 5]. The phosphorylated forms of Smad1, Smad5, and Smad8 (pSmad1/5/8) then associate with mammalian co-Smad4 to form an oligomeric complex, which facilitates their movement into the nucleus where they can regulate the transcription of particular target genes [6], 7].

A study has identified Smad and BMP as susceptibility genes associated with early-onset colorectal cancer [8]. Xiao et al. suggested that the inhibition of tumor growth by miR-885-3p may be attributed to the downregulation of BMPR1A [9]. They also proposed that the downregulation of BMPR1A contributes, at least in part, to the inhibition of Smad/Id1 signaling. However, its precise mechanism of action in CRC requires further investigation.

In this study, we utilized CRC cell lines SW620 and HCT116 to investigate the influence of BMPR1A on cellular function. Additionally, we established a CRC mouse model to further examine the role of BMPR1A in vivo. Based on our findings, we propose that BMPR1A may facilitate the development of CRC, potentially through the Smad1 signaling pathway. Our research aims to explore the role of BMPR1A in CRC in vivo and in vitro, revealing potential molecular and cellular mechanisms, which will enhance our understanding of CRC.

Materials and methods

Gene correlation analysis in GEPIA

The Gene Expression Profiling Interactive Analysis (GEPIA) tool, available at http://gepia.cancer-pku.cn/index.html, was employed to examine the expression levels of the BMPR1A gene in colon cancer (COAD) and rectal adenocarcinoma (READ) tissues as well as in normal tissues. Survival curves were generated by GEPIA based on the expression data of the BMPR1A gene in these samples. Additionally, box plots alongside survival plots were generated from the obtained results. The analyses were conducted using datasets comprising CRC tissues and corresponding normal tissues.

Cell culture and processing

Human normal colorectal mucosal cell line FHC (CRL-1831), human colon adenocarcinoma cell lines SW480 (CCL-228) and SW620 (CCL-227), human colon cancer cell lines HT-29 (HTB-38) and HCT116 (CCL-247) were obtained and certified by American Type Culture Collection (ATCC) (USA). All cell lines were mycoplasma-free. FHC, HCT116, and SW620 were inoculated and cultured in DMEM high glucose medium (11965092, Gibco, USA). Conversely, SW480 cells were inoculated and cultivated in L-15 medium (11415064, Gibco, USA), whereas HT-29 cells were inoculated and grown in McCOY’s 5A medium (16600082, Gibco, USA), and both were enriched with 10 % FBS (A5670701, Gibco, USA) and 1 % penicillin-streptomycin (15140122, 10,000 U/mL, Gibco, USA). All the cells were kept in a 37 °C incubator containing 5 % CO2. The Smad1 inhibitor ML347 group was treated with the addition of ML347 (purity: 99.94 %, HY-12274, MCE, USA) for 24 and 48 h with a concentration of 25 µM as previously described [10].

Western Blot (WB)

The cells and tissues were lysed and proteins were extracted using high-efficiency RIPA tissue/cell lysis buffer (R0010, Solarbio, China). The supernatant proteins were quantified using the bicinchoninic acid (BCA) method (P0010, Beyotime, China). A 10 % SDS-PAGE gel was utilized for conducting protein electrophoresis. Once the electrophoresis was complete, the protein was transferred to a PVDF membrane, which was then blocked with 5 % BSA for 1 h. Primary antibodies, including BMPR1A (1:1,000 dilution; 12702-1-AP, Proteintech, China), Cyclin D1 (1:10,000 dilution; 26939-1-AP, Proteintech, China), Smad1 (1:1,000 dilution; 10429-1-AP, Proteintech, China), Anti-Smad1 (1:1,000 dilution; ab226821, Abcam, UK), Activin A receptor type I (ACVR1) (1:1,000 dilution; 67417-1-Ig, Proteintech, China), Cyclin Dependent Kinase Inhibitor 1A (p21) (1:1,000 dilution; AHZ0422, Thermo Fisher, USA), Cyclin Dependent Kinase Inhibitor 1B (p27) (1:1,000 dilution; PA5-27188, Thermo Fisher, USA), c-Jun NH2-terminal Kinase (JNK) (1:2,000 dilution; 24164-1-AP, Proteintech, China), Anti-JNK (1:1,000 dilution; ab307802, Abcam, UK), and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:10,000 dilution; ab8245, Abcam, UK), were added and incubated overnight at 4 °C. Afterward, the membrane underwent washing with Tris-buffered saline with Tween-20 (TBST) buffer and incubated with the appropriate secondary antibodies, including Goat Anti-Rabbit IgG H&L Horseradish Peroxidase (HRP) (1:10,000 dilution; ab6721, Abcam, UK) and Goat Anti-Mouse IgG/HRP (1:5,000 dilution; SE131, Solarbio, China), at room temperature for 2 h. The detection was performed using an enhanced chemiluminescence (ECL) reagent kit (29050, Engreen, China) and semi-quantitative densitometric analysis was performed with ImageJ (V 1.52a).

Quantitative real-time PCR (qPCR)

FHC, SW480, SW620, HT-29, and HCT116 cells were lysed using Trizol solution (T9424, Sigma, USA), and RNA extraction was performed with chloroform (≥99.5 %) and isopropanol (≥99.7 %). The mRNA was reverse transcribed following the protocol provided by the M5 First Strand cDNA Synthesis Kit (MF011-01, Mei5bio, China). qPCR was conducted using the cDNA obtained from reverse transcription, adhering to the method outlined in the PerfectStart® Green qPCR SuperMix Kit (AQ601-01-V2, TransGen Biotech, China). The primer sequences employed were: BMPR1A (5′-GGCACTGTCCAGATGATGCT-3′, 5′-GTTCGCTGAACTTTGCACTGA-3′) and GAPDH (5′-AATGACCCCTTCATTGAC, TCCACGACGTACTCAGCGC-3′).

Cell proliferation assessment

For the cell proliferation assay of SW620 and HCT116 cells, 5,000 cells per well were seeded in a 96-well plate. 10 % Cell Counting Kit-8 (CCK-8) reagent (MF128-01, Mei5bio, China) was added at 0, 24, 48 h and a subsequent incubation period of 2 h. Absorbance values at 450 nm were then measured using an enzyme labeling instrument (ELx800, BioTek, USA) to calculate the cell survival rate, using the following formula: Cell viability (%) = [(As − Ab)/(Ac − Ab)] × 100. In this equation, As represents the absorbance of the experimental well, Ab denotes the absorbance of the blank well (which contains the culture medium and CCK-8), and Ac indicates the absorbance of the control well.

Cell apoptosis detection

The rate of apoptosis was assessed utilizing the ANNEXIN V-FITC/PI Apoptosis Detection Kit (G1511, Solarbio, China) with a flow cytometer (Accuri™, BD Biosciences, USA). Late apoptotic cells were counted as a measure of the apoptosis rate.

Invasion assay

Cell suspensions of SW620 and HCT116 cells were diluted and introduced into Transwell chambers. The lower chamber was subsequently supplemented with medium corresponding to the SW620 and HCT116 cells, as mentioned earlier, containing 10 % serum. It was then placed in a cell incubator for a duration of 48 h. After the incubation phase, methanol was employed to fix the cells for a duration of 15 min, followed by staining with 0.5 % crystal violet for 20 min. The cells were washed and destained with 40 % acetic acid before being photographed using the Meimetry Microscopy Digital Imaging System (Mshot, China).

Wound healing assay

Cells after different treatments were collected, and they were plated into 6-well plates at 2 × 105 cells each well and fostered for 24 h at 37 °C with 5 % CO2. A pipette tip (200 μL) was used to draw a line perpendicular to the cell surface, and the cells were cultured for 24 h afterward. The scratch width was tested by using the Meimetry Microscopy Digital Imaging System (Mshot, China) at 0, 24 h, and 48 h subsequent to scratching, and images were obtained. The scratch healing rate (%) was computed to test cell migratory capability.

Knockdown of BMPR1A

The si-NC and si-BMPR1A sequence was synthesized by Tsingke Biotech Co., Ltd. (Beijing, China). The siRNAs were transfected into cells for either 24 or 48 h. The efficiency of BMPR1A knockdown was assessed using qPCR. The sequences of si-RNAs are: si-BMPR1A (SS Sequence: GGAGGUGGUUUGUGUUAAAGG, AS Sequence: UUUAACACAAACCACCUCCAG); si-NC (SS Sequence: UUCUCCGAACGUGUCACGUTT, AS Sequence: ACGUGACACGUUCGGAGAATT).

Cell cycle detection

DNA Content Quantitation Assay (Cell Cycle) (CA1510, Solarbio, China) was used for cell cycle analysis. Cells were harvested by trypsinization and fixed in 70 % ice-cold ethanol comprising 2 mg/mL RNase for 30 min and were finally stained with propidium iodide (PI; 50 mg/mL) for 10 min. The fluorescence of PI in transfected cells (1 × 104) was determined via a flow cytometer (Accuri™, BD Biosciences, USA).

Experimental animal modeling

Six-week-old male BALB/c nude mice (n=36) were procured from Guangdong Yaokang Biotechnology Co., Ltd. (China). Animals were housed conventionally with free access to food and water on a 12-h light/dark cycle. A total of 5 × 106 SW620 or HCT116 cells in 100 μL were subcutaneously injected into nude mice. In the study examining the effect of BMPR1A on CRC in mice, mice were randomly divided into two groups: si-NC and si-BMPR1A, with three mice in each group. To investigate the impact of BMPR1A on the Smad1 pathway in CRC mice, mice were randomly divided into the si-NC group, si-BMPR1A group, si-NC+ML347 group, and si-BMPR1A+ML347 group with three mice in each group. The si-BMPR1A group received injections of si-BMPR1A (15 pmol d−1), while the si-NC+ML347 group was administered both si-NC and Smad1 inhibitor ML347 (10 mg d−1) to inhibit the BMPR1/Smad1 pathway. The si-BMPR1A+ML347 group was injected with si-BMPR1A (15 pmol d−1) and ML347 (10 mg d−1). The si-NC group received si-NC. After four weeks, the mice were euthanized through inhalation of an overdose of carbon dioxide (CO2), and tumor tissue was subsequently collected. Tumors were measured using calipers, and the volume was calculated with the formula: length × width2/2. The protocol was approved by The Laboratory Animal Ethics Committee of Laian Technology (Guangzhou) Co., Ltd., approval number (G2024080), which was performed in accordance with the ARRIVE guidelines.

Hematoxylin-eosin (HE) staining

Sections of tumor tissues were treated with xylene (>98 %) for 10 min, followed by dewaxing. They were then immersed in 10 % hematoxylin solution for 5 min, after which any excess dye was removed under running water. The sections were then exposed to a 1 % hydrochloric acid alcohol for a duration of 10 s and later washed under flowing water. Subsequently, the sections were counterstained using a 0.6 % ammonia solution and rinsed once more with running water. Following the counterstaining process, the sections were soaked in eosin dye for 5 min with excess dye eluted under running water. Post-staining, the sections underwent gradient dehydration with 75 % ethanol-95 % ethanol-100 % ethanol, were immersed in xylene for 5 min to achieve transparency, sealed with neutral gum, and observed using a Minmax microscopic digital imaging system (Mshot, China).

Immunohistochemistry

Tumor tissues fixed in 4 % paraformaldehyde were subjected to gradient dehydration, sectioning, deparaffinization, and subsequent gradient hydration. A dropwise addition of 3 % BSA was applied to the histochemical circle, which was then sealed at room temperature for a duration of 30 min. The primary antibodies – BMPR1A (1:200 dilution; 12702-1-AP, Proteintech, China), Cyclin D1 (1:750 dilution; 26939-1-AP, Proteintech, China), Anti-Smad1 (1:100 dilution; ab226821, Abcam, UK), p21 (1:5,000 dilution; AHZ0422, Thermo Fisher, USA), p27 (1:250 dilution; PA5-27188, Thermo Fisher, USA), and Anti-JNK (1:100 dilution; ab307802, Abcam, UK) – were incubated overnight at 4 °C in a wet box within wet cassettes containing a phosphor. Following incubation, the sections were washed with shaking, and the corresponding secondary antibody, Goat Anti-Rabbit IgG H&L (HRP) (1:1,000 dilution; ab6721, Abcam, UK), was added and incubated at room temperature for 50 min in phosphate-buffered saline (PBS) with shaking. After washing, DAB (3,3′-diaminobenzidine) color development solution was added dropwise, and the sections were rinsed with tap water to halt color development. Hematoxylin was subsequently applied in drops for re-staining, and the color development was stopped by washing the sections with tap water. The sections underwent re-staining with hematoxylin for about 3 min, followed by the addition of ammonia to restore the blue color. Gradient dehydration with 75 % ethanol-95 % ethanol-100 % ethanol was performed, and the sections were sealed with neutral gum before imaging using a microscopic digital imaging system (Mshot, China).

Prediction of protein interactions

The STRING database (Search Tool for the Retrieval of Interacting Genes) (https://string-db.org/) was utilized to analyze the BMPR1A protein. The prediction function of the STRING database facilitated the identification of predicted functional correlations between proteins, which are typically inferred from genomic correlations among the genes encoding them. To enhance visualization, the BMPR1A protein interaction network was selected and mapped, allowing for a clearer representation of the interactions and potential functional relationships between BMPR1 and other proteins.

Overexpression of BMPR1A, Smad1 and ACVR1

The sequences for oe-BMPR1A, oe-Smad1, and oe-ACVR1 were synthesized by Tsingke Biotech Co. (Beijing, China). The oe-RNAs were transfected into cells for 24 h or 48 h. The efficiency of overexpression for both Smad1 and ACVR1 was assessed using qPCR and WB. The sequences of oe-RNAs are provided in Supplementary Table S1.

Co-immunoprecipitation (Co-IP) assay

Cells from SW620 and HCT116 lines, which overexpress BMPR1A, were harvested and subsequently lysed using IP lysis buffer containing PMSF (R0278, Sigma, USA). All experimental procedures were carried out on ice to maintain integrity. The supernatants obtained were then incubated overnight at 4 °C with agarose-conjugated anti-BMPR1A antibody (1:250 dilution; 12702-1-AP, Proteintech, China), anti-Smad1 antibody (1:30 dilution; ab226821, Abcam, UK), or IgG (1:200 dilution; AC005, ABclonal, China). Following immunoprecipitation, the beads were washed three times, eluted using 1 × loading buffer (P0015A, Beyotime, China), and heated at 99 °C for 5 min. After the beads were removed, WB analysis was conducted on the samples.

Statistical analysis

Statistical analyses were conducted with GraphPad Prism 9.0.0 (GraphPad Software, Inc. La Jolla, CA, USA). Data are expressed as mean ± standard deviation (SD). Each experiment was performed with a minimum of three independent replicates. Multiple comparisons were analyzed using a one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test. Comparisons between the two groups were assessed using the Student’s t-test. A p-value of <0.05 was indicated as statistically significant.

Results

BMPR1A as a therapeutic target in CRC

The GEPIA database indicates that the expression of BMPR1A was higher in COAD tumor samples compared to normal tissue samples. Furthermore, BMPR1A expression in READ tumor samples was also elevated relative to normal tissue samples (Figure 1A). Additionally, an analysis of the relationship between BMPR1A expression in the tumor tissues of CRC patients and their survival outcomes, as reported by GEPIA, demonstrated that high BMPR1A expression correlated with lower survival percentages and shorter overall survival (Figure 1B). The results indicate that BMPR1A is involved in the development of CRC and affects the survival outcomes for patients with CRC, indicating that targeting BMPR1A may offer new therapeutic strategies for CRC treatment. Additionally, we examined BMPR1A expression levels in CRC-associated cell lines, including FHC, SW480, HT-29, HCT116, and SW620. The findings found that FHC cells displayed the least expression of BMPR1A, while SW480, HT-29, HCT116, and SW620 cells demonstrated higher levels compared to FHC cells (Figure 1C and D).

Figure 1: The expression of BMPR1A in colorectal cancer. (A) Analysis of BMPR1A expression in colon Adenocarcinoma (COAD) and rectal adenocarcinoma (READ) was conducted using the GEPIA database. (B) The GEPIA database was utilized to examine the relationship between BMPR1A expression and survival prognosis. (C) The mRNA expression levels of BMPR1A were assessed in various colorectal cancer cell lines. (D) Additionally, the protein expression of BMPR1A was evaluated in different colorectal cancer cells. Data are presented as mean  ±  SD. n=3, compared to si-NC group, *p<0.05, **p<0.01, ***p<0.001.
Figure 1:

The expression of BMPR1A in colorectal cancer. (A) Analysis of BMPR1A expression in colon Adenocarcinoma (COAD) and rectal adenocarcinoma (READ) was conducted using the GEPIA database. (B) The GEPIA database was utilized to examine the relationship between BMPR1A expression and survival prognosis. (C) The mRNA expression levels of BMPR1A were assessed in various colorectal cancer cell lines. (D) Additionally, the protein expression of BMPR1A was evaluated in different colorectal cancer cells. Data are presented as mean  ±  SD. n=3, compared to si-NC group, *p<0.05, **p<0.01, ***p<0.001.

BMPR1A promotes the proliferation of CRC cells

SW620 and HCT116 cells, demonstrating high expression of BMPR1A, were chosen for our study to explore how knocking down the BMPR1A gene influences the growth and proliferation of cancer cells. The qPCR tests indicated that following the knockdown of BMPR1A, the RNA levels of BMPR1A were reduced (Supplementary Figure S1). The proliferation rates of SW620 and HCT116 cells decreased following BMPR1A gene knockdown after 24 and 48 h (Figure 2A and Supplementary Figure S2A). Furthermore, the apoptosis rate of SW620 cells did not show change at 24 h in the si-BMPR1A group, but it increased after 48 h (Figure 2B). Conversely, the rate of apoptosis in HCT116 cells increased at 24 and 48 h after the knockdown of BMPR1A (Supplementary Figure S2B). Furthermore, the invasive capabilities of SW620 and HCT116 cells were reduced following the knockdown of BMPR1A at both 24 h and 48 h (Figure 2C and Supplementary Figure S2C). Similarly, the migration capabilities of SW620 and HCT116 cells decreased after BMPR1A knockdown (Figure 2D and Supplementary Figure S2D). In SW620 cells, the reduction of the BMPR1A caused a notable decline in the count of cells within the S phase and a rise in the population of cells in the G2/M phase at both 24 h and 48 h (Figure 2E). Similarly, in HCT116 cells, the knockdown of BMPR1A resulted in a lower number of cells in the G0/G1 phase, along with an increase in the G2/M phase cell count over the same time periods (Supplementary Figure S2E). BMPR1A and Cyclin D1 protein levels decreased after BMPR1A knockdown, while the levels of p21 and p27 increased in both SW620 and HCT116 cells (Figure 2F and Supplementary Figure S2F).

Figure 2: The effect of BMPR1A on the growth of SW620 cells. (A) The cell proliferation rates following the knockdown of the BMPR1A gene (si-BMPR1A) at 24 h and 48 h. (B) The cell apoptosis rates after the knockdown of the BMPR1A gene at 24 h and 48 h. (C) The migration ability post-BMPR1A gene knockdown at 24 h and 48 h, scale bar=100 μm. (D) The invasion capability after the knockdown of the BMPR1A, scale bar=100 μm. (E) Flow assay for cell cycle changes at 24 h and 48 h following the knockdown of the BMPR1A. (F) WB detection of cell cycle protein expression at 24 h and 48 h post-BMPR1A knockdown. Data are presented as mean  ±  SD. n=3, compared to si-NC group, *p<0.05, **p<0.01.
Figure 2:

The effect of BMPR1A on the growth of SW620 cells. (A) The cell proliferation rates following the knockdown of the BMPR1A gene (si-BMPR1A) at 24 h and 48 h. (B) The cell apoptosis rates after the knockdown of the BMPR1A gene at 24 h and 48 h. (C) The migration ability post-BMPR1A gene knockdown at 24 h and 48 h, scale bar=100 μm. (D) The invasion capability after the knockdown of the BMPR1A, scale bar=100 μm. (E) Flow assay for cell cycle changes at 24 h and 48 h following the knockdown of the BMPR1A. (F) WB detection of cell cycle protein expression at 24 h and 48 h post-BMPR1A knockdown. Data are presented as mean  ±  SD. n=3, compared to si-NC group, *p<0.05, **p<0.01.

BMPR1A promotes tumor growth in CRC mice

Following the injection of si-BMPR1A into SW620 and HCT116 cells that were subcutaneously implanted in tumor-bearing mice, a decrease in tumor weight (Figure 3A and B and Supplementary Figure S3A, B), accompanied by a gradual reduction in tumor volume was observed over time (Figure 3C and Supplementary Figure S3C). Histological examination via HE staining revealed that following the administration of si-BMPR1A, tumor cells in CRC mice exhibited a more loosely arranged structure, an increase in gaps, a reduction in inflammatory infiltration, and a normalization of blood vessel formation (Figure 3D and Supplementary Figure S3D). Immunohistochemical analysis of cell cycle proteins in CRC mice tumor tissues indicated that following si-BMPR1A injection, BMPR1A protein expression was reduced, while the expression of ki67 and CyclinD1 proteins decreased, and the expression of p21 and p27 proteins increased (Figure 3E and Supplementary Figure S3E).

Figure 3: The effect of BMPR1A on tumor growth in a mouse model of CRC. Following the subcutaneous injection of SW620 cells, mice were treated with si-BMPR1A. (A) The diagram shows tumor morphology and the final changes in tumor weight. (B) Gross tumor volume measurements are presented. (C) The graph depicts changes in tumor volume over time. (D) Hematoxylin and eosin (HE) staining was performed to observe the pathological changes within the tumor, scale bar=20 μm. (E) Immunohistochemical analysis was conducted to assess the expression of cell cycle proteins: BMPR1A, Ki67, Cyclin D1, p21, and p27, scale bar=20 μm. Data are presented as mean  ±  SD. n=3, compared to si-NC group, *p<0.05, **p<0.01.
Figure 3:

The effect of BMPR1A on tumor growth in a mouse model of CRC. Following the subcutaneous injection of SW620 cells, mice were treated with si-BMPR1A. (A) The diagram shows tumor morphology and the final changes in tumor weight. (B) Gross tumor volume measurements are presented. (C) The graph depicts changes in tumor volume over time. (D) Hematoxylin and eosin (HE) staining was performed to observe the pathological changes within the tumor, scale bar=20 μm. (E) Immunohistochemical analysis was conducted to assess the expression of cell cycle proteins: BMPR1A, Ki67, Cyclin D1, p21, and p27, scale bar=20 μm. Data are presented as mean  ±  SD. n=3, compared to si-NC group, *p<0.05, **p<0.01.

BMPR1A regulates Smad1 activation

Protein interaction network analysis conducted using the STRING database revealed that BMPR1A interacts with members of the BMP family, Smad1, GDF5, and ACVR1 (Supplementary Figure S4). Correlation analysis of these proteins indicated a strong correlation between BMPR1A and both Smad1 and ACVR1, while a weaker correlation was observed with GDF5 and the BMP family (Figure 4A and Supplementary Figure S5). To explore the regulatory mechanisms upstream and downstream of BMPR1A, we conducted an overexpression of BMPR1A in SW620 and HCT116 cell lines, leading to a notable enhancement in the protein expression levels of p-Smad1 and Smad1. This result indicates that BMPR1A regulates the activation of Smad1. Notably, no considerable alteration in ACVR1 protein levels was seen, indicating that ACVR1 is not a downstream target of BMPR1A (Figure 4B and Supplementary Figure S6A). To further elucidate the relationship between BMPR1A, Smad1, and ACVR1, we overexpressed ACVR1 and Smad1 in SW620 and HCT116 cells, respectively. The overexpression of ACVR1 led to a increase in BMPR1A protein expression in both SW620 and HCT116 cells (Figure 4C and Supplementary Figure S6B), suggesting that BMPR1A activation is regulated by ACVR1. Conversely, the protein expression of BMPR1A did not change following the overexpression of Smad1 (Figure 4D and Supplementary Figure S6C), indicating a unidirectional regulatory relationship from BMPR1A to Smad1. Additionally, we validated the protein interactions between BMPR1A and Smad1 in SW620 and HCT116 cells using a Co-IP assay, confirming the formation of a complex between BMPR1A and Smad1 in both cell lines (Figure 4E and Supplementary Figure S6D).

Figure 4: The regulatory relationship between BMPR1A and Smad1. (A) A correlation analysis was performed to examine the relationship between BMPR1A, Smad1, and ACVR1. (B) The effects of BMPR1A overexpression (oe-BMPR1A) on the levels of p-Smad1, Smad1, and ACVR1 were evaluated in SW620 cells. (C) The impact of ACVR1 overexpression (oe-ACVR1) on BMPR1A levels was also examined in SW620 cells. (D) The changes in BMPR1A following the overexpression of Smad1 (oe-Smad1) in SW620 cells were analyzed. (E) The interactions between BMPR1A and Smad1 proteins were validated. Data are presented as mean  ±  SD. n=3, compared to si-NC group, *p<0.05, **p<0.01, ns=no significance.
Figure 4:

The regulatory relationship between BMPR1A and Smad1. (A) A correlation analysis was performed to examine the relationship between BMPR1A, Smad1, and ACVR1. (B) The effects of BMPR1A overexpression (oe-BMPR1A) on the levels of p-Smad1, Smad1, and ACVR1 were evaluated in SW620 cells. (C) The impact of ACVR1 overexpression (oe-ACVR1) on BMPR1A levels was also examined in SW620 cells. (D) The changes in BMPR1A following the overexpression of Smad1 (oe-Smad1) in SW620 cells were analyzed. (E) The interactions between BMPR1A and Smad1 proteins were validated. Data are presented as mean  ±  SD. n=3, compared to si-NC group, *p<0.05, **p<0.01, ns=no significance.

Inhibition of the BMPR1A/Smad1 pathway promotes apoptosis in CRC cells

To explore the impact of the BMPR1A/Smad1 signaling pathway on CRC cells, we employed ML347, a Smad1 inhibitor. Compared to si-NC group, the proliferation rates of SW620 and HCT116 cells in si-BMPR1A group and si-NC+ML347 group significantly decreased after 24 h and 48 h; Compared to si-BMPR1A group, the proliferation rates of SW620 and HCT116 cells in si-BMPR1A+ML347 group significantly decreased after 24 h and 48 h (Figure 5A and Supplementary Figure S7A). Additionally, the apoptosis rates of SW620 and HCT116 cells increased after BMPR1A gene knockdown for both 24 h and 48 h. ML347 administration also resulted in increased apoptosis rates after both 24 h and 48 h. Furthermore, the apoptosis rates following simultaneous inhibition of the BMPR1A/Smad1 pathway for 24 h and 48 h were markedly more pronounced than those observed with BMPR1A knockdown alone (Figure 5B and Supplementary Figure S7B). The invasive capabilities of SW620 and HCT116 cells were reduced following the knockdown of the BMPR1A at both 24 h and 48 h. Similarly, ML347 treatment resulted in a decrease in invasive capabilities at both 24 h and 48 h. Moreover, inhibiting the BMPR1A/Smad1 pathway for 24 h and 48 h also led to a reduction in cell migration ability, with changes being more pronounced than those observed with BMPR1A knockdown alone (Figure 5C and Supplementary Figure S7C). The migration capabilities of SW620 and HCT116 cells were reduced after the BMPR1A was knocked down. In addition, administering ML347 also led to a marked decrease in the migration capabilities of these cells. Moreover, concurrently inhibiting the BMPR1A/Smad1 pathway produced an even more substantial reduction than that achieved by the BMPR1A knockdown alone (Figure 5D and Supplementary Figure S7D). Additionally, cell cycle analysis revealed that SW620 and HCT116 cells experienced cell cycle arrest at 24 h and 48 h of BMPR1A knockdown. Cell cycle arrest was also observed following ML347 treatment for the same duration. Notably, the arrest was more after the simultaneous inhibition of the BMPR1A/Smad1 pathway for 24 h and 48 h than after BMPR1A knockdown alone (Figure 5E and Supplementary Figure S7E).

Figure 5: The impact of the BMPR1A/Smad1 pathway on the growth of SW620 cells. (A) The cell proliferation rates were assessed following the knockdown of the BMPR1A gene (si-BMPR1A), inhibition of Smad1 (si-NC+ML347), or simultaneous inhibition of the BMPR1A/Smad1 pathway (si-BMPR1A+ML347) over 24 h and 48 h. (B) The rates of apoptosis were evaluated after the knockdown of the BMPR1A gene, inhibition of Smad1, or simultaneous inhibition of the BMPR1A/Smad1 pathway for 24 h and 48 h. (C) The migration capabilities were analyzed following the knockdown of the BMPR1A gene, inhibition of Smad1, or simultaneous inhibition of the BMPR1A/Smad1 pathway over 24 h and 48 h, scale bar=100 μm. (D) The invasion abilities were examined after the knockdown of the BMPR1A gene, inhibition of Smad1, or simultaneous inhibition of the BMPR1A/Smad1 pathway, scale bar=100 μm. (E) A flow cytometry assay was conducted to assess cell cycle alterations following the knockdown of the BMPR1A gene, inhibition of Smad1, or simultaneous inhibition of the BMPR1A/Smad1 pathway. Data are presented as mean  ±  SD. n=3, compared to si-NC group, *p<0.05, **p<0.01, ***p<0.001; compared to si- BMPR1A group, #p<0.05, ##p<0.01, ###p<0.001.
Figure 5:

The impact of the BMPR1A/Smad1 pathway on the growth of SW620 cells. (A) The cell proliferation rates were assessed following the knockdown of the BMPR1A gene (si-BMPR1A), inhibition of Smad1 (si-NC+ML347), or simultaneous inhibition of the BMPR1A/Smad1 pathway (si-BMPR1A+ML347) over 24 h and 48 h. (B) The rates of apoptosis were evaluated after the knockdown of the BMPR1A gene, inhibition of Smad1, or simultaneous inhibition of the BMPR1A/Smad1 pathway for 24 h and 48 h. (C) The migration capabilities were analyzed following the knockdown of the BMPR1A gene, inhibition of Smad1, or simultaneous inhibition of the BMPR1A/Smad1 pathway over 24 h and 48 h, scale bar=100 μm. (D) The invasion abilities were examined after the knockdown of the BMPR1A gene, inhibition of Smad1, or simultaneous inhibition of the BMPR1A/Smad1 pathway, scale bar=100 μm. (E) A flow cytometry assay was conducted to assess cell cycle alterations following the knockdown of the BMPR1A gene, inhibition of Smad1, or simultaneous inhibition of the BMPR1A/Smad1 pathway. Data are presented as mean  ±  SD. n=3, compared to si-NC group, *p<0.05, **p<0.01, ***p<0.001; compared to si- BMPR1A group, #p<0.05, ##p<0.01, ###p<0.001.

BMPR1A/Smad1 mediates p38 activation without affecting JNK changes

Following the knockdown of BMPR1A in SW620 cells, a decrease in BMPR1A protein expression was observed, along with a notable reduction in phosphorylated Smad1 protein levels; total Smad1 protein expression also decreased. This suggests that the activation of Smad1 phosphorylation may be accompanied by other modifications, leading to inhibited p38 activation, while JNK levels remained unchanged. After the administration of ML347, BMPR1A protein expression did not exhibit changes, and both Smad1 and p38 activation were inhibited, with no alterations in JNK levels. Furthermore, simultaneous inhibition of the BMPR1A/Smad1 pathway resulted in no changes in BMPR1A protein expression, alongside inhibited Smad1 and p38 activation, while JNK levels remained unchanged when compared to the injection of si-BMPR1A alone (Figure 6). In contrast, the knockdown of BMPR1A in HCT116 cells led to a marked decline in the expression of BMPR1A protein, along with a decrease in. both phosphorylated and total Smad1 protein levels, accompanied by suppressed p38 activation, with no changes in JNK. Following the administration of ML347, BMPR1A protein expression remained unchanged, while both Smad1 and p38 activation were inhibited, with JNK levels showing no changes. Moreover, the concurrent suppression of the BMPR1A/Smad1 pathway resulted in a reduction of BMPR1A protein levels, inhibition of Smad1 and p38 activation, and no changes in JNK compared to the injection of si-BMPR1A alone (Supplementary Figure S8).

Figure 6: The regulation of p38 and JNK by the BMPR1A/Smad1 pathway. (A) Representative WB results of BMPR1A, p-Smad1, Smad1, p-p38, p38, p-JNK, and JNK expression in each group of SW620 cells. (B) Relative protein levels of BMPR1A, p-Smad1, Smad1, p-p38, p38, p-JNK and JNK in SW620 cells. Data are presented as mean  ±  SD. n=3, compared to si-NC group, *p<0.05, **p<0.01; compared to si-BMPR1A group, #p<0.05.
Figure 6:

The regulation of p38 and JNK by the BMPR1A/Smad1 pathway. (A) Representative WB results of BMPR1A, p-Smad1, Smad1, p-p38, p38, p-JNK, and JNK expression in each group of SW620 cells. (B) Relative protein levels of BMPR1A, p-Smad1, Smad1, p-p38, p38, p-JNK and JNK in SW620 cells. Data are presented as mean  ±  SD. n=3, compared to si-NC group, *p<0.05, **p<0.01; compared to si-BMPR1A group, #p<0.05.

BMPR1A/Smad1 promotes tumor growth in CRC mice

In SW620 and HCT116 cells subcutaneously injected into tumor-bearing mice, the tumor weight and volume were reduced following the injection of si-BMPR1A, ML347, and both si-BMPR1A and ML347 simultaneously, compared to the injection of si-BMPR1A alone (Figure 7A and B and Supplementary Figure S9A, B). HE staining revealed that the tumor tissue cells in CRC mice injected with si-NC were tightly arranged, exhibiting varied cell sizes and uneven morphology, with increased nucleoli and more heterogeneous nuclei. In contrast, tumor histopathology improved following the injection of either si-BMPR1A or ML347; notably, the simultaneous injection of both si-BMPR1A and ML347 resulted in a more pronounced enhancement in tumor histopathology compared to the si-BMPR1A injection alone (Figure 7C and Supplementary Figure S9C). After the injection of si-BMPR1A in mice, there was a reduction in tumor tissue BMPR1A protein expression, Ki67 protein expression, and phosphorylated Smad1 protein expression. Additionally, total Smad1 protein levels were decreased, p38 activation was inhibited, and no change was observed in JNK. Conversely, following the administration of ML347, no changes were observed in BMPR1A protein expression. Additionally, the activation of Smad1 and p38 was inhibited, while no alterations in p-JNK were noted. Following simultaneous injection of si-BMPR1A and ML347, compared to si-BMPR1A injection alone, there were no changes in BMPR1A protein expression in tumor tissue, while Ki67 protein expression was decreased, Smad1 and p38 activation was inhibited, and no changes were noted in JNK (Figure 7D and E and Supplementary Figure S9D, E).

Figure 7: The effect of BMPR1A/Smad1 on tumor growth in a colorectal cancer mouse model. Following the subcutaneous injection of SW620 cells, mice were treated with si-BMPR1A, ML347, or a combination of both si-BMPR1A and ML347, the following observations were made: (A) alterations in tumor morphology and weight; (B) measurement of tumor volume; (C) histological examination via HE staining to assess pathological changes in the tumor, scale bar=20 μm; (D) immunohistochemical analysis to detect variations in cell cycle protein Ki67, as well as changes in BMPR1A, p-Smad1, p38, and JNK, scale bar=20 μm; (E) WB to evaluate the levels of BMPR1A, p-Smad1, Smad1, p-p38, p38, p-JNK, and JNK. Data are presented as mean  ±  SD. n=3, compared to si-NC group, *p<0.05, **p<0.01; compared to si- BMPR1A group, #p<0.05.
Figure 7:

The effect of BMPR1A/Smad1 on tumor growth in a colorectal cancer mouse model. Following the subcutaneous injection of SW620 cells, mice were treated with si-BMPR1A, ML347, or a combination of both si-BMPR1A and ML347, the following observations were made: (A) alterations in tumor morphology and weight; (B) measurement of tumor volume; (C) histological examination via HE staining to assess pathological changes in the tumor, scale bar=20 μm; (D) immunohistochemical analysis to detect variations in cell cycle protein Ki67, as well as changes in BMPR1A, p-Smad1, p38, and JNK, scale bar=20 μm; (E) WB to evaluate the levels of BMPR1A, p-Smad1, Smad1, p-p38, p38, p-JNK, and JNK. Data are presented as mean  ±  SD. n=3, compared to si-NC group, *p<0.05, **p<0.01; compared to si- BMPR1A group, #p<0.05.

Discussion

The development, advancement, spread, and return of CRC involve various critical signaling pathways within the body, making it a complex biological process [11]. Therefore, a comprehensive investigation into the mechanisms behind CRC could offer insightful approaches to the diagnosis and therapy of tumors. Juvenile polyp syndrome (JPS) is linked to a heightened risk of gastrointestinal cancers [12], 13], with most cases resulting from pathogenic variants of SMAD4 or BMPR1A [14], [15], [16]. Nevertheless, a direct link between BMPR1A and a heightened risk of CRC has not been widely documented. Our examination of the GEPIA database revealed that BMPR1A levels are increased in COAD and READ, and that high BMPR1A expression correlates with earlier mortality and shorter survival times in CRC patients, suggesting that BMPR1A may serve as a therapeutic target for CRC. RSPO3 plays a crucial role in the activation of WNT signaling pathways and is implicated in the development of CRC [17]. One characteristic of tumors in RSPO-positive CRC is a higher prevalence of BMPR1A mutations [18]. Our assay found that BMPR1A expression is elevated in CRC-related cells, indicating that BMPR1A may promote the development of CRC.

The silencing of BMPR1A led to a notable reduction in the value-added rate of SW620 and HCT116 cells, caused cell cycle arrest, and resulted in an increased rate of apoptosis, in addition to a substantial decline in their migration and invasion abilities. In mice injected subcutaneously with SW620 and HCT116 cells to form tumors, the administration of si-BMPR1A led to a substantial reduction in both tumor volume and weight in CRC models, accompanied by notable improvements in tumor histopathology. Ki67 expression is closely linked to the proliferation of tumor cells and acts as a marker indicating tumor growth [19], which was diminished following si-BMPR1A injection. Our experiments demonstrated that the mice treated with si-BMPR1A exhibited a pronounced decrease in tumor volume and weight, alongside enhancements in tumor histopathology. Additionally, the depletion of BMPR1A led to a decrease in the expression of the Ki67 protein. The process of cell division plays a vital role in cancer advancement, with Cyclin D1, a regulatory protein of the cell cycle, promoting cell proliferation during the transition from the G1 phase to the S phase [20], 21], while p21 and p27 promote cell cycle arrest [22], 23]. Following the administration of si-BMPR1A to mice with CRC, there was a marked reduction in the expression levels of Cyclin D1 protein, alongside a rise in the levels of p21 and p27 proteins. These findings indicate that the knockdown of BMPR1A in CRC mice inhibited tumor cell proliferation and contributed to the treatment of CRC to some extent.

Protein interaction network analysis conducted using the STRING database revealed that BMPR1A interacts with proteins from the BMP family, as well as Smad1, GDF5, and ACVR1. Notably, we found a strong correlation between BMPR1A and both Smad1 and ACVR1. Smad1 mediates the signaling of BMPs [24], which are involved in numerous biological functions, such as cellular development, programmed cell death, and immune reactions [25]. BMP ligands initiate the phosphorylation and activation of Smad1 via BMP receptor kinases [26]. The human activin A receptor type I (ACVR1) creates a heterotetrameric complex with type II receptors, including BMPR2, ACVR2A, and ACVR2B [27]. The structural domains of the type I receptor’s kinase are activated by this interaction, which then leads to the phosphorylation of the Smad1/5/8 proteins [28]. BMPR1A is a component of a heterotetrameric complex with BMPs, while the type II receptor BMPR1 also forms a heterotetramer. However, the regulatory relationship between BMPR1A, Smad1, and ACVR1 remains unclear. To investigate the upstream and downstream regulatory mechanisms of BMPR1A, we overexpressed BMPR1A and ACVR1 in SW620 and HCT116 cells. Our findings indicate that Smad1 is a downstream target protein of BMPR1A, while the activation of BMPR1A is regulated by ACVR1. Furthermore, we validated the protein interactions between BMPR1A and Smad1 in both SW620 and HCT116 cells, confirming the presence of these interactions. Notably, simultaneous knockdown of BMPR1A alongside inhibition of Smad1 led to a decrease in the value-added rate, cell cycle arrest in the G2/M phase, and increased apoptosis in SW620 and HCT116 cells, as well as a marked reduction in their migration and invasion capabilities.

It has been established that miR-656 plays a role in suppressing glioma tumorigenesis by targeting BMPR1A. Specifically, miR-656 hinders the proliferation of glioma cells, the formation of neurospheres, as well as their migration and invasion, regardless of the presence of exogenous BMP-2. The knockdown of BMPR1A markedly lessens the antiproliferative impacts of miR-656 in vitro. Furthermore, overexpression of miR-656 inhibits both the classical BMP/Smad and the nonclassical BMP/mitogen-activated protein kinase (MAPK) pathways [29]. Consequently, we investigated the influence of the BMPR1A/Smad1 pathway on the JNK/p38 pathway. Our results indicated that the knockdown of BMPR1A, along with the inhibition of Smad1 expression and simultaneous suppression of the BMPR1A/Smad1 pathway in both in vivo and in vitro experiments, reduced the activation of p38, while not affecting the JNK pathway. p38 activation can occur through three different pathways, with the typical activation pathway involving the cyclic sequence Thr-Gly-Tyr, which leads to the phosphorylation of p38. Additionally, there exists an atypical pathway for p38 activation, which entails the direct interaction of transforming growth factor-activated kinase-1 binding protein-1 (TAB1) with p38α. Our findings demonstrate that the p38 pathway is activated via the cyclic sequence Thr-Gly-Tyr, resulting in the phosphorylation of p38α [30]. This study suggests that the BMPR1A/Smad1 pathway may not activate the p38 pathway through JNK in CRC, and further investigation is warranted to elucidate the specific activation mechanisms involved.

Despite these promising findings, there are limitations to our study. We did not analyze samples of patients, and future studies could collect samples of patients that better reflect the role of BMPR1A in patients. Additionally, metastasis of CRC was not explored in this study, and more animal models could be established to study whether BMPR1A affects metastasis of CRC. While our study has its limitations, it has the potential to contribute to advancements in both the understanding and treatment of CRC.

Conclusions

In conclusion, our research reveals the critical roles of BMPR1A in CRC progression, specifically in cell proliferation, migration and invasion. with its mechanism of action being partially associated with the activation of the Smad1 pathway. Targeting BMPR1A provides a foundation for novel therapeutic strategies in CRC.

Corresponding authors: Pengjun Zhou, Department of Pharmacology, Guangdong Pharmaceutical University, Guangzhou 510006, China; and Guangzhou Jinan Biomedicine Research and Development Center, Guangdong Provincial Key Laboratory of Bioengineering Medicine, College of Life Science and Technology, Jinan University, Guangzhou, 510632, China, E-mail: ; and Yifei Wang, Guangzhou Jinan Biomedicine Research and Development Center, Guangdong Provincial Key Laboratory of Bioengineering Medicine, College of Life Science and Technology, Jinan University, Guangzhou, 510632, China, E-mail:
Pengjun Zhou and Wanning Li contributed equally to this work and shared co-first authorship.

Funding source: China Postdoctoral Science Foundation

Award Identifier / Grant number: 2019M663398

Funding source: Youth Program of National Natural Science Foundation of China

Award Identifier / Grant number: 82002930

Funding source: the Science and Technology Projects in Guangzhou

Award Identifier / Grant number: 2023A04J1143

  1. Research ethics: All animal experiments were approved by the Laboratory Animal Ethics Committee of Laian Technology (Guangzhou) Co., Ltd., approval number (G2024080), and the animal experiments were performed in accordance with ARRIVE guidelines (https://arriveguidelines.org).

  2. Informed consent: Not applicable.

  3. Author contributions: Pengjun Zhou and Wanning Li designed, performed the experiments, and wrote and revised the paper. Meiyi Ye performed in vitro experiments. Chunlan Chen reviewed and revised the paper. Yifei Wang designed the study and revised the paper. All authors contributed to analyze the results and approved the paper.

  4. Use of Large Language Models, AI and Machine Learning Tools: Not applicable.

  5. Conflict of interest: The authors declare that they have no conflict of interest.

  6. Research funding: This work was supported by the Science and Technology Projects in Guangzhou (2023A04J1143), Youth Program of National Natural Science Foundation of China (82002930), China Postdoctoral Science Foundation (2019M663398).

  7. Data availability: Data sharing is not applicable to this article as no datasets were generated or analyzed during the current study. The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

  8. Consent for publication: Not applicable.

References

1. Morgan, E, Arnold, M, Gini, A, Lorenzoni, V, Cabasag, CJ, Laversanne, M, et al.. Global burden of colorectal cancer in 2020 and 2040: incidence and mortality estimates from GLOBOCAN. Gut 2023;72:338–44. https://doi.org/10.1136/gutjnl-2022-327736.Search in Google Scholar PubMed

2. Eng, C, Yoshino, T, Ruíz-García, E, Mostafa, N, Cann, CG, O’Brian, B, et al.. Colorectal cancer. Lancet 2024;404:294–310. https://doi.org/10.1016/s0140-6736(24)00360-x.Search in Google Scholar PubMed

3. Qi, J, Li, M, Wang, L, Hu, Y, Liu, W, Long, Z, et al.. National and subnational trends in cancer burden in China, 2005–20: an analysis of national mortality surveillance data. Lancet Public Health 2023;8:e943–e955. https://doi.org/10.1016/s2468-2667(23)00211-6.Search in Google Scholar PubMed

4. Tauriello, DVF, Sancho, E, Batlle, E. Overcoming TGFβ-mediated immune evasion in cancer. Nat Rev Cancer 2021;22:25–44. https://doi.org/10.1038/s41568-021-00413-6.Search in Google Scholar PubMed

5. Zsiros, V, Dóczi, N, Petővári, G, Pop, A, Erdei, Z, Sebestyén, A, et al.. BMP-induced non-canonical signaling is upregulated during autophagy-mediated regeneration in inflamed mesothelial cells. Sci Rep 2023;13:10426. https://doi.org/10.1038/s41598-023-37453-x.Search in Google Scholar PubMed PubMed Central

6. Derynck, R, Budi, EH. Specificity, versatility, and control of TGF-β family signaling. Sci Signal 2019;12:eaav5183. https://doi.org/10.1126/scisignal.aav5183.Search in Google Scholar PubMed PubMed Central

7. Gough, NR, Xiang, X, Mishra, L. TGF-Β signaling in liver, pancreas, and gastrointestinal diseases and cancer. Gastroenterology 2021;161:434–52.e15. https://doi.org/10.1053/j.gastro.2021.04.064.Search in Google Scholar PubMed PubMed Central

8. Laskar, RS, Qu, C, Huyghe, JR, Harrison, T, Hayes, RB, Cao, Y, et al.. Genome-wide association studies and Mendelian randomization analyses provide insights into the causes of early-onset colorectal cancer. Ann Oncol 2024;35:523–36. https://doi.org/10.1016/j.annonc.2024.02.008.Search in Google Scholar PubMed PubMed Central

9. Xiao, F, Qiu, H, Cui, H, Ni, X, Li, J, Liao, W, et al.. MicroRNA-885-3p inhibits the growth of HT-29 colon cancer cell xenografts by disrupting angiogenesis via targeting BMPR1A and blocking BMP/Smad/Id1 signaling. Oncogene 2014;34:1968–78. https://doi.org/10.1038/onc.2014.134.Search in Google Scholar PubMed

10. Zhang, H, Zhan, Y, Zhang, Y, Yuan, G, Yang, G. Dual roles of TGF-β signaling in the regulation of dental epithelial cell proliferation. J Mol Histol 2021;52:77–86. https://doi.org/10.1007/s10735-020-09925-1.Search in Google Scholar PubMed

11. Shen, C, Xuan, B, Yan, T, Ma, Y, Xu, P, Tian, X, et al.. m(6)A-dependent glycolysis enhances colorectal cancer progression. Mol Cancer 2020;19:72. https://doi.org/10.1186/s12943-020-01190-w.Search in Google Scholar PubMed PubMed Central

12. Ishida, H, Ishibashi, K, Iwama, T. Malignant tumors associated with juvenile polyposis syndrome in Japan. Surg Today 2018;48:253–63. https://doi.org/10.1007/s00595-017-1538-2.Search in Google Scholar PubMed

13. Dal Buono, A, Gaiani, F, Poliani, L, Laghi, L. Juvenile polyposis syndrome: an overview. Best Pract Res Clin Gastroenterol 2022;58–59:101799. https://doi.org/10.1016/j.bpg.2022.101799.Search in Google Scholar PubMed

14. Papadopulos, ME, Plazzer, JP, Macrae, FA. Genotype-phenotype correlation of BMPR1a disease causing variants in juvenile polyposis syndrome. Hered Cancer Clin Pract 2023;21:12. https://doi.org/10.1186/s13053-023-00255-3.Search in Google Scholar PubMed PubMed Central

15. Forte, G, Buonadonna, AL, Fasano, C, Sanese, P, Cariola, F, Manghisi, A, et al.. Clinical and molecular characterization of SMAD4 splicing variants in patients with juvenile polyposis syndrome. Int J Mol Sci 2024;25:7939. https://doi.org/10.3390/ijms25147939.Search in Google Scholar PubMed PubMed Central

16. Cao, K, Plazzer, JP, Macrae, F. SMAD4 variants and its genotype-phenotype correlations to juvenile polyposis syndrome. Hered Cancer Clin Pract 2023;21:27. https://doi.org/10.1186/s13053-023-00267-z.Search in Google Scholar PubMed PubMed Central

17. Jeong, JH, Yun, JW, Kim, HY, Heo, CY, Lee, S. Investigation of cell signalings and therapeutic targets in PTPRK-RSPO3 fusion-positive colorectal cancer. PLoS One 2022;17:e0274555. https://doi.org/10.1371/journal.pone.0274555.Search in Google Scholar PubMed PubMed Central

18. Yan, HHN, Siu, HC, Ho, SL, Yue, SSK, Gao, Y, Tsui, WY, et al.. Organoid cultures of early-onset colorectal cancers reveal distinct and rare genetic profiles. Gut 2020;69:2165–79. https://doi.org/10.1136/gutjnl-2019-320019.Search in Google Scholar PubMed

19. Maia, R, Santos, GAD, Reis, S, Viana, NI, Pimenta, R, Guimarães, VR, et al.. Can we use Ki67 expression to predict prostate cancer aggressiveness? Rev Col Bras Cir 2022;49:e20223200. https://doi.org/10.1590/0100-6991e-20223200-en.Search in Google Scholar PubMed PubMed Central

20. Yang, Y, Song, L, Yin, Y, Gao, Y, Wang, Y, Wu, S, et al.. Clinical significance of Cyclin D1 by complete quantification detection in mantle cell lymphoma: positive indicator in prognosis. Diagn Pathol 2024;19:149. https://doi.org/10.1186/s13000-024-01577-z.Search in Google Scholar PubMed PubMed Central

21. Wang, J, Zhang, Z, Liu, H, Liu, N, Hu, Y, Guo, W, et al.. Identification of 8 candidate microsatellite instability loci in colorectal cancer and validation of the ACVR2A mechanism in the tumor progression. Sci Rep 2024;14:14145. https://doi.org/10.1038/s41598-024-62753-1.Search in Google Scholar PubMed PubMed Central

22. Karimian, A, Ahmadi, Y, Yousefi, B. Multiple functions of p21 in cell cycle, apoptosis and transcriptional regulation after DNA damage. DNA Repair (Amst) 2016;42:63–71. https://doi.org/10.1016/j.dnarep.2016.04.008.Search in Google Scholar PubMed

23. Razavipour, SF, Harikumar, KB, Slingerland, JM. p27 as a transcriptional regulator: new roles in development and cancer. Cancer Res 2020;80:3451–8. https://doi.org/10.1158/0008-5472.can-19-3663.Search in Google Scholar

24. Nickel, J, Mueller, TD. Specification of BMP signaling. Cells 2019;8:1579. https://doi.org/10.3390/cells8121579.Search in Google Scholar PubMed PubMed Central

25. Wu, J, Zhang, M, Faruq, O, Zacksenhaus, E, Chen, W, Liu, A, et al.. SMAD1 as a biomarker and potential therapeutic target in drug-resistant multiple myeloma. Biomark Res 2021;9:48. https://doi.org/10.1186/s40364-021-00296-7.Search in Google Scholar PubMed PubMed Central

26. Chandrasinghe, P, Cereser, B, Moorghen, M, Al Bakir, I, Tabassum, N, Hart, A, et al.. Role of SMAD proteins in colitis-associated cancer: from known to the unknown. Oncogene 2017;37:1–7. https://doi.org/10.1038/onc.2017.300.Search in Google Scholar PubMed

27. Yadin, D, Knaus, P, Mueller, TD. Structural insights into BMP receptors: specificity, activation and inhibition. Cytokine Growth Factor Rev 2015;27:13–34. https://doi.org/10.1016/j.cytogfr.2015.11.005.Search in Google Scholar PubMed

28. Betapudi, V, Patro, BS, Saika, S, Rahaman, SO. Editorial: TGF-β signalling pathways and their enigmatic role as a friend and foe in human health and diseases. Front Mol Biosci 2023;10:1232454. https://doi.org/10.3389/fmolb.2023.1232454.Search in Google Scholar PubMed PubMed Central

29. Guo, M, Jiang, Z, Zhang, X, Lu, D, Ha, AD, Sun, J, et al.. miR-656 inhibits glioma tumorigenesis through repression of BMPR1A. Carcinogenesis 2014;35:1698–706. https://doi.org/10.1093/carcin/bgu030.Search in Google Scholar PubMed

30. Wang, L, Xia, Z, Tang, W, Sun, Y, Wu, Y, Kwok, HF, et al.. p38 activation and viral infection. Expert Rev Mol Med 2022;24:e4. https://doi.org/10.1017/erm.2021.29.Search in Google Scholar PubMed

Supplementary Material

This article contains supplementary material (https://doi.org/10.1515/oncologie-2024-0534).

Received: 2024-10-15
Accepted: 2025-02-09
Published Online: 2025-03-04
Published in Print: 2025-03-26

© 2025 the author(s), published by De Gruyter on behalf of Tech Science Press (TSP)

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Frontmatter
  2. Review Articles
  3. Targeting HER2 in metastatic urothelial carcinoma: a contemporary review
  4. Advances in research on the impact of exosomal miRNAs on liver metastasis of colorectal cancer
  5. Sebaceous carcinoma of the intraoral origin: a literature review
  6. Role of emerging theranostic technologies in precision oncology: revolutionizing cancer diagnosis and treatment
  7. Research Articles
  8. Half-body irradiation with dose escalation in the era of advanced systemic therapies: unveiling new therapeutic opportunities
  9. Characteristics of MMR protein expression in colorectal cancer and MMR gene variations in Vietnamese patients with Lynch syndrome
  10. BMPR1A promotes the proliferation of colorectal cancer cells through the activation of Smad1
  11. Construction and validation of a diagnostic model for cholangiocarcinoma based on tumor-educated platelet RNA expression profiles
  12. Prognostic implications of PCSK9 expression in HER2-positive breast cancer
  13. Rapid Communication
  14. Potential impact of hormone replacement therapy on the risk of hepatocellular carcinoma in women of the PLCO cohort
  15. Article Commentary
  16. “Plant-based and ketogenic diets as diverging paths to address cancer”: a commentary concerning the supposed superiority of a plant-based diet
  17. Novel insights into molecular landscape of advanced renal cell carcinoma
  18. Corrigendum
  19. Corrigendum to “Y27632 induces tongue squamous cell carcinoma cell apoptosis through MAPK-ERK/JNK signal”
https://doi.org/10.1515/oncologie-2024-0534
Keywords for this article
colorectal cancer; bone morphogenetic protein receptor type 1A (BMPR1A); SMAD family member 1 (Smad1); cell proliferation
Creative Commons
BY 4.0

Articles in the same Issue

  1. Frontmatter
  2. Review Articles
  3. Targeting HER2 in metastatic urothelial carcinoma: a contemporary review
  4. Advances in research on the impact of exosomal miRNAs on liver metastasis of colorectal cancer
  5. Sebaceous carcinoma of the intraoral origin: a literature review
  6. Role of emerging theranostic technologies in precision oncology: revolutionizing cancer diagnosis and treatment
  7. Research Articles
  8. Half-body irradiation with dose escalation in the era of advanced systemic therapies: unveiling new therapeutic opportunities
  9. Characteristics of MMR protein expression in colorectal cancer and MMR gene variations in Vietnamese patients with Lynch syndrome
  10. BMPR1A promotes the proliferation of colorectal cancer cells through the activation of Smad1
  11. Construction and validation of a diagnostic model for cholangiocarcinoma based on tumor-educated platelet RNA expression profiles
  12. Prognostic implications of PCSK9 expression in HER2-positive breast cancer
  13. Rapid Communication
  14. Potential impact of hormone replacement therapy on the risk of hepatocellular carcinoma in women of the PLCO cohort
  15. Article Commentary
  16. “Plant-based and ketogenic diets as diverging paths to address cancer”: a commentary concerning the supposed superiority of a plant-based diet
  17. Novel insights into molecular landscape of advanced renal cell carcinoma
  18. Corrigendum
  19. Corrigendum to “Y27632 induces tongue squamous cell carcinoma cell apoptosis through MAPK-ERK/JNK signal”
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 27.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/oncologie-2024-0534/html?lang=en
Scroll to top button